1994

What do we know about HIV. [videorecording].: [Bethesda, Md. : NIAID, 1990] 1 videocassette (51 min., 58 sec.) : sd., col. ; 1/2 in (NIAID research grand rounds) Unique Identifier : AIDSLINE AV/9412586; Martin MA
HIV and the healthcare worker : a program in two parts. [videorecording]: Research Triangle Park, NC : Glaxo, 1992 1 videocassette : sd., col. ; 1/2 in. + 1 guide (54 p.) (The Masters of medicine series) Unique Identifier : AIDSLINE AV/9415388; Wofsy CB; Durack DT; Sexton DJ; Bartlett JA
[HIV AIDS i vardarbetet, risker och attityder.]: Stockholm : Svenska sjukhusforeningen, 1988 70 p Unique Identifier : AIDSLINE CAT/9407098
[Le:SIDA et autres maladies sexuellement transmissibles.]: Stanley, Rose-Hill, Ile Maurice : Editions de l'Ocean Indien, c1988 40 p. : ill Unique Identifier : AIDSLINE CAT/9401757; Chan Kam C
A:National study of HIV infection, AIDS, and general practice.: Newcastle upon Tyne : University of Newcastle upon Tyne, 1989 x, 94 p (Report / University of Newcastle upon Tyne, Health Care Research Unit ; no. 36) Unique Identifier : AIDSLINE CAT/9402137; Gallagher M
HIV/AIDS education : a curriculum guide for health care professionals.: New York, N.Y. : AIDS Education Center, New York University, c1989 vii, 115 p Unique Identifier : AIDSLINE CAT/9403624; Hurley PM; Arts Professions
Summary of AIDS laws from the 1988 legislative sessions.: Washington, D.C. : Intergovernmental Health Policy Project, c1989 119, 13 p Unique Identifier : AIDSLINE CAT/9404982; Bowleg IA
AIDS quarterly newsletter.: [Addis Ababa : The Ministry, v. : ill Unique Identifier : AIDSLINE CAT/9415452
American Red Cross African American HIV/AIDS instructor's manual.: [Washington, D.C.] : American National Red Cross, c1990 viii, 76 p. + 1 poster (folded) Unique Identifier : AIDSLINE CAT/9404732
Strategies for hope. No. 1-: London, U.K. : ActionAid ; Nairobi, Kenya : AMREF (African Medical and Research Foundation) ; Colchester, U.K. : World in Need, c1990- v. : ill., ports Unique Identifier : AIDSLINE CAT/9415045
The:AIDS report. Vol. 2, no. 1 (Sept./Oct 1990)-: Cambridge, Mass. : The Institute, 1990- v. : ill., ports Unique Identifier : AIDSLINE CAT/9415453
AIDS. 89-90-: Paris : New York : Medsi/McGraw Hill, c1989- v. : ill., ports Unique Identifier : AIDSLINE CAT/9414202
[Primera Encuesta Nacional sobre SIDA : informe de resultados.]: San Jose : Asociacion Demografica Costarricense, 1990 198, 25 p. : ill Unique Identifier : AIDSLINE CAT/9407169; Madrigal Pana J
Imaging of AIDS.: Philadelphia : B.C. Decker, c1991 xiii, 288 p. : ill Unique Identifier : AIDSLINE CAT/9413566; Trotot PM
AIDS research resource inventory 1983-1991 : Latin American [sic] and the Caribbean.: [Washington, D.C.?] : Pan American Health Organization/World Health Organization, [1992] xiv, 478 p. : ill Unique Identifier : AIDSLINE CAT/9412325; Weissenbacher M
The:FAHEC clinical manual for the care of patients with human immunodeficiency virus (HIV) infection or acquired immune deficiency syndrome (AIDS). 3rd ed.: [Fayetteville, N.C.] : Fayetteville Area Health Education Center, c1992 203 p Unique Identifier : AIDSLINE CAT/9410777; Ellenbogen C
The:new frontiers of oto-rhino-laryngology in Europe : proceeding [sic] of 2nd European Congress of Oto-Rhino-Laryngology and Cervico-Facial Surgery, Sorrento (Naples), June 6th-10th.: Surgery Bologna : Monduzzi, c1992 4 v. : ill Unique Identifier : AIDSLINE CAT/9411539
Laughing in the face of AIDS : a surgeon's personal battle.: Grand Rapids, Mich. : Baker Book House, c1992 160 p Unique Identifier : AIDSLINE CAT/9405612; Rozar GE; Biebel DB
The:CDC's case definition of AIDS : implications of the proposed revisions.: Washington, D.C. : Congress of the U.S., Office of Technology Assessment, [Supt. of Docs., U.S. G.P.O., distributor, 1992] vii, 93 p. : ill (HIV-related issues ; 8) Unique Identifier : AIDSLINE CAT/9411823
AIDS funding report.: Silver Spring, Md. : CD Publications, v Unique Identifier : AIDSLINE CAT/9416068
Capita selecta on aids.: Leiden : Boerhaave Commissie voor Postacademisch Onderwijs in de Geneeskunde, Rijksuniversiteit Leiden, [1993] 90 p. : ill (Boerhaave cursus) Unique Identifier : AIDSLINE CAT/9411609; Kroon FP; Geneeskunde
The:Search for antiviral drugs : case histories from concept to clinic.: Boston : Birkhauser, c1993 xii, 240 p. : ill Unique Identifier : AIDSLINE CAT/9413574; Adams J; Merluzzi VJ
Bearing witness : Gay Men's Health Crisis and the politics of AIDS.: Boulder : Westview Press, 1993 xxii, 275 p. : ill Unique Identifier : AIDSLINE CAT/9412162; Kayal PM
Social care & HIV-AIDS.: London : HMSO, 1993 x, 214 p. : ill Unique Identifier : AIDSLINE CAT/9412074
Behavioral and social sciences and the HIV/AIDS epidemic.: Syndrome Washington, DC : National Commission on AIDS, [1993] ix, 52, 6 p Unique Identifier : AIDSLINE CAT/9414664
HIV/AIDS prevention & education curriculum supplement : a manual to assist facilities.: Washington, DC (P.O. Box 17675, Washington 20041-0675) : National Association of Rehabilitation Facilities, c1993 xiv, 256 p Unique Identifier : AIDSLINE CAT/9414652; Mason C; Jaskulski T
Women and AIDS : psychological perspectives.: London : Newbury Park : Sage Publications, 1993 x, 196 p. : ill (Gender and psychology) Unique Identifier : AIDSLINE CAT/9402310; Squire C
1st Kenya HIV/AIDS/STD Conference : program and abstracts.: [Nairobi] : Ministry of Health, [1993] 63 p Unique Identifier : AIDSLINE CAT/9414673
The:biology of AIDS. 3rd ed.: Boston : Jones and Bartlett Publishers, c1994 xv, 176 p. : ill (Jones and Bartlett series in biology) Unique Identifier : AIDSLINE CAT/9418958; Fan H; Conner RF; Villarreal LP
AIDS, the politics of survival.: Amityville, N.Y. : Baywood Pub. Co., 1994 xiii, 281 p. : ill (Policy, politics, health, and medicine series) Unique Identifier : AIDSLINE CAT/9418579; Krieger N; Margo G
Information services for HIV/AIDS : recommendations to the NIH : report of a conference co-sponsored by the National Library of Medicine and the NIH Office of AIDS Research, June 28-30, 1993.: [Bethesda, Md.] : U.S. Dept. of Health and Human Services, Public Health Service, National Institutes of Health, [1994] xi, 71 p. : ill (Publication no. 94-3730) Unique Identifier : AIDSLINE CAT/9418978
Presence of HTLV-I in astroglial cells infected with cell-free virus preparation (Meeting abstract).: Chronica Dermatol; 2(3):444-5 1992. Unique Identifier : AIDSLINE ICDB/94696621; Macchi B; Graziani G; Caronti B; Lauro GM; Bonmassar E; Dept. of Experimental Medicine and Biochemical Sciences, Univ.; 'Tor Vergata,' Rome, Italy; Previous data have shown that astroglial cells express the virus core protein p19 1 wk after exposure to an HTLV-I donor cell line. In order to investigate whether HTLV-I was able to replicate within astroglial cells, glioma cell lines after 20-40 passages in vitro, were exposed to HTLV-I using a cell-free virus prepa
The dimensions of caring 1992: enhancing quality of life in palliative care. March 12-13, 1992, San Diego, CA.: The Dimensions of Caring 1992: Enhancing Quality of Life in Palliative Care. March 12-13, 1992, San Diego, CA, Green Cancer Center of Scripps Clinic and Research Foundation and San Diego Hospice, 117 p., 1992.. Unique Identifier : AIDSLINE ICDB/94696529; Anonymous; No affiliation given; The conference, Dimensions of Caring 1992: Enhancing the Quality of Life in Palliative Care, held March 12-13, 1992, in San Diego, California, was presented by the Green Cancer Center of Scripps Clinic and Research Foundation and the San Diego Hospice. There were daily opening and closing plenary presentations, but th
[Immunodeficiency syndrome: thymopentin]: Arch Monaldi Mal Torace. 1989 Jul-Dec;44(4-6):767-78. Unique Identifier : AIDSLINE MED/94092000; Micillo E; Dericoloso A; Catena E; Tranchese D; Melito P; Di Filippo O; Di Giacomo A
Dual infections of the immune system in patients with chronic active Epstein-Barr virus infection mimicking chronic fatigue syndrome.: Can Dis Wkly Rep. 1991 Jan;17 Suppl 1E:29-32. Unique Identifier : AIDSLINE MED/94073999; Purtilo DT; The etiologic bases of CFS are undetermined at the present time. It is very important to distinguish the patients with CFS as defined by the Centers for Disease Control (CDC) case definition of Holmes et al. from patients with physical and laboratory findings suggesting dual infections and/or underlying immunodeficien
[A morphological study of the liver in the acquired immunodeficiency syndrome. An analysis of 69 cases]: G E N. 1992 Apr-Jun;46(2):105-12. Unique Identifier : AIDSLINE MED/94063406; Ruiz ME; Garcia Tamayo J; Instituto Anatomopatologico, Universidad Central de Venezuela.; The morphologic findings in the liver of 69 autopsy cases with had died of AIDS are presented. The morphologic changes were represented by the presence of opportunistic germs (Histoplasma capsulatum, Mycobacteria, Cryptococcus neoformans and CMV ). Other alterati
[Terminal jaundice in progressive disseminated histoplasmosis associated with AIDS. A report of an autopsy case]: G E N. 1992 Apr-Jun;46(2):157-61. Unique Identifier : AIDSLINE MED/94063412; Sulbaran Munoz JA; Sierra de Sulbaran YB; Departamento de Anatomia Patologica, Hospital Militar Dr.; Carlos Arvelo.; The case of a 58-years-old patient with AIDS is discussed. He presented a progressive disease with discomfort, abdominal pain, hiporexia, fever and weight loss. At the time of admittance in our hospital he had hepatosplenomegaly. The patient worsened and presented asthenia, fever, oedema, ascites, pulmonary congestion
[Advances in AIDS research (editorial)]: Medicina (B Aires). 1992;52(4):374-6. Unique Identifier : AIDSLINE MED/94066763; Pasqualini CD; Bracco MM
[Physicians and AIDS: risk, compromise and social responsibility (editorial)]: Medicina (B Aires). 1992;52(6):582-5. Unique Identifier : AIDSLINE MED/94066784; Cahn P
[Accidental exposure to health care workers of blood and body fluids from patients]: Rev Med Chil. 1992 Nov;120(11):1247-53. Unique Identifier : AIDSLINE MED/94069064; Wolff M; Hidalgo S; Departamento de Medicina, Facultad de Medicina, Sede Central,; Universidad de Chile.; Due to the growing concern of Health Care Workers (HCW) regarding the possibility of acquiring blood borne infections through accidental occupational exposure and the fact that HIV and Hepatitis B infections have occurred in that setting, an evaluation of the frequency of accidents and their circumstances, suffered by
[HTLV-I clinical pathological spectrum]: Rev Med Chil. 1992 Aug;120(8):927-33. Unique Identifier : AIDSLINE MED/94069091; Cartier L; Araya F; Castillo JL; Departamento de Ciencias Neurologicas, Facultad de Medicina,; Universidad de Chile (Division Oriente), Santiago.; HTLV-I has been revealed as the etiological factor of the Tropical Spastic Paraparesis (TSP) and of the T-cell leukemia-lymphoma of the adult (ATLL). Recently, it has also been associated to some forms of polymyositis, polyarthritis, polyneuropathies, Sjogren s syndrome, thrombocytopenia and lympho-alveolitis. The cli
Paracoccidioidomycosis in a patient with HIV-1 infection [letter]: Rev Paul Med. 1992 Sep-Oct;110(5):193-4. Unique Identifier : AIDSLINE MED/94069203; Bagatin E; Goncalves VL; Sabongi VP; Sotto MN
Detection of Pneumocystis carinii in bronchoalveolar lavage fluid by dot immunobinding assay and immunofluorescence.: Eur J Med. 1992 Dec;1(8):496-8. Unique Identifier : AIDSLINE MED/94073365; Contini C; Nato F; Vullo V; Mazie JC; Mojon M; Romani R; Delia S; Sorice F; Istituto di Malattie Infecttive, Universita La Sapienza, Rome,; Italy.
Production and characterization of monoclonal antibodies to human Pneumocystis carinii for the diagnosis of P. carinii pneumonia.: Eur J Med. 1992 Jun;1(3):132-8. Unique Identifier : AIDSLINE MED/94080314; Nato F; Contini C; Zamora-Zavala C; Viscardi P; Delia S; Mojon M; Mazie JC; Hybridolab, Departement des Biotechnologies, Institut Pasteur,; Paris, France.; OBJECTIVES: Monoclonal antibodies against human Pneumocystis carinii were produced by fusion of myeloma cells (X63-AG8.653) with splenocytes from Biozzi mice that had been immunized against P. carinii cysts isolated from infected human lung. The aim of this study was to evaluate the usefulness of these monoclonal anti
Clinical relevance of herpes simplex virus in the throat of elderly with Salmonella enteritidis gastroenteritis.: Eur J Med. 1992 Jul-Aug;1(4):244-5. Unique Identifier : AIDSLINE MED/94080335; Crombach WH; Beckers EA; Claessens WL; Laboratory for Bacteriology, Virology and Immunology, St Maartens; Gasthuis, Venlo, The Netherlands.; It is not known whether the presence of Herpes simplex virus in the throat of elderly patients with severe gastroenteritis and pulmonary implications is of clinical relevance. We cultured throat swabs and faeces of elderly patients with (n = 11) and without (n = 12) severe Salmonella gastroenteritis for viruses and ba
Massive haemorrhage from rupture of a pancreatic pseudocyst after pentamidine-associated pancreatitis.: Eur J Med. 1992 Jul-Aug;1(4):251-3. Unique Identifier : AIDSLINE MED/94080338; Pais JR; Cazorla C; Novo E; Viana A; Department of Internal Medicine, Hospital Ramon y Cajal, Madrid,; Spain.; A 40 year-old man with the acquired immunodeficiency syndrome who was treated with intravenous pentamidine suffered a massive spontaneous haemorrhage caused by rupture of a pancreatic pseudocyst after pentamidine-induced pancreatitis. The patient previously presented symptomatic hypoglycaemia, severe nephrotoxicity an
Aspergillus hepatosplenic abscesses and chylous ascites: successful treatment with fluconazole.: Eur J Med. 1992 Jul-Aug;1(4):253-4. Unique Identifier : AIDSLINE MED/94080339; Soriano V; Cobo J; Gutierrez M; Castejon A; Laguna F; Gonzalez-Lahoz J; Service of Infectious Diseases, Instituto de Salud Carlos III,; Madrid, Spain.
Visceral leishmaniasis involving a cutaneous Kaposi's sarcoma lesion and free areas of skin [letter]: Eur J Med. 1992 Jul-Aug;1(4):255. Unique Identifier : AIDSLINE MED/94080340; Taillan B; Marty P; Schneider S; Telle H; Fuzibet JG; Rosenthal E; Rahal A; Lefichoux Y; Dujardin P
Fatal haemolytic uraemic syndrome in an AIDS patient [letter]: Eur J Med. 1992 Oct;1(6):378-9. Unique Identifier : AIDSLINE MED/94080355; Cotte L; Preckel MP; Cahen R; Dijoud F; Loire R; Chassard D; Trepo C
An ethical approach to screening for human immunodeficiency virus [letter; comment]: Eur J Med. 1992 Oct;1(6):382. Unique Identifier : AIDSLINE MED/94080360; Perren-Klingler G
Screening for HIV [letter; comment]: Eur J Med. 1992 Nov;1(7):446. Unique Identifier : AIDSLINE MED/94080377; Crisci C
Extrapulmonary tuberculosis. A review.: Arch Fam Med. 1992 Sep;1(1):91-8. Unique Identifier : AIDSLINE MED/94084148; Elder NC; Department of Family and Community Medicine, Oregon Health; Sciences University, Portland.; The increase in cases of tuberculosis that has occurred with the increasing number of individuals infected with the human immunodeficiency virus (HIV) has focused attention on the problems in diagnosing and treating tuberculosis. While it is primarily considered a pulmonary disease, tuberculosis has the potential to i
Zidovudine (AZT).: Arch Fam Med. 1992 Nov;1(2):250. Unique Identifier : AIDSLINE MED/94084156
Who is providing ambulatory care to Medicaid beneficiaries with acquired immunodeficiency syndrome in New York State?: Arch Fam Med. 1992 Nov;1(2):251-4. Unique Identifier : AIDSLINE MED/94084157; Howell EM; Keyes M; Mason ML; Turner BJ; Mathematica Policy Research Inc., Washington, DC.; This study examined the number of ambulatory care providers treating individuals with the acquired immunodeficiency syndrome who were Medicaid beneficiaries in New York State in 1988 and examined the distribution of this care across various practice settings. The study population was identified retrospectively in the
Fibronectin in HIV-infected patients: a prospective study.: Eur J Med. 1992 Sep;1(5):308-10. Unique Identifier : AIDSLINE MED/94084180; Raffi F; Boudart D; Merrien D; Barrier JH; Internal Medicine Department, Hotel-Dieu, Nantes, France.; Fibronectin, a non-specific opsonin involved in the clearance of microorganisms, is thought to play a role in various infectious disease processes. Its diagnostic value as a biological marker of infection and/or prognosis in human immunodeficiency virus (HIV) patients is questionable. We conducted a prospective study
Anti-idiotypic therapeutic strategies in HIV infection.: Mol Cell Biol Hum Dis Ser. 1992;1:283-308. Unique Identifier : AIDSLINE MED/94084355; Wilks D; Dalgleish AG; Department of Medicine, Addenbrooke's Hospital, Cambridge, UK.
Statistical methods for longitudinal and clustered designs with binary responses.: Stat Methods Med Res. 1992;1(3):249-73. Unique Identifier : AIDSLINE MED/94084467; Neuhaus JM; Department of Epidemiology and Biostatistics, University of; California, San Francisco 94143-0560.; Dependent binary response data arise frequently in practice due to repeated measurements in longitudinal studies or to subsampling primary sampling units as in fields such as teratology and ophthalmology. Several classes of approaches have recently been proposed to analyse such repeated binary outcome data. The differ
[Analysis of epidemiologic-sociocultural and economic course during the AIDS epidemic in the Netherlands and the scenario to the year 2000]: Przegl Lek. 1992;49(12):428. Unique Identifier : AIDSLINE MED/94089930; Skotnicki AB; Klinika Hematologii AM w Krakowie.
[Pneumocystis carinii infection. Various aspects on its clinical and laboratory diagnosis]: Rev Med Chil. 1992 Jun;120(6):634-7. Unique Identifier : AIDSLINE MED/94090063; Lorca M; Tassara R; Denegri M; Sierra P; Garcia A; Munoz P; Barria MS; Henriquez A; Caviedes I; Wu E; et al; Departamento de Pediatria, Facultad de Medicina (Division Cs.; Medicas Occidente) Universidad de Chile, Santiago.; P carinii is an opportunistic pathogenic agent able to produce severe infection that must be diagnosed promptly. We analyzed 138 samples from 100 patients suspected of having infection by P carinii. The ortho-toluidine blue and the methenamine stains were used to analyze the samples. Infection was demonstrated in 18 p
[Acalculous acute cholecystitis caused by Cryptosporidium in a patient with AIDS]: Rev Med Chil. 1992 Jul;120(7):789-93. Unique Identifier : AIDSLINE MED/94090092; Labarca J; Tagle R; Acuna G; Oddo D; Perez C; Guzman S; Departamento de Medicina Interna, Hospital Clinico de la P; Universidad Catolica de Chile, Santiago.; We report a patient with the acquired immunodeficiency syndrome who developed acute cholecystitis. Removal of the gallbladder revealed infection by Cryptosporidium spp. The clinical course after cholecystectomy was favourable. The pathogenesis and therapy of this complication in patients with AIDS is discussed.
An ethical approach to screening for human immunodeficiency virus [see comments]: Eur J Med. 1992 Jun;1(3):173-6. Unique Identifier : AIDSLINE MED/94080320; Manuel C; Auquier P; Charrel J; Enel P; Reviron D; San Marco JL; Laboratoire de Sante Publique, Faculte de Medecine, Marseille.
Short communication: possible activity of beta-carotene in patients with the AIDS related complex. A pilot study.: Med Oncol Tumor Pharmacother. 1992;9(3):151-3. Unique Identifier : AIDSLINE MED/94076882; Bianchi-Santamaria A; Fedeli S; Santamaria L; Camillo Golgi Institute of General Pathology, Centro Tumori,; University of Pavia, Italy.; In a pilot single blind study, beta-carotene (BC) supplementation produced, in ARC patients under current treatment, apparent recovery from asthenia, fever, nocturnal sweating, diarrhoea, loss in weight, and led as a result to an improvement in general health and working efficiency, but not to an improvement in multip
The British Paediatric Surveillance Unit: activities and developments in 1990 and 1991.: Commun Dis Rep CDR Rev. 1992 Dec 4;2(13):R145-8. Unique Identifier : AIDSLINE MED/94061119; Lynn R; Hall SM; British Paediatric Surveillance Unit, British Paediatric; Association, Regent's Park, London.; The British Paediatric Surveillance Unit is a joint undertaking of the British Paediatric Association, the PHLS Communicable Disease Surveillance Centre and the Department of Epidemiology at the Institute of Child Health, London. It provides an active case reporting system which aims to facilitate the surveillance of
The surveillance of communicable disease in the European Community.: Commun Dis Rep CDR Rev. 1992 Jun 19;2(7):R73-7. Unique Identifier : AIDSLINE MED/94061123; Healing TD; This article summarises the existing international structures in Europe which collate data produced by surveillance systems in individual countries. The surveillance of influenza, tuberculosis, and other infections in Europe is undertaken by the World Health Organisation (WHO), the European Community (EC), and nationa
Surveillance of HIV infection by voluntary testing in England.: Commun Dis Rep CDR Rev. 1992 Jul 17;2(8):R85-90. Unique Identifier : AIDSLINE MED/94061126; Waight PA; Rush AM; Miller E; Eighteen laboratories, which together provide primary HIV antibody testing for 43% of the population in England, collaborated in a study to record epidemiological information for all individuals voluntarily tested by them over a five year period. From the 184,113 individuals who had a first test during the study perio
Listeriosis surveillance.: Commun Dis Rep CDR Wkly. 1992 Mar 6;2(10):43. Unique Identifier : AIDSLINE MED/94061132
Regulation of HIV testing kits.: Commun Dis Rep CDR Wkly. 1992 Mar 20;2(12):51. Unique Identifier : AIDSLINE MED/94061138
AIDS and HIV-1 infection in the United Kingdom: monthly report.: Commun Dis Rep CDR Wkly. 1992 Mar 20;2(12):55-6. Unique Identifier : AIDSLINE MED/94061139
AIDS and HIV-1 infection in the United Kingdom: monthly report.: Commun Dis Rep CDR Wkly. 1992 Apr 24;2(17):77-80. Unique Identifier : AIDSLINE MED/94061148
HIV infection in a surgeon.: Commun Dis Rep CDR Wkly. 1992 May 8;2(19):85. Unique Identifier : AIDSLINE MED/94061151
Occupational exposure to HIV and use of zidovudine.: Commun Dis Rep CDR Wkly. 1992 May 8;2(19):85. Unique Identifier : AIDSLINE MED/94061152
AIDS and HIV-1 infection in the United Kingdom: monthly report.: Commun Dis Rep CDR Wkly. 1992 May 22;2(21):97-8. Unique Identifier : AIDSLINE MED/94061157
Transmission of HIV infection in the health care setting.: Commun Dis Rep CDR Wkly. 1992 May 29;2(22):99. Unique Identifier : AIDSLINE MED/94061159
AIDS and HIV-1 infection in the United Kingdom: monthly report.: Commun Dis Rep CDR Wkly. 1992 Jun 19;2(25):115-6. Unique Identifier : AIDSLINE MED/94061162
AIDS and HIV-1 infection in the United Kingdom: monthly report.: Commun Dis Rep CDR Wkly. 1992 Jul 24;2(30):137-40. Unique Identifier : AIDSLINE MED/94061167
AIDS and HIV-1 infection in the United Kingdom: monthly report.: Commun Dis Rep CDR Wkly. 1992 Jan 24;2(4):17-20. Unique Identifier : AIDSLINE MED/94061169
AIDS and HIV-1 infection in the United Kingdom: monthly report.: Commun Dis Rep CDR Wkly. 1992 Feb 21;2(8):37-8. Unique Identifier : AIDSLINE MED/94061179
Sexually transmitted diseases and HIV infection.: Commun Dis Rep CDR Wkly. 1992 Aug 21;2(34):153. Unique Identifier : AIDSLINE MED/94073284
AIDS and HIV-1 infection in the United Kingdom: monthly report.: Commun Dis Rep CDR Wkly. 1992 Aug 21;2(34):157-8. Unique Identifier : AIDSLINE MED/94073285
AIDS and HIV-1 infection in the United Kingdom: monthly report.: Commun Dis Rep CDR Wkly. 1992 Sep 18;2(38):175-6. Unique Identifier : AIDSLINE MED/94073287
Progression of the AIDS pandemic.: Commun Dis Rep CDR Wkly. 1992 Nov 20;2(47):213. Unique Identifier : AIDSLINE MED/94073288
AIDS and HIV-1 infection in the United Kingdom: monthly report.: Commun Dis Rep CDR Wkly. 1992 Nov 20;2(47):217-8. Unique Identifier : AIDSLINE MED/94073289
New guidelines on HIV testing and partner notification.: Commun Dis Rep CDR Wkly. 1992 Dec 18;2(51):231. Unique Identifier : AIDSLINE MED/94073291
AIDS and HIV-1 infection in the United Kingdom: monthly report.: Commun Dis Rep CDR Wkly. 1992 Dec 18;2(51):235-6. Unique Identifier : AIDSLINE MED/94073293
Deficiency of CD4+CD45RA+ lymphocytes in patients with glioblastoma multiforme.: Eur J Med. 1992 Oct;1(6):362-4. Unique Identifier : AIDSLINE MED/94080348; Menage P; Thibault G; Lebranchu Y; Jan M; Bardos P; Departement de Neurochirurgie, Hopital Bretonneau, Tours,; France.
Sexually transmitted diseases in England and Wales: 1981-1990.: Commun Dis Rep CDR Rev. 1992 Jan 3;2(1):R1-7. Unique Identifier : AIDSLINE MED/94084072; Catchpole MA; Data provided by genito-urinary medicine clinics, microbiology laboratories and other reports reveal a consistent picture of the epidemiology of sexually transmitted diseases in England and Wales during the 1980s. The number of new cases increased by 21% between 1981 and 1990; most of this increase being due to
Complementarities and network interactions in AIDS.: J Autoimmun. 1993 Oct;6(5):601-10. Unique Identifier : AIDSLINE MED/94059348; Susal C; Hoffman GW; Daniel V; Grant M; Opelz G; Department of Transplantation Immunology, University of; Heidelberg, Germany.; The contribution of autoimmune phenomena to the development of AIDS is not fully understood. In this paper we provide new evidence that idiotypic network interactions are operative in the development of AIDS. We furthermore present a model that involves two groups of antibodies and other molecules that are related to
Vaccination in Third World countries [editorial]: Curr Opin Immunol. 1993 Oct;5(5):683-6. Unique Identifier : AIDSLINE MED/94059426; Ada G
An ultrastructural study of HIV-infected human dendritic cells and monocytes/macrophages.: APMIS. 1993 Sep;101(9):672-80. Unique Identifier : AIDSLINE MED/94059526; Blom J; Nielsen C; Rhodes JM; Department of Molecular Cell Biology, Statens Seruminstitut,; Copenhagen, Denmark.; The ultrastructure of dendritic cells (DC) isolated from HIV-negative blood donors revealed three morphologically distinct cell types: type I had an irregularly shaped nucleus with a high content of heterochromatin and numerous short pseudopodia; type II possessed a smoother boundary, a blast-like nucleus and a few ve
Antibodies to Pneumocystis carinii in Danish blood donors and AIDS patients with and without Pneumocystis carinii pneumonia.: APMIS. 1993 Sep;101(9):707-10. Unique Identifier : AIDSLINE MED/94059531; Buhl L; Settnes OP; Andersen PL; Institute of Pathology, Aarhus University Hospital, Aarhus; Kommunehospital, Denmark.; Sera from 1) 8 AIDS patients with Pneumocystitis carinii pneumonia, 2) 13 HIV antibody-positive patients, 9 with AIDS and 4 with AIDS-related symptoms, all 13 without Pneumocystis carinii pneumonia, and 3) 36 healthy male blood donors, all HIV antibody negative, were examined for antibodies against Pneumocystis carini
Advances in AIDS Vaccine Development: 5th Annual meeting of the National Cooperative Vaccine Development Groups for AIDS. Chantilly, Virginia, August 30-September 3, 1992. Proceedings and abstracts.: AIDS Res Hum Retroviruses. 1993 Oct;9 Suppl 1:S1-167. Unique Identifier : AIDSLINE MED/94059646
Mycobacterium genavense sp. nov.: Int J Syst Bacteriol. 1993 Oct;43(4):841-3. Unique Identifier : AIDSLINE GENBANK/X60070; Bottger EC; Hirschel B; Coyle MB; Institut fur Medizinische Mikrobiologie, Medizinische Hochschule; Hannover, Germany.; Strains of a suggested novel type of mycobacterium have been repeatedly isolated from patients with AIDS. We summarize the results of tests performed to determine enzymatic activities and metabolic properties, the results of fatty acid analyses, and the results of a comparative 16S rRNA sequence determination. We prop
U.S. Congress upholds ban on HIV carriers [news]: Ann Oncol. 1993 Sep;4(8):616. Unique Identifier : AIDSLINE MED/94059786
Hodgkin's disease in the setting of HIV infection [editorial]: Ann Oncol. 1993 Sep;4(8):621-2. Unique Identifier : AIDSLINE MED/94059788; Levine AM
Hodgkin's disease during HIV1 infection: the French registry experience. French Registry of HIV-associated Tumors.: Ann Oncol. 1993 Sep;4(8):635-41. Unique Identifier : AIDSLINE MED/94059791; Andrieu JM; Roithmann S; Tourani JM; Levy R; Desablens B; le Maignan C; Gastaut JA; Brice P; Raphael M; Taillan B; Hematology-Oncology Unit, Laennec Hospital, Paris, France.; BACKGROUND: The first cases of Hodgkin s disease (HD) associated with HIV infection were reported in 1984. Since then, short series of seropositive patients suffering from HD have been published. In order to identify the characteristics, treatment response and outcome of HIV-associated Hodgkin s disease (HIV-HD), the
Role of conserved regions of class I MHC molecules in the activation of CD8+ cytotoxic T lymphocytes by peptide and purified cell-free class I molecules.: Int Immunol. 1993 Sep;5(9):1129-38. Unique Identifier : AIDSLINE MED/94059865; Takeshita T; Kozlowski S; England RD; Brower R; Schneck J; Takahashi H; DeLisi C; Margulies DH; Berzofsky JA; Molecular Immunogenetics and Vaccine Research Section, NCI, NIH,; Bethesda, MD 20892.; To analyze the molecular interactions involved in CD8+ cytotoxic T lymphocyte (CTL) recognition quantitatively, we developed a cell-free antigen presenting system. Genetically engineered soluble H-2Dd molecules coated on plastic microtiter plates could present HIV envelope peptide to an antigen-specific CTL clone, ind
Changes of IgE production, splenic helper and suppressor T lymphocytes in mice infected with Paragonimus westermani.: Korean J Parasitol. 1993 Sep;31(3):231-8. Unique Identifier : AIDSLINE MED/94059903; Min DY; Ryu JS; Shin MH; Department of Parasitology, College of Medicine, Hanyang; University, Seoul, Korea.; Effects of Paragonims westermani infection were observed in mice on the change of serum IgE level, the number of peripheral eosinophils and the distribution of Thy 1.2+ (CD3), L3T4+ (CD4), and Lyt-2+ (CD8) splenic T lymphocytes without mitogen stimulation. BALB/c mice were infected with 20 metacercariae of P. westerma
Use of nitrogen-15 kinetic isotope effects to elucidate details of the chemical mechanism of human immunodeficiency virus 1 protease.: Biochemistry. 1993 Nov 23;32(46):12380-5. Unique Identifier : AIDSLINE MED/94059947; Rodriguez EJ; Angeles TS; Meek TD; Department of Pharmaceutical Technologies, SmithKline Beecham; Pharmaceuticals, King of Prussia, Pennsylvania 19406.; We have used 15N kinetic isotope effects of the HIV-1 protease-catalyzed peptidolysis of Ac-Ser-Gln-Asn-Tyr-Pro-Val-Val-NH2 to characterize the chemical mechanism of this enzyme. In addition, the multiple isotope effects have been determined by measuring the 15N kinetic isotope effects in both H2O and D2O. The isotope
Structure of the protease from simian immunodeficiency virus: complex with an irreversible nonpeptide inhibitor.: Biochemistry. 1993 Nov 23;32(46):12498-507. Unique Identifier : AIDSLINE MED/94059962; Rose RB; Rose JR; Salto R; Craik CS; Stroud RM; Department of Biochemistry, University of California at San; Francisco 94143-0448.; A variant of the simian immunodeficiency virus protease (SIV PR), covalently bound to the inhibitor 1,2-epoxy-3-(p-nitrophenoxy)propane (EPNP), was crystallized. The structure of the inhibited complex was determined by X-ray crystallography to a resolution of 2.4 A and refined to an R factor of 19%. The variant, SIV P
An NMR study of the HIV-1 TAR element hairpin.: Biochemistry. 1993 Nov 23;32(46):12522-30. Unique Identifier : AIDSLINE MED/94059964; Jaeger JA; Tinoco I Jr; Department of Chemistry, University of California, Berkeley; 94720.; The TAR hairpin is an important part of the 5 long terminal repeat of HIV-1 and appears to be recognized by a cellular protein. A 14-base model of the native TAR hairpin 5 -GAGC[CUGGGA]-GCUC-3 (loop bases in square brackets) has been studied by proton, phosphorus, and natural abundance carbon NMR; these results are
Three-dimensional structure of a simian immunodeficiency virus protease/inhibitor complex. Implications for the design of human immunodeficiency virus type 1 and 2 protease inhibitors.: Biochemistry. 1993 Dec 7;32(48):13054-60. Unique Identifier : AIDSLINE MED/94059982; Zhao B; Winborne E; Minnich MD; Culp JS; Debouck C; Abdel-Meguid SS; Department of Macromolecular Sciences, SmithKline Beecham, King; of Prussia, Pennsylvania 19406.; Simian immunodeficiency virus (SIV) proteins have considerable amino acid sequence homology to those from human immunodeficiency virus (HIV); thus monkeys are considered useful models for the preclinical evaluation of acquired immune deficiency syndrome (AIDS) therapeutics. We have crystallized and determined the thre
Magic Johnson [letter]: J Adolesc Health. 1993 Sep;14(6):427. Unique Identifier : AIDSLINE MED/94060021; Stiffman AR; Cunningham R; Dore P
A survey of attitudes, knowledge, and behavior related to HIV testing of adolescents and young adults enrolled in alcohol and drug treatment.: J Adolesc Health. 1993 Sep;14(6):442-5. Unique Identifier : AIDSLINE MED/94060025; Friedman LS; Strunin L; Hingson R; Department of Medicine, New England Deaconess Hospital, Boston,; MA 02215.; The objectives of this study were to assess attitudes, knowledge, and behavior related to human immunodeficiency virus (HIV) antibody testing of adolescents and young adults undergoing treatment for alcohol and drug problems. Setting and subjects were 101 adolescents and young adults enrolled in a New England substanc
Sexual behavior among adolescents in Uppsala, Sweden.: J Adolesc Health. 1993 Sep;14(6):468-74. Unique Identifier : AIDSLINE MED/94060030; Klanger B; Tyden T; Ruusuvaara L; Department of Obstetrics and Gynecology, University Hospital,; Uppsala, Sweden.; The purpose of this study was to compare the sexual behavior of Swedish teenagers in the late 1980s with that in the late 1970s, when a similar study was performed in the same city. Another aim was to discover differences between boys and girls, smokers and nonsmokers, and pupils in theoretical and practical classes.
AIDS anxieties of adolescents: determinants of state and trait anxiety dimensions in a linear structural model.: J Adolesc Health. 1993 Sep;14(6):475-84. Unique Identifier : AIDSLINE MED/94060031; Strehlow U; Kampmann G; Department of Children and Adolescent Psychiatry, University of; Heidelberg, Germany.; This study presents the effects of general psychologic characteristics on acquired immunodeficiency syndrome (AIDS) anxieties and sexual behaviour of adolescents. To this end, data were collected in a complex interview and subsequently subjected to a linear structural model analysis. The questioned adolescents were di
A proportional hazards model for truncated AIDS data.: Biometrics. 1993 Sep;49(3):731-40. Unique Identifier : AIDSLINE MED/94060216; Finkelstein DM; Moore DF; Schoenfeld DA; Harvard School of Public Health, Department of Biostatistics,; Boston, Massachusetts 02115.; An important source of information on the latency period for AIDS is the data from individuals infected by contaminated blood transfusion. However, a difficulty in the analysis and interpretation of these data is that information is available only on individuals who are infected and develop the disease prior to some s
Puerperium and breast-feeding.: Curr Opin Obstet Gynecol. 1993 Oct;5(5):683-7. Unique Identifier : AIDSLINE MED/94060298; Burkman RT; Department of Obstetrics and Gynecology, Henry Ford Hospital,; Detroit, Michigan.; This review focuses on several aspects of breast-feeding, including mothers skills and attitudes, risk of HIV transmission in breast milk, lactational amenorrhea and its contraceptive effects, and the effects of anesthesia and analgesia on lactation. Also discussed is postpartum contraception and sources of referral
Assessment of the hemostatic effectiveness of human platelets treated with aminomethyltrimethyl psoralen and UV A light using a rabbit ear bleeding time technique.: Blood. 1993 Dec 1;82(11):3489-92. Unique Identifier : AIDSLINE MED/94060386; Wagner SJ; Bardossy L; Moroff G; Dodd RY; Blajchman MA; Jerome H. Holland Laboratory for the Biomedical Sciences,; American Red Cross Blood Services, Rockville, MD 20855.; The photochemical aminomethyltrimethyl psoralen (AMT), in conjunction with UV A light (UVA), has been shown to inactivate human immunodeficiency virus-1 and model viruses in platelet suspensions under conditions that have only a minimal effect on in vitro platelet properties. A rabbit ear bleeding time technique was u
Health care delivery for people with HIV infection and AIDS.: Br J Nurs. 1993 Nov 25-Dec 8;2(21):1065-9. Unique Identifier : AIDSLINE MED/94060653; Arkell S; Health care delivery for people with HIV infection and AIDS will need to change in the future to accommodate the expected increasing numbers of people affected. Nurses have an important role in preventing the spread of HIV infection and in caring for this group of people.
Using condoms to prevent transmission of HIV [letter; comment]: BMJ. 1993 Oct 16;307(6910):1007. Unique Identifier : AIDSLINE MED/94060843; Robinson NJ; Hayes R; Mulder D
Post-tropical screening. Is of little value... [letter; comment]: BMJ. 1993 Oct 16;307(6910):1008. Unique Identifier : AIDSLINE MED/94060849; Conlon CP; Peto T
Funding policies for HIV and AIDS [letter; comment]: BMJ. 1993 Oct 16;307(6910):1010. Unique Identifier : AIDSLINE MED/94060855; Adler M; Allason-Jones E; French P; George R; Mercey D
Initial and current drug use: how are they related?: Addiction. 1993 Sep;88(9):1225-31. Unique Identifier : AIDSLINE MED/94060880; Ronald PJ; Robertson JR; Edinburgh Drug Addiction Study, UK.; The present study examines how initial and current patterns of drug use are related among a group of drug users in Edinburgh. The study categorised individuals according to the year in which they first used illicit drugs. 1984 has been shown to be the year when patterns of drug use in this group began to change after
AIDS risk behaviors and knowledge among heterosexual alcoholics and non-injecting drug users.: Addiction. 1993 Sep;88(9):1257-65. Unique Identifier : AIDSLINE MED/94060883; Fitterling JM; Matens PB; Scotti JR; Allen JS Jr; Jackson Veterans Affairs Medical Center, Mississippi.; The disinhibitory effects of abusable substances on sexual behavior and the increasing HIV prevalence among heterosexuals suggest that alcoholics and non-injection drug users may be at risk for HIV infection. We examined alcohol and non-injection drug use as AIDS risk factors, AIDS risk knowledge, and the effect of AI
The tetrapeptide AcSerAspLysPro (Seraspenide), a hematopoietic inhibitor, may reduce the in vitro toxicity of 3'-azido-3'-deoxythymidine to human hematopoietic progenitors.: Stem Cells (Dayt). 1993 Sep;11(5):455-64. Unique Identifier : AIDSLINE MED/94060917; Grillon C; Bonnet D; Mary JY; Lenfant M; Najman A; Guigon M; Institut de Chimie des Substances Naturelles, CNRS, Gif sur; Yvette, France.; 3 -azido-3 -deoxythymidine ( AZT ), the main antiviral drug used in AIDS treatment, is known to induce anemia and neutropenia. These effects have been attributed to its toxicity to hematopoietic progenitors. In this report, we present a new approach to
Gynecologic issues of women with human immunodeficiency virus infection.: AWHONNS Clin Issues Perinat Womens Health Nurs. 1993;4(2):258-64. Unique Identifier : AIDSLINE MED/94061019; Jay N; Women are the fastest growing population with newly diagnosed acquired immune deficiency syndrome (AIDS) in the United States . Although little is known of specific female manifestations, research trends suggest an increase in genital tract infections and neoplasms that may be recurrent
Health hazards of nursing: identifying workplace hazards and reducing risks.: AWHONNS Clin Issues Perinat Womens Health Nurs. 1993;4(2):320-7. Unique Identifier : AIDSLINE MED/94061025; Hewitt JB; Misner ST; Levin PF; Nurses often work in settings in which they may be exposed to a wide array of psychosocial, chemical, biological, and physical hazards. The authors outline several ways in which occupational exposures occur and the general process for reducing or preventing workplace hazards. Several commonly encountered workplace haz
Localization of the human TAX-1 gene to 1q32.1: a region implicated in microcephaly and Van der Woude syndrome.: Hum Mol Genet. 1993 Sep;2(9):1461-2. Unique Identifier : AIDSLINE GENBANK/X68274; Kenwrick S; Leversha M; Rooke L; Hasler T; Sonderegger P; Department of Medicine, University of Cambridge, Addenbrooke's; Hospital, UK.
[Positive serology for syphilis in neonatal period: prevalence in secondary level maternity. Association with maternal risk factors and with positive serology for HIV-1]: Rev Assoc Med Bras. 1993 Apr-Jun;39(2):100-4. Unique Identifier : AIDSLINE MED/94061082; Guinsburg R; dos Santos AM; Leal DV; Pacheco AA; Okida KS; Trigueiro TC; Almeida MF; Kopelman BI; Disciplina de Pediatria Neonatal da Escola Paulista de Medicina,; Sao Paulo.; To study neonatal Syphilis seropositivity incidence, its association with HIV-1 seropositivity and the impact of Congenital Syphilis CDC case definition, cord blood VDRL and Indirect Hemagglutination (IHA) for Syphilis were performed in 3,664 newborns from Dec/91-July/92. A positive group was formed by those with posi
Function and homing of the lung macrophages. I. Evidence of functional heterogeneity of mobile cells of the murine lung parenchyma in the bronchoalveolar lavage (BAL).: Virchows Arch B Cell Pathol Incl Mol Pathol. 1993;64(3):191-7. Unique Identifier : AIDSLINE MED/94061308; Freudenberg N; Konarske K; Riede UN; Lamers R; Zeller S; Hammerling G; Sorg C; Usener HU; Katschinski T; Galanos C; et al; Pathologisches Institut der Universitat, Freiburg, Germany.; The object of the present investigation was to extend fundamental understanding of the composition, function and origin of bronchoalveolar lavage (BAL) cells, and to reduce the considerable gaps in our existing knowledge. BAL cells from the B10.D2 mouse were identified by morphological, enzyme cytochemical and immunoc
Hodgkin's disease [see comments]: CA Cancer J Clin. 1993 Nov-Dec;43(6):327-46. Unique Identifier : AIDSLINE MED/94061628; Weinshel EL; Peterson BA; Division of Medical Oncology, University of Minnesota Medical; School, Minneapolis.; The etiology of Hodgkin s disease is unknown, and the identity of the normal counterpart of the malignant cell involved in Hodgkin s disease remains controversial. Yet, three of every four patients diagnosed with Hodgkin s disease will be cured. This success in treatment is due in large part to the application of mode
Quantitative receptor autoradiographic analysis for angiotensin II receptors in bovine retinal microvessels: quantitation with radioluminography.: Cell Mol Neurobiol. 1993 Jun;13(3):233-45. Unique Identifier : AIDSLINE MED/94061914; Sato T; Niwa M; Himeno A; Tsutsumi K; Amemiya T; Department of Ophthalmology, Nagasaki University School of; Medicine, Japan.; 1. Specific 125I-Sar1, Ile8-Angiotensin II (125I-Sar1, Ile8-AII) binding sites in bovine retinal microvessels were investigated using the quantitative receptor autoradiographic method with pellet sections. 2. A quantitation was made with the computerized radioluminographic imaging plate system, a newly developed and h
Correlation between induction of lymphocyte apoptosis and prostaglandin E2 production by macrophages infected with HIV.: Cell Immunol. 1993 Nov;152(1):120-30. Unique Identifier : AIDSLINE MED/94062000; Mastino A; Grelli S; Piacentini M; Oliverio S; Favalli C; Perno CF; Garci E; Department of Experimental Medicine and Biochemical Sciences,; University of Rome Tor Vergata, Italy.; Several data indicate that HIV infection of antigen-presenting cells (APCs) and apoptosis of lymphocytes play important roles in pathogenesis of AIDS. We have recently demonstrated that prostaglandin E2 (PGE2) can cause thymocyte apoptosis in vivo. In the present study we have investigated the possibility that the int
Effect of CD4 engagement on CD4-T cell receptor complexes.: Cell Immunol. 1993 Nov;152(1):211-9. Unique Identifier : AIDSLINE MED/94062009; Chuck RS; Cantor CR; Tse DB; Department of Medicine, North Shore University Hospital, Cornell; University Medical College, Manhasset, New York 11030.; To detect the presence of CD4-T cell receptor (TCR) complexes, we previously developed a flow cytometric method for measuring singlet-singlet energy transfer on human T cells labeled with fluorescein isothiocyanate-conjugated anti-CD4 and tetramethylrhodamine isothiocyanate-conjugated anti-TCR. Using the same procedur
Treatment of coccidioidomycosis.: Curr Top Med Mycol. 1993;5:151-79. Unique Identifier : AIDSLINE MED/94062049; Graybill JR; Audie Murphy VA Hospital, University of Texas, Health Science; Center at San Antonio 78284-7750.; This review has traced chemotherapy of coccidioidomycosis from its unsuccessful beginnings through the present time. Although in vitro susceptibilities give initial impressions of activity of many drugs, and although animal studies identify the diseases targeted for
[Immunohistochemical study of lung tissues from patients with idiopathic pulmonary fibrosis]: Chung Hua Chieh Ho Ho Hu Hsi Tsa Chih. 1993 Jun;16(3):144-6, 186-7. Unique Identifier : AIDSLINE MED/94062060; Hou J; Dai LJ; Zhu HW; Nanjing Gu Drum Towerlou Hospital.; Immunohistochemical analysis using 24 different monoclonal and polyclonal antibodies was applied to lung biopsy and autopsy material from 9 patients with idiopathic pulmonary fibrosis (IPF) and 6 patients without lung disorders as control. Lymphoid, non-lymphoid cells and their subsets as well as extracellular matrix
[Lymphocyte subsets in labial salivary gland of Sjogren's syndrome]: Chung Kuo I Hsueh Ko Hsueh Yuan Hsueh Pao. 1993 Apr;15(2):83-8. Unique Identifier : AIDSLINE MED/94062080; Li X; PUMC Hospital, Beijing.; Using the immunohistochemical avidin-biotin-peroxidase complex (ABC) method, lymphocyte subsets in the salivary glands of 15 patients with primary Sjogren s syndrome, 7 patients with secondary Sjogren s syndrome and 4 normal controls were identified by monoclonal antibodies. The infiltrating lymphocytes were mainly T
Human immunodeficiency virus transmission between surgeons and patients in orthopaedic surgery.: Clin Orthop. 1993 Dec;(297):272-81. Unique Identifier : AIDSLINE MED/94062214; Wright JG; McGeer A; Hospital for Sick Children, Division of Orthopaedic Surgery,; Toronto, Ontario, Canada.; Surgeons are at risk for contracting human immunodeficiency virus (HIV) from patients. The risk of HIV transmission between patient and surgeon and the potential strategies to reduce the risk of HIV transmission are important. Continuous occupational exposure makes the risk of HIV transmission greater for surgeons tha
Unusual eruption of cutaneous metastases from occult gastric carcinoma shortly after HIV-1 infection.: Cutis. 1993 Sep;52(3):173-6. Unique Identifier : AIDSLINE MED/94062380; Sinicco A; Gagliano P; Caramello P; Fora R; Sciandra M; Novero D; Institute of Infectious Disease, University of Turin, Italy.; We report a case of eruptive metastases to the skin of the face and neck from a hitherto unknown gastric carcinoma, occurring in a fifty-two-year-old man (a regular blood donor), about six months after he contracted human immunodeficiency virus-1 infection. The eruption, consisting of more than thirty pea-sized cutane
Guideline for flow cytometric immunophenotyping: a report from the National Institute of Allergy and Infectious Diseases, Division of AIDS.: Cytometry. 1993 Oct;14(7):702-15. Unique Identifier : AIDSLINE MED/94062483; Calvelli T; Denny TN; Paxton H; Gelman R; Kagan J; Department of Pediatrics, Albert Einstein College of Medicine,; Bronx, New York.
Issues in biomedical ethics.: Dis Mon. 1993 Dec;39(12):869-925. Unique Identifier : AIDSLINE MED/94062504; Vevaina JR; Nora LM; Bone RC; Harborview Medical Center, San Diego, California.; Bioethics is the discipline of ethics dealing with moral problems arising in the practice of medicine and the pursuit of biomedical research. Physicians may confront ethical dilemmas regularly in their individual relationships with patients and in institutional and societal decisions on health care policy. Ethical pro
[Acute kidney failure caused by sulfadiazine stones. A complication of the therapy of toxoplasmosis in AIDS]: Dtsch Med Wochenschr. 1993 Nov 19;118(46):1683-6. Unique Identifier : AIDSLINE MED/94062559; Kronawitter U; Jakob K; Zoller WG; Rauh G; Goebel FD; Medizinische Poliklinik der Universitat, Klinikum Grosshadern,; Universitat Munchen.; A 45-year-old man with AIDS was treated for a recurrence of cerebral toxoplasmosis with sulphadiazine, 4 g, and pyrimethamine, 75 mg, daily. Owing to a lack of appetite and dysphagia he drank rather little water during the first week of treatment. On the 13th day after starting the drugs he had bilateral renal colics
[The prevention of Pneumocystis carinii pneumonia in HIV infection]: Dtsch Med Wochenschr. 1993 Nov 19;118(46):1694-7. Unique Identifier : AIDSLINE MED/94062561; Rockstroh JK; Spengler U; Sauerbruch T; Abteilung Allgemeine Innere Medizin, Medizinische; Universitatsklinik Bonn.
Failure to detect silent HIV infection by polymerase chain reaction in subjects at risk for heterosexually transmitted HIV type 1 infection.: Eur J Clin Microbiol Infect Dis. 1993 Sep;12(9):663-7. Unique Identifier : AIDSLINE MED/94062847; Luque F; Leal M; Pineda JA; Torres Y; Aguado I; Olivera M; Hernandez-Quero J; Sanchez-Quijano A; Rey C; Lissen E; Department of Biochemistry, Virgen del Rocio University Hospital,; Seville, Spain.; The prevalence of silent HIV-1 infections in subjects at risk of acquiring HIV infection by heterosexual transmission was assessed using a nested polymerase chain reaction (PCR) assay. The two groups of risk subjects consisted of 92 female prostitutes and 43 heterosexual partners of infected individuals. Appropriate p
Diagnosis of HIV-1 infection by PCR with two primer pairs.: Eur J Epidemiol. 1993 Jul;9(4):426-9. Unique Identifier : AIDSLINE MED/94063002; Quiros E; Garcia F; Gonzalez I; Cabezas T; Bernal MC; Maroto MC; Department of Microbiology, School of Medicine of Granada, Spain.; We have used two different primer pairs to assess HIV-1 infection of peripheral blood mononuclear cells (PBMC) by polymerase chain reaction (PCR). The study was carried out on 150 individuals: 50 seronegative individuals without risk behaviours for HIV-1 infection, 50 individuals with risk-behaviours but seronegative
Anti-HIV 1 antibodies prevalence in parturients through newborn testing: results of the Italian anonymous serosurvey. The Italian Collaborative Study Group of HIV Prevalence in Newborns.: Eur J Epidemiol. 1993 Jul;9(4):430-5. Unique Identifier : AIDSLINE MED/94063003; Stegagno M; Ippolito G; Costa F; Aebischer ML; Guzzanti E; Department of Child Health, University La Sapienza, Rome, Italy.; A prevalence assessment of HIV infection among parturients was performed in order to estimate the future incidence of pediatric AIDS cases and obtain data on the trend of the infection in Italy . Consecutive whole blood samples from newborns collected on filter paper from all regions
Estimation of the magnitude of the HIV epidemic among homosexual men: utilization of survey data in predictive models.: Eur J Epidemiol. 1993 Jul;9(4):436-41. Unique Identifier : AIDSLINE MED/94063004; Veugelers PJ; Van Zessen G; Hendriks JC; Sandfort TG; Coutinho RA; Van Griensven GJ; Municipal Health Service, Department of Public Health, Amsterdam,; The Netherlands.; A group of 709 randomly selected males aged 18-55 years living in the city of Amsterdam, the Netherlands , were questioned about sexual lifestyle and related behavior. A substantial proportion (10%) of these men appeared to be homo- or bisexual. Of these homo- and bisexual men,
A Cyanobacterium-like body found in the stools of an HIV+ patient with diarrhoea [letter]: Eur J Epidemiol. 1993 Jul;9(4):453-4. Unique Identifier : AIDSLINE MED/94063008; Brandonisio O; Maggi P; Panaro MA; Marangi A; Marzio R; Angarano G
Emergence of oropharyngeal candidiasis caused by non-albicans species of Candida in HIV-infected patients [letter]: Eur J Epidemiol. 1993 Jul;9(4):455-6. Unique Identifier : AIDSLINE MED/94063009; Barchiesi F; Morbiducci V; Ancarani F; Scalise G
Synergistic cytotoxicity of AZT plus alpha and gamma interferon in chronic myeloid leukemia cell line K562.: Eur J Haematol. 1993 Oct;51(4):209-13. Unique Identifier : AIDSLINE MED/94063013; Tosi P; Visani G; Ottaviani E; Gamberi B; Cenacchi A; Tura S; Istituto di Ematologia L. e A. Seragnoli, Universita di; Bologna, Italy.; We have previously reported that the antineoplastic activity of 3 -azido 3 deoxythymidine ( AZT ) can be increased by drugs that inhibit de novo thymidylate synthesis, such as 5-fluorouracil, methotrexate and hydroxyurea. In the present study we tested
The real costs of infection control.: Dent Econ. 1993 May;83(5):83-6, 88. Unique Identifier : AIDSLINE MED/94063198; Diehnelt DE
Psychosocial risk factors for HIV transmission in male drug abusers.: Genet Soc Gen Psychol Monogr. 1993 Aug;119(3):369-87. Unique Identifier : AIDSLINE MED/94063465; Brook JS; Brook DW; Whiteman M; Roberto J; Masci JR; De Catalogne J; Amundsen F; Department of Psychiatry and Behavioral Sciences New York Medical; College.; We studied the psychosocial risk factors associated with Black, Hispanic, and White (N = 257) male intravenous drug abusers needle-sharing behavior with familiar individuals and with strangers. Approximately half the subjects were HIV+. The findings supported a mediational model in that risk factors in the family dom
Inactivation of a yeast transactivator by the fused HIV-1 proteinase: a simple assay for inhibitors of the viral enzyme activity.: Gene. 1993 Nov 30;134(1):123-8. Unique Identifier : AIDSLINE MED/94063506; Murray MG; Hung W; Sadowski I; Das Mahapatra B; Schering-Plough Research Institute, Kenilworth, NJ 07033-0539.; The human immunodeficiency virus type 1 (HIV-1) proteinase (PR) and its flanking sequences have been fused in frame between the DNA-binding domain and the transcription-activation domain of the yeast protein, GAL4. As has been shown before with the 3C proteinase of Coxsackie virus B3 (CVB3) [Das Mahapatra et al., Proc
Audit of endoscopic surveillance biopsy specimens in HIV positive patients with gastrointestinal symptoms.: Gut. 1993 Oct;34(10):1429-32. Unique Identifier : AIDSLINE MED/94063602; Lim SG; Lipman MC; Squire S; Pillay D; Gillespie S; Sankey EA; Dhillon AP; Johnson MA; Lee CA; Pounder RE; University Department of Medicine, Royal Free Hospital and School; of Medicine, London.; An audit of upper gastrointestinal endoscopy in HIV infected patients with gastrointestinal symptoms assessed the frequency of disease detected by endoscopy and routine laboratory analysis of surveillance biopsy specimens. Sixty nine consecutive endoscopies were performed in 59 HIV infected patients. Endoscopic biopsy
Bleeding as a cause of death in HIV-seropositive patients with congenital clotting disorders.: Haematologia (Budap). 1993;25(2):123-9. Unique Identifier : AIDSLINE MED/94063694; Mares M; Sartori MT; Stocco D; Girolami A; Institute of Medical Semeiotics, University of Padua Medical; School, Italy.; The causes of death in a group of HIV-seropositive patients suffering from congenital clotting disorders (cCD) were studied. During the past 6 years, we have followed 19 patients with cCD and HIV infection. Eight patients fulfilled revised CDC criteria for AIDS, 6 subjects reached stage III of CDC, and 5 remained asym
AIDS.: Health Aff (Millwood). 1993 Fall;12(3):263. Unique Identifier : AIDSLINE MED/94063747
Histopathologic features in the central nervous system of 400 acquired immunodeficiency syndrome cases: implications of rates of occurrence.: Hum Pathol. 1993 Nov;24(11):1189-98. Unique Identifier : AIDSLINE MED/94063836; Rhodes RH; Department of Pathology, Case Western Reserve University School; of Medicine, Cleveland, OH.; Histopathologic lesions in the central nervous system (CNS) of 400 autopsy cases of the acquired immunodeficiency syndrome (AIDS) collected from 1982 to 1990 were studied. Lesions most closely associated with human immunodeficiency virus (HIV) infection in the CNS (perivascular macrophages, nodular encephalomyelitis,
Localization of p53 protein and human papillomavirus in anogenital squamous lesions: immunohistochemical and in situ hybridization studies in benign, dysplastic, and malignant epithelia.: Hum Pathol. 1993 Nov;24(11):1238-42. Unique Identifier : AIDSLINE MED/94063842; Walts AE; Koeffler HP; Said JW; Department of Pathology and Laboratory Medicine, Cedars-Sinai; Medical Center, Los Angeles, CA 90048.; p53 Protein is a 53-kd nuclear phosphoprotein believed to play an important role in controlling proliferation of neoplastic and normal cells. This natural tumor suppressor can be rendered ineffective (or oncogenic) by mutations in the p53 gene or by interactions with proteins synthesized by DNA-transforming viruses, i
Small lymphocytic non-Hodgkin's lymphoma of suppressor/cytotoxic T-cell phenotype [CD4(-), CD8(+)]: Hum Pathol. 1993 Nov;24(11):1253-6. Unique Identifier : AIDSLINE MED/94063844; Dorfman DM; Longtine JA; Weinberg DS; Pinkus GS; Department of Pathology, Brigham and Women's Hospital, Boston, MA; 02115.; An unusual case of small lymphocytic non-Hodgkin s lymphoma of suppressor/cytotoxic T-cell phenotype is described. The patient presented with significant involvement of the spleen, lymph nodes, and bone marrow, but without a leukemic phase. Most small lymphocytic lymphomas are of B
The pathogenesis of the neurological complications of HIV-1 infection.: Genitourin Med. 1993 Oct;69(5):333-40. Unique Identifier : AIDSLINE MED/94063870; Brew BJ; National Centre in HIV Epidemiology and Clinical Research,; Darlinghurst, Sydney, Australia.
HIV and other sexually transmitted diseases at a rural hospital in Zimbabwe.: Genitourin Med. 1993 Oct;69(5):352-6. Unique Identifier : AIDSLINE MED/94063873; Le Bacq F; Mason PR; Gwanzura L; Robertson VJ; Latif AS; Karoi District Hospital.; OBJECTIVE--To define the epidemiological characteristics of STD patients attending an outpatient clinic in rural Zimbabwe , to examine the aetiologic agents causing infection and to determine their relationship with HIV infection. SUBJECTS--319 men and 146 women, making a sample o
Outpatient follow-up in women with HIV infection in Parkside Health Authority (UK).: Genitourin Med. 1993 Oct;69(5):370-2. Unique Identifier : AIDSLINE MED/94063877; Horner PJ; McBride M; Coker RJ; Crowley S; Harris JR; Murphy SM; Weber JN; Renton AM; Department of Genitourinary Medicine and Communicable Diseases,; St Mary's Hospital, London, UK.; OBJECTIVE--To describe patterns of attendance for follow-up among HIV infected women in Parkside, UK and their correlates. DESIGN--Retrospective cohort study. SUBJECTS--103 HIV infected women. MAIN OUTCOME MEASURES--Whether patients attended for follow-up between three and 18 months. RESULTS--31% of women were married
Defective IgG2 response to Pneumovax in HIV seropositive patients.: Genitourin Med. 1993 Oct;69(5):373-6. Unique Identifier : AIDSLINE MED/94063878; Unsworth DJ; Rowen D; Carne C; Sonnex C; Baglin T; Brown DL; Department of Clinical Immunology, Addenbrooke's Hospital,; Cambridge, UK.; OBJECTIVE--To determine whether HIV (Human Immunodeficiency Virus) antibody positive adults are capable of mounting an effective immune response when immunized with polyvalent pneumococcal vaccine. DESIGN--28 patients (nine homosexual men, one bisexual man, three heterosexual females, 10 injecting drug abusers, five h
Attitudes of medical students to HIV and AIDS.: Genitourin Med. 1993 Oct;69(5):377-80. Unique Identifier : AIDSLINE MED/94063879; Evans JK; Bingham JS; Pratt K; Carne CA; Department of Genitourinary Medicine, Middlesex Hospital, London.; OBJECTIVE--To assess the knowledge and attitudes of medical students to HIV/AIDS and whether attitudes correlate with knowledge and clinical experience. To determine if students felt adequately prepared to deal with medical and psychological aspects of HIV/AIDS. SUBJECTS AND METHODS--The subjects consisted of 190 Lond
Hepatitis B infection post Engerix B vaccination [letter]: Genitourin Med. 1993 Oct;69(5):406-7. Unique Identifier : AIDSLINE MED/94063888; Huengsberg MI; Radcliffe KW; Boxall EH
Non tuberculous cavitory disease in a west African man with AIDS.: Genitourin Med. 1993 Oct;69(5):408. Unique Identifier : AIDSLINE MED/94063889; Jebakumar S; Goorney B; Mandal BK; Regional Department of Infectious Diseases, Monsall Hospital,; Manchester, UK.
HIV-1 gp41 binding to human peripheral blood mononuclear cells occurs preferentially to B Lymphocytes and monocytes.: Immunobiology. 1993 Aug;188(4-5):323-9. Unique Identifier : AIDSLINE MED/94063979; Chen YH; Bock G; Vornhagen R; Steindl F; Katinger H; Dierich MP; Ludwig Boltzmann Institute for AIDS Research, Innsbruck, Austria.; Based on our findings that HIV-1 gp41 independently of CD4 can bind to the human helper T lymphoid cell line H9, B cell line Raji and monocyte cell line U937, we characterized putative binding of HIV-1 gp41 to human peripheral blood lymphocytes (PBLs) and monocytes. Using flow cytometry (FACS), we demonstrated that th
Caveat surgeon: do orthopaedic surgeons take adequate precautions against blood-borne viral infections, in particular the human immunodeficiency virus (HIV)?: Injury. 1993 Sep;24(8):511-3. Unique Identifier : AIDSLINE MED/94064124; Asante DK; Tait GR; Glasgow Royal Infirmary, UK.; One year ago the British Orthopaedic Association issued guidelines for the prevention of cross-infection with special reference to HIV and the hepatitis viruses. We were interested to establish whether the guidelines were being widely applied and whether they had changed general orthopaedic practice. We distributed a
Epstein-Barr virus subtype distribution in angioimmunoblastic lymphadenopathy.: Int J Cancer. 1993 Nov 11;55(5):748-52. Unique Identifier : AIDSLINE MED/94064161; Borisch B; Caioni M; Hurwitz N; Dommann-Scherrer C; Odermatt B; Waelti E; Laeng RH; Kraft R; Laissue J; Pathologisches Institut, Universitat Bern.; The tissues of 16 patients bearing a T-cell lymphoma of angioimmunoblastic lymphadenopathy type (AILD-TCL) were investigated for the distribution of Epstein-Barr virus (EBV) subtypes 1 and 2. EBV-association had been proven in these cases by polymerase chain reaction (PCR) for EBV-DNA, in situ hybridization (ISH) for
Discrimination against people with HIV/AIDS [news]: Int Nurs Rev. 1993 Sep-Oct;40(5):132. Unique Identifier : AIDSLINE MED/94064234
Tuberculosis is the leading cause of death attributable to a single infectious pathogen [news]: Int Nurs Rev. 1993 Sep-Oct;40(5):133. Unique Identifier : AIDSLINE MED/94064235
WHO is recommending sweeping reforms in prisons [news]: Int Nurs Rev. 1993 Sep-Oct;40(5):133. Unique Identifier : AIDSLINE MED/94064236
Educating nurses to change their attitudes about caring for patients with HIV/AIDS.: Int Nurs Rev. 1993 Sep-Oct;40(5):144-9. Unique Identifier : AIDSLINE MED/94064239; Hewitt HH; Department of Advanced Nursing Education, University of the West; Indies, Jamaica.; Changing nurses attitude about caring for HIV/AIDS patients is a challenge for nursing leaders, who have no choice but to promote an attractive and acceptable environment in which nurses can practice safely, compassionately and knowledgeably. Below, how nursing administrators and educators can develop strategies to m
Preface: AIDS in Israel--1993.: Isr J Med Sci. 1993 Oct;29(10 Suppl):1-2. Unique Identifier : AIDSLINE MED/94064273; Maayan S; Handzel ZT; Department of Clinical Microbiology and Infectious Diseases,; Hadassah University Hospital, Jerusalem, Israel.
HIV infection and intravenous drug abuse: world perspective and epidemiology in Israel.: Isr J Med Sci. 1993 Oct;29(10 Suppl):11-4. Unique Identifier : AIDSLINE MED/94064275; Dan M; Infectious Diseases Unit, Edith Wolfson Hospital, Holon, Israel.; As the second largest group of persons to have been infected with human immunodeficiency virus (HIV) and the main source of HIV transmission to heterosexual partners in the industrialized world, intravenous drug abusers (IVDAs) play an increasingly important role in the AIDS epidemic. The situation is particularly ala
Clinical, epidemiological and natural history study of HIV-1 infection among seropositive homo/bisexuals in Israel, 1986-92. A collaborative study in three medical centers [published erratum appears in Isr J Med Sci 1993 Nov;29(11):following 755]: Isr J Med Sci. 1993 Oct;29(10 Suppl):15-8. Unique Identifier : AIDSLINE MED/94064276; Yust I; Maayan S; Burke M; Vardinon N; Moses A; Burstein R; Hendlzel Z; Bentwich Z; Department of Medicine A, Tel Aviv Medical Center (Ichilov; Hospital, Israel.; The clinical and epidemiological aspects of HIV-1 seropositive homo/bisexuals at three AIDS screening clinics in Israel were analyzed retrospectively for the 4-year period 1986-92. Of 1,526 individuals who attended the clinics a total of 238 (15.5%) were found to be HIV-1 seroposit
The epidemiology of adult AIDS and HIV infection in Israel.: Isr J Med Sci. 1993 Oct;29(10 Suppl):2-6. Unique Identifier : AIDSLINE MED/94064278; Slater PE; Costin C; Department of Epidemiology, Ministry of Health, Jerusalem,; Israel.; Between 1980 and 1992, 227 AIDS cases and 1,010 HIV seropositives were diagnosed in Israel , 222 AIDS cases and 965 seropositives occurring in persons aged 13 years and older. Among the AIDS cases, the predominant risk groups were male homo/bisexuals, intravenous drug abusers (IVDAs
Early and complete detection of HIV exposure.: Isr J Med Sci. 1993 Oct;29(10 Suppl):31-3. Unique Identifier : AIDSLINE MED/94064281; Jehuda-Cohen T; Pediatric Research Unit, B. Rappaport Faculty of Medicine,; Technion, Haifa, Israel.; Currently, HIV diagnosis relies on serology. Yet in groups at high risk for HIV serology is not sufficient because of the window period between infection and seroconversion. There is a growing body of reports on HIV-infected yet seronegative individuals. Some tests have been developed to identify exposure to HIV by it
Host immunity and the course of HIV infection.: Isr J Med Sci. 1993 Oct;29(10 Suppl):34-6. Unique Identifier : AIDSLINE MED/94064282; Bentwich Z; Wainberg MA; Ruth Ben-Ari Institute of Clinical Immunology, Kaplan Hospital,; Rehovot, Israel.; HIV infection and disease are determined to a large extent by the host s immune response. Exposure to the virus alone does not lead necessarily to long-lasting infection and the progress of HIV infection once established varies in different individuals. The development of host immunity, while either protective or enha
Sexual behavior of heterosexual men and women attending an HIV testing clinic.: Isr J Med Sci. 1993 Oct;29(10 Suppl):37-40. Unique Identifier : AIDSLINE MED/94064283; Soskolne V; Maayan S; Dormoi NE; Department of Social Medicine, Hebrew University-Hadassah (Braun); School of Public Health and Community Medicine, Jerusalem,; Israel.; The prevalence of high risk sexual behaviors was assessed among heterosexual men (n = 154) and women (n = 109) voluntarily attending an HIV testing clinic in Jerusalem. Men were found to be involved more frequently than women in nonmonogamous relationships (66% vs. 45% respectively, P
Israeli youth and AIDS: knowledge and attitude changes among high school students following an AIDS education program.: Isr J Med Sci. 1993 Oct;29(10 Suppl):41-7. Unique Identifier : AIDSLINE MED/94064284; Schenker II; Greenblatt CL; Department of Medical Ecology, Hebrew University-Hadassah (Braun); School of Public Health and Community Medicine, Jerusalem,; Israel.; A pilot project conducted in three Jerusalem schools in 1990-91 demonstrated that medical students who had received extensive training in teaching about AIDS and its prevention were able to influence the level of knowledge and attitudes on this subject among high school students. Research findings showed moderate to l
A culturally specific educational program to reduce the risk of HIV and HBV transmission among Ethiopian immigrants to Israel II: Evaluating the effect of the training program on veteran immigrant trainees.: Isr J Med Sci. 1993 Oct;29(10 Suppl):48-54. Unique Identifier : AIDSLINE MED/94064285; Shtarkshall R; Soskolne V; Chemtov D; Rosen H; Department of Social Medicine, Hebrew University-Hadassah (Braun); School of Public Health and Community Medicine, Jerusalem,; Israel.; We describe the evaluation of a program for training veteran Ethiopian immigrants to be health educators/cultural mediators. This educational intervention project was designed to lower the risk of transmission of HIV and HBV among the immigrants who arrived in Israel in Operation S
HIV/AIDS among Palestinian Arabs [published erratum appears in Isr J Med Sci 1993 Nov;29(11):following 755]: Isr J Med Sci. 1993 Oct;29(10 Suppl):7-10. Unique Identifier : AIDSLINE MED/94064286; Maayan S; Shinar E; Aefani M; Soughayer M; el Khoudary R; Rahav G; Manny N; Department of Clinical Microbiology, Hadassah University; Hospital, Jerusalem, Israel.; We studied 24 HIV-positive Palestinians who presented for medical care in the West Bank , Jerusalem and the Gaza Strip between 1987 and 1992. Three individuals, all males, were detected by bloo
Comparison of QEEG and response accuracy in good vs poorer performers during a vigilance task.: Int J Psychophysiol. 1993 Sep;15(2):123-33. Unique Identifier : AIDSLINE MED/94064457; Valentino DA; Arruda JE; Gold SM; Department of Psychology, University of Rhode Island, Kingston; 02881.; Subjects performed an auditory continuous performance test requiring them to detect targets in a series of letters presented at a rate of 2/s. 2-min samples of EEG were obtained from eight bipolar sites during a resting condition and during early and late (7-10 min) test performance. EEG power spectra from 27 subjects
Mer-N5075A, a potential HIV-1 protease inhibitor, produced by Streptomyces chromofuscus.: J Antibiot (Tokyo). 1993 Oct;46(10):1622-4. Unique Identifier : AIDSLINE MED/94064515; Kaneto R; Chiba H; Dobashi K; Kojima I; Sakai K; Shibamoto N; Nishida H; Okamoto R; Akagawa H; Mizuno S; Central Research Laboratories, Mercian Corporation, Fujisawa,; Japan.
Monoclonality in reactive lymphadenopathy: gene rearrangement and multiparameter analysis.: Hematol Pathol. 1993;7(3):143-52. Unique Identifier : AIDSLINE MED/94064529; Farhi DC; McGuire PW; Luckey CN; Department of Pathology and Laboratory Medicine, Emory University; School of Medicine, Atlanta, Georgia.; Multiparameter analysis of lymph nodes with follicular, interfollicular, and/or atypical hyperplasia was undertaken to search for monoclonality. Twenty-three patients aged 7 to 75 years (mean 32 years) were studied. One patient had a history of lymphoma; two were HIV-positive. Nodes were removed for clinical suspicion
Herpes zoster: daily marking of new vesicles in therapeutic studies. A clinical method for objective assessment of the end of the eruptive phase.: J Am Acad Dermatol. 1993 Dec;29(6):970-3. Unique Identifier : AIDSLINE MED/94064955; Runne U; Ochsendorf FR; Department of Dermatology, J.W. Goethe University,; Frankfurt/Main, Germany.; BACKGROUND: The efficacy of a therapeutic agent must be evaluated by objective criteria. However, in herpes zoster (HZ) studies there has been no generally accepted objective clinical criterion. OBJECTIVE: Our purpose was to establish a clinical method for determining objectively the point in time at which the eruptiv
Earvin Magic Johnson's HIV serostatus disclosure: effects on men's perceptions of AIDS.: J Consult Clin Psychol. 1993 Oct;61(5):887-91. Unique Identifier : AIDSLINE MED/94064980; Kalichman SC; Russell RL; Hunter TL; Sarwer DB; Department of Psychiatry and Mental Health Sciences, Medical; College of Wisconsin, Milwaukee 53226.; The effects of celebrity self-disclosure of human immunodeficiency virus (HIV) seropositivity on perceptions of HIV and Acquired Immunodeficiency Syndrome (AIDS) were investigated. AIDS-related interest and knowledge measures were collected from 468 men before and after basketball star Earvin Magic Johnson s self-disc
Augmentation of in vitro cytolytic activity of LAK cells with heated ATL-derived cell lines.: J Dermatol. 1993 Aug;20(8):457-65. Unique Identifier : AIDSLINE MED/94065001; Nakayama J; Toshitani A; Hattori T; Moroi Y; Hori Y; Department of Dermatology, Faculty of Medicine, Kyushu; University, Fukuoka, Japan.; Three adult T-cell leukemia/lymphoma-derived cell lines, MT-2, MJ, and HUT102, were investigated to determine how they responded to hyperthermia, lymphokine-activated killer (LAK) cells, or a combination of both in vitro. All three cell lines showed a similar sensitivity to LAK cells, but revealed varying degrees of s
Truth or consequences: dishonesty in dating and HIV/AIDS-related issues in a college-age population.: J Am Coll Health. 1993 Sep;42(2):51-4. Unique Identifier : AIDSLINE MED/94065012; Stebleton MJ; Rothenberger JH; University of Minnesota, Minneapolis.; This article examines the issue of dishonesty in dating among college students as it relates to the HIV/AIDS epidemic in the United States . The authors surveyed 171 under-graduates at a large midwestern university in January 1991. They conducted an analysis by gender and found signific
Comparison of anthropometric measures of men with HIV: asymptomatic, symptomatic, and AIDS.: J Am Diet Assoc. 1993 Dec;93(12):1404-8. Unique Identifier : AIDSLINE MED/94065074; Parisien C; Gelinas MD; Cossette M; Department of Nutrition, University of Montreal, Quebec, Canada.; OBJECTIVE: Anthropometric measures were performed to determine differences in estimated fat mass, lean body mass, and body weight among three groups of men infected with human immunodeficiency virus (HIV). DESIGN: This study was cross-sectional. SETTING: Local centers of community services and support groups for perso
Reversion of the SCID phenotype by human T cell grafts. Development of cross-species immunocompetence.: J Immunol. 1993 Dec 1;151(11):5948-54. Unique Identifier : AIDSLINE MED/94065148; Donjon CM; Morkowski H; Cheung RK; Leeder JS; Dosch HM; Department of Pediatrics, University of Toronto, Hospital For; Sick Children, Ontario, Canada.; Due to defective recombinase function, mice with severe combined immunodeficiency (SCID) lack functional lymphocytes and can accept human lymphoid xenografts. Xenografted animals (SCIDhum) are thought to provide a neutral environment for in vivo studies of normal, malignant or HIV-infected human cells. SCIDhum often d
Shared T cell-defined antigens on independently derived tumors.: J Immunol. 1993 Dec 1;151(11):6302-10. Unique Identifier : AIDSLINE MED/94065184; Sahasrabudhe DM; Burstyn D; Dusel JC; Hibner BL; Collins JL; Zauderer M; Cancer Center, University of Rochester School of Medicine and; Dentistry, NY 14642.; We report that a subset of tumors independently derived from a cloned line of contact-inhibited, non-tumorigenic murine fetal fibroblasts confer cross-protective immunity against each other in vivo. Concordant with the in vivo cross-protection, cytolytic T cell clones from mice immunized with one of these tumor lines
C33 antigen and M38 antigen recognized by monoclonal antibodies inhibitory to syncytium formation by human T cell leukemia virus type 1 are both members of the transmembrane 4 superfamily and associate with each other and with CD4 or CD8 in T cells.: J Immunol. 1993 Dec 1;151(11):6470-81. Unique Identifier : AIDSLINE MED/94065201; Imai T; Yoshie O; Shionogi Institute for Medical Science, Osaka, Japan.; C33 Ag and M38 Ag had been identified by mAb inhibitory to HTLV-1-induced syncytium formation. The cDNA encoding C33 Ag had revealed that it belongs to the newly defined transmembrane 4 superfamily (TM4SF). M38 Ag was detected on virtually all human cell lines and fresh leukocytes except for most granulocytes. It was
Further characterization of the interaction between the C1q subcomponent of human C1 and the transmembrane envelope glycoprotein gp41 of HIV-1.: J Immunol. 1993 Dec 1;151(11):6583-92. Unique Identifier : AIDSLINE MED/94065213; Thielens NM; Bally IM; Ebenbichler CF; Dierich MP; Arlaud GJ; Laboratoire d'Enzymologie Moleculaire, Institut de Biologie; Structurale, Grenoble, France.; Previous studies have provided evidence for activation of the human C1 complex by HIV-1, resulting from direct interaction between C1q and the external portion of the viral transmembrane envelope protein, rsgp41. The present study was undertaken to locate more precisely, within C1q and rsgp41, the sites involved in th
Various questions on AIDS.: J Indian Med Assoc. 1993 Aug;91(8):214. Unique Identifier : AIDSLINE MED/94065226; Mukherjee S; Department of Medicine, Medical College, Calcutta.
Quinolinic acid in the cerebrospinal fluid of children with symptomatic human immunodeficiency virus type 1 disease: relationships to clinical status and therapeutic response.: J Infect Dis. 1993 Dec;168(6):1380-6. Unique Identifier : AIDSLINE MED/94065260; Brouwers P; Heyes MP; Moss HA; Wolters PL; Poplack DG; Markey SP; Pizzo PA; Pediatric Branch, National Cancer Institute, NIH Clinical Center,; Bethesda, MD 20892.; Quinolinic acid (QUIN) is a neurotoxin implicated in the neurologic deficits associated with human immunodeficiency virus type 1 (HIV-1) infection. Forty children with symptomatic HIV-1 disease had elevated (P
Safety and immunogenicity of a fully glycosylated recombinant gp160 human immunodeficiency virus type 1 vaccine in subjects at low risk of infection. National Institute of Allergy and Infectious Diseases AIDS Vaccine Evaluation Group Network.: J Infect Dis. 1993 Dec;168(6):1387-95. Unique Identifier : AIDSLINE MED/94065261; Belshe RB; Clements ML; Dolin R; Graham BS; McElrath J; Gorse GJ; Schwartz D; Keefer MC; Wright P; Corey L; et al; Dept. of Medicine, St. Louis University School of Medicine, MO; 63104.; Recombinant gp160 derived from human immunodeficiency virus type 1 (HIV-1)IIIB and produced in mammalian tissue culture cells using a vaccinia virus expression system (rgp160-mam) was evaluated as a vaccine in combination with alum and deoxycholate adjuvant. Sixty low-risk, uninfected subjects received 12.5 micrograms
Cross-reactive response to human immunodeficiency virus type 1 (HIV-1) gp120 and HLA class I heavy chains induced by receipt of HIV-1-derived envelope vaccines.: J Infect Dis. 1993 Dec;168(6):1396-403. Unique Identifier : AIDSLINE MED/94065262; De Santis C; Robbioni P; Longhi R; Lopalco L; Siccardi AG; Beretta A; Roberts NJ Jr; Department of Biological and Technological Research, Ospedale S.; Raffaele, Milan, Italy.; Autoantibodies specific to HLA class I antigens were detected in the sera of persons vaccinated with human immunodeficiency virus type 1-derived recombinant vaccines by using synthetic peptides representing the amino acid sequences recognized by an HLA class I/gp120 cross-reactive monoclonal antibody. Study subjects r
The association between circumcision status and human immunodeficiency virus infection among homosexual men.: J Infect Dis. 1993 Dec;168(6):1404-8. Unique Identifier : AIDSLINE MED/94065263; Kreiss JK; Hopkins SG; Department of Epidemiology, University of Washington, Seattle.; To evaluate whether uncircumcised status is correlated with acquisition of human immunodeficiency virus (HIV), 502 homosexual men were surveyed; 85% were circumcised. HIV infection was significantly associated with uncircumcised status (odds ratio [OR], 2.2; 95% confidence interval [CI], 1.2, 3.8), nonwhite race, intr
Early abnormalities of the antibody response against Mycobacterium tuberculosis in human immunodeficiency virus infection.: J Infect Dis. 1993 Dec;168(6):1409-14. Unique Identifier : AIDSLINE MED/94065264; Saltini C; Amicosante M; Girardi E; Antonucci G; Ippolito G; Ameglio F; Monno T; Congedo P; Angarano G; Babudieri S; et al; Institute of Tuberculosis and Chest Diseases, University of; Modena, Italy.; Among human immunodeficiency virus (HIV)-infected persons, those who react against purified protein derivative (PPD) have higher risk of tuberculosis. Since PPD testing has limited predictive power in HIV-positive populations, new markers of antituberculous immunity were sought by analyzing antibodies to Mycobacterium
Systemic cell-mediated immune reactivity in women with recurrent vulvovaginal candidiasis.: J Infect Dis. 1993 Dec;168(6):1458-65. Unique Identifier : AIDSLINE MED/94065271; Fidel PL Jr; Lynch ME; Redondo-Lopez V; Sobel JD; Robinson R; Division of Infectious Diseases, Wayne State University, School; of Medicine, Detroit, Michigan.; It has been suggested that impaired cell-mediated immunity (CMI) against Candida antigens is responsible for susceptibility to recurrent vulvovaginal candidiasis (RVVC) in adult women. To address this, we conducted a comprehensive longitudinal study examining in vivo and in vitro systemic CMI reactivity in RVVC patien
Primary human immunodeficiency virus type 1 infection: review of pathogenesis and early treatment intervention in humans and animal retrovirus infections.: J Infect Dis. 1993 Dec;168(6):1490-501. Unique Identifier : AIDSLINE MED/94065276; Niu MT; Stein DS; Schnittman SM; Medical Branch, NIAID, NIH, Bethesda, MD 20892.; Primary human immunodeficiency virus type 1 (HIV-1) infection can present clinically as the abrupt onset of a febrile illness resembling acute mononucleosis. The symptoms coincide with high titers of culturable plasma viremia, cell-associated virus, and antigenemia, which rapidly decrease coincident with the emergence
Intravitreal ganciclovir concentration after intravenous administration in AIDS patients with cytomegalovirus retinitis: implications for therapy.: J Infect Dis. 1993 Dec;168(6):1506-9. Unique Identifier : AIDSLINE MED/94065278; Kuppermann BD; Quiceno JI; Flores-Aguilar M; Connor JD; Capparelli EV; Sherwood CH; Freeman WR; Department of Ophthalmology, University of California, San Diego,; School of Medicine.; To determine whether therapeutic intravitreal concentrations of ganciclovir are achieved after intravenous administration, vitreous samples were obtained intraoperatively from 23 eyes of 22 AIDS patients with retinal detachments associated with cytomegalovirus (
Evidence of previous infection with Mycobacterium avium-Mycobacterium intracellulare complex among healthy subjects: an international study of dominant mycobacterial skin test reactions.: J Infect Dis. 1993 Dec;168(6):1553-8. Unique Identifier : AIDSLINE MED/94065289; von Reyn CF; Barber TW; Arbeit RD; Sox CH; O'Connor GT; Brindle RJ; Gilks CF; Hakkarainen K; Ranki A; Bartholomew C; et al; Infectious Disease Section, Dartmouth-Hitchcock Medical Center,; Lebanon, NH 03756.; Skin tests with 0.1 mL of intermediate-strength Mycobacterium tuberculosis purified protein derivative (PPD) and 0.1 mL of Mycobacterium avium sensitin were conducted on 484 healthy subjects from diverse geographic sites. Reactions of > or = 5 mm to one antigen that exceeded the reaction to the other by > or = 3 mm we
Low serum levels of oral antimycobacterial agents in patients with disseminated Mycobacterium avium complex disease.: J Infect Dis. 1993 Dec;168(6):1559-62. Unique Identifier : AIDSLINE MED/94065290; Gordon SM; Horsburgh CR Jr; Peloquin CA; Havlik JA Jr; Metchock B; Heifets L; McGowan JE Jr; Thompson SE 3d; Department of Medicine, Emory University School of Medicine,; Atlanta, Georgia.; Twenty-seven human immunodeficiency virus-infected patients with disseminated Mycobacterium avium complex disease who were treated with oral antimycobacterial agents (clofazimine, ciprofloxacin, ethambutol, and rifampin) were studied to evaluate the usefulness of monitoring serum drug concentrations and testing in vit
Defective antifungal activity of monocyte-derived macrophages from human immunodeficiency virus-infected children against Aspergillus fumigatus.: J Infect Dis. 1993 Dec;168(6):1562-5. Unique Identifier : AIDSLINE MED/94065291; Roilides E; Holmes A; Blake C; Pizzo PA; Walsh TJ; Infectious Diseases Section, National Cancer Institute, National; Institutes of Health, Bethesda, Maryland 20892.; Invasive aspergillosis recently has been encountered in adults and children with human immunodeficiency virus (HIV) infection even without known risk factors, such as neutropenia or corticosteroid therapy. Macrophages play a significant role in the host defenses against Aspergillus organisms by ingesting conidia and p
Small subunit rRNA sequence of Enterocytozoon bieneusi and its potential diagnostic role with use of the polymerase chain reaction.: J Infect Dis. 1993 Dec;168(6):1570-5. Unique Identifier : AIDSLINE GENBANK/L07123; Zhu X; Wittner M; Tanowitz HB; Kotler D; Cali A; Weiss LM; Department of Pathology (Division of Parasitology and Tropical; Medicine, Albert Einstein College of Medicine, Bronx, New York; 10461.; In the past several years, microsporidia have become recognized as another important group of opportunistic infections of immunocompromised patients, especially those with AIDS. Enteric infections with the noncultivatable microsporidian parasite Enterocytozoon bieneusi have been diagnosed from AIDS patients with chron
Detection of Toxoplasma gondii by competitive DNA amplification of bronchoalveolar lavage samples.: J Infect Dis. 1993 Dec;168(6):1585-8. Unique Identifier : AIDSLINE MED/94065296; Bretagne S; Costa JM; Vidaud M; Tran J; Nhieu V; Fleury-Feith J; Laboratoire de Parasitologie, Hopital Henri Mondor, Creteil,; France.; The prevalence of pulmonary toxoplasmosis was assessed by a prospective analysis of 144 bronchoalveolar lavage (BAL) samples using competitive polymerase chain reaction (PCR) to avoid false-negative results due to PCR techniques. Six samples were excluded because they contained amplification reaction inhibitors. None
Spontaneous lymphocyte proliferation in human T lymphotropic virus type II infection is associated with increased provirus load.: J Infect Dis. 1993 Dec;168(6):1599-600. Unique Identifier : AIDSLINE MED/94065303; Prince HE; Swanson P
Treatment trials for primary human immunodeficiency virus type 1 infection [letter]: J Infect Dis. 1993 Dec;168(6):1601-2. Unique Identifier : AIDSLINE MED/94065304; Niu MT; Stein DS; Schnittman SM
[Progress on the study of allergy and immunology in the field of internal medicine]: Nippon Naika Gakkai Zasshi. 1993 Sep 10;82(9):1305-12. Unique Identifier : AIDSLINE MED/94065371; Kimura I
[Autoimmune thyroiditis]: Nippon Naika Gakkai Zasshi. 1993 Sep 10;82(9):1341-55. Unique Identifier : AIDSLINE MED/94065375; Nagataki S
Effect of health education programme on knowledge about AIDS and HIV transmission in paramedical personnel working in Benha hospitals.: J Egypt Public Health Assoc. 1993;68(1-2):143-59. Unique Identifier : AIDSLINE MED/94065527; Wassif OM; el-Gendy MF; Saleh MA; el-Sawaf EM; Department of Community, Environmental and Occupational Medicine,; Benha Faculty of Medicine, Zagazig University.; Accurate information about acquired immunodeficiency Syndrome (AIDS) and human immunodeficiency virus (HIV) is important for prevention. This study is intended to asses AIDS knowledge in paramedical personnel working in Benha Hospitals and to measure the effect of health education programme done on knowledge about AID
H-2Dd exploits a four residue peptide binding motif.: J Exp Med. 1993 Dec 1;178(6):1877-92. Unique Identifier : AIDSLINE MED/94065556; Corr M; Boyd LF; Padlan EA; Margulies DH; Molecular Biology Section, National Institute of Allergy and; Infectious Diseases, National Institutes of Health, Bethesda,; Maryland 20892.; We have characterized the amino acid sequences of over 20 endogenous peptides bound by a soluble analog of H-2Dd, H-2Dds. Synthetic analogs corresponding to self, viral, tumor, or motif peptides were then tested for their ability to bind to H-2Dd by serologic epitope induction assays using both purified soluble protei
Patient attitudes toward rooming with persons with HIV infection.: J Fam Pract. 1993 Dec;37(6):564-8. Unique Identifier : AIDSLINE MED/94065608; Seltzer E; Schulman KA; Brennan PJ; Lynn LA; Department of Medicine, University of Pennsylvania, Philadelphia.; BACKGROUND. Early in the HIV epidemic, hospitals developed strict isolation policies for patients with HIV infection, some of which have not been revised. The objectives of this study were to examine patient attitudes about rooming with persons with various medical conditions, including HIV, and to assess their knowle
Multiple pneumonias in a man infected with HIV.: J Fam Pract. 1993 Dec;37(6):610-5. Unique Identifier : AIDSLINE MED/94065614; Carmichael JK; Parikh TM; Department of Family Medicine, University of Arizona College of; Medicine, Tucson 85719.; There are many pathogens responsible for pneumonia in persons infected with HIV. This case report describes a patient with pneumonias diagnosed sequentially and caused by Pneumocystis carinii, Mycobacterium gordonae, and Coccidioides immitis. It demonstrates the importance of pursuing a definitive or additional diagno
Hexamethylene bisacetamide activates the human immunodeficiency virus type 1 provirus by an NF-kappa B-independent mechanism.: J Gen Virol. 1993 Nov;74 ( Pt 11):2401-8. Unique Identifier : AIDSLINE MED/94065666; Vlach J; Pitha PM; Oncology Center, Johns Hopkins University, Baltimore, Maryland; 21231.; Expression of the human immunodeficiency virus type 1 (HIV-1) provirus in T lymphocytic and monocytic cells can be induced by treatment with hexamethylene bisacetamide (HMBA). The induction occurs at the transcriptional level within 1 to 3 h after the addition of the drug, and is not associated with detectable changes
Feline immunodeficiency virus gene expression: analysis of the RNA splicing pattern and the monocistronic rev mRNA.: J Gen Virol. 1993 Nov;74 ( Pt 11):2409-17. Unique Identifier : AIDSLINE GENBANK/M59418; Tomonaga K; Shin YS; Fukasawa M; Miyazawa T; Adachi A; Mikami T; Department of Veterinary Microbiology, Faculty of Agriculture,; University of Tokyo, Japan.; The transcription pattern of the feline immunodeficiency virus (FIV) genome in a feline CD4+ cell line was examined. In addition to the genomic RNA (9.2 kb), at least five FIV-specific transcripts [5.2, 4.4 (doublet), 1.7 and 1.4 kb] were detected by using subgenomic restriction enzyme fragments of an FIV molecular cl
Complete sequence conservation of the human T cell leukaemia virus type 1 tax gene within a family cluster showing different pathologies.: J Gen Virol. 1993 Nov;74 ( Pt 11):2531-7. Unique Identifier : AIDSLINE MED/94065685; Major ME; Nightingale S; Desselberger U; Regional Virus Laboratory, East Birmingham Hospital, U.K.; We have amplified, through PCR, the full-length tax gene of human T cell leukaemia virus type 1 (HTLV-1) derived from proviral DNA of peripheral blood lymphocytes of five first degree relatives of Afro-Caribbean origin. One patient (the father) had adult T cell leukaemia (ATL), one (the mother) tropical spastic parapa
Current management of cytomegalovirus disease.: J Med Virol. 1993;Suppl 1:106-11. Unique Identifier : AIDSLINE MED/94065689; Griffiths PD; Department of Virology, Royal Free Hospital School of Medicine,; London, United Kingdom.; Cytomegalovirus ( CMV ) is an important pathogen for the fetus, for allograft recipients, and for acquired immunodeficiency syndrome (AIDS) patients; the clinical features in each of these groups of patients are described. CMV may also act as a cofactor to acceler
Cytomegalovirus infection in acquired immune-deficiency syndrome.: J Med Virol. 1993;Suppl 1:128-33. Unique Identifier : AIDSLINE MED/94065693; Katlama C; Departement de Pathologie, Infectieuse, Tropicale et de Sante; Publique, Hopital de la Salpetriere, Paris, France.; Cytomegalovirus ( CMV ) infection is very common in acquired immune deficiency syndrome (AIDS) with approximately 40% of patients presenting CMV visceral involvement at advanced stage disease. The most common localizations are retinitis and gastrointestinal involv
Potential for combined therapy with 348U87, a ribonucleotide reductase inhibitor, and acyclovir as treatment for acyclovir-resistant herpes simplex virus infection.: J Med Virol. 1993;Suppl 1:146-9. Unique Identifier : AIDSLINE MED/94065697; Safrin S; Schacker T; Delehanty J; Hill E; Corey L; Department of Medicine, Epidemiology and Biostatistics,; University of California, San Francisco.; Inhibitors of the ribonucleotide reductase of herpes simplex viruses (HSV) potentiate the activity of acyclovir in vitro and in animal studies. In addition, the combination of the ribonucleotide reductase inhibitor 348U87 and acyclovir has synergistic therapeutic effects against
Valaciclovir (BW256U87): the L-valyl ester of acyclovir.: J Med Virol. 1993;Suppl 1:150-3. Unique Identifier : AIDSLINE MED/94065698; Jacobson MA; Medical Service, San Francisco General Hospital, CA 94110.; Valaciclovir (BW256U87) is an L-valyl ester of acyclovir , which is extensively and almost completely converted to acyclovir. In healthy human volunteers, single valaciclovir doses of 100-1000 mg resulted in dose-proportional increases in acyclovir area under the curve (AUC). The
Impact of herpesvirus infections in the future.: J Med Virol. 1993;Suppl 1:158-64. Unique Identifier : AIDSLINE MED/94065700; Levin MJ; University of Colorado Health Sciences Center, School of; Medicine, Denver.; Numerous diverse, often opposing, trends will determine the frequency (and severity) of herpesvirus infections in the future. A major factor is the growing population of iatrogenically immunocompromised patients, accruing especially from large increases in organ and autologous bone marrow transplantation. Of even grea
Acyclovir: discovery, mechanism of action, and selectivity.: J Med Virol. 1993;Suppl 1:2-6. Unique Identifier : AIDSLINE MED/94065702; Elion GB; Wellcome Research Laboratories, Research Triangle Park, North; Carolina.; The reasons for acyclovir s activity and selectivity in cells infected with HSV or VZV may be summarized as follows: 1. Activation by a HSV- or VZV-specified TK. 2. Greater sensitivity of viral DNA polymerase than of the cellular polymerases to ACV-TP. 3. Inactivation of the viral DNA polymerase, but not the cellular
Herpes simplex virus infections during the decade since the licensure of acyclovir.: J Med Virol. 1993;Suppl 1:7-12. Unique Identifier : AIDSLINE MED/94065711; Corey L; Department of Laboratory Medicine, University of Washington,; Seattle 98144.; The development and use of acyclovir accelerated in the area of the natural history, epidemiology, and biology of herpes simplex viruses. The development of serologic assays that differentiate HSV-1 from HSV-2 demonstrated the worldwide distribution of
Behcet's disease and Sjogren syndrome in a patient with HTLV-I-associated myelopathy [letter]: J Neurol Sci. 1993 Oct;119(1):121-2. Unique Identifier : AIDSLINE MED/94065845; Kanazawa H; Ijichi S; Eiraku N; Igakura T; Higuchi I; Nakagawa M; Kuriyama M; Tanaka S; Osame M
HIV infection [letter]: J Obstet Gynecol Neonatal Nurs. 1993 Sep-Oct;22(5):400-1. Unique Identifier : AIDSLINE MED/94065945; Hutchinson MK; Department of Individual and Family Studies, University of; Delaware, Newark.
Preparation and anti-HIV activity of O-acylated heparin and dermatan sulfate derivatives with low anticoagulant effect.: J Med Chem. 1993 Nov 12;36(23):3546-55. Unique Identifier : AIDSLINE MED/94066102; Barzu T; Level M; Petitou M; Lormeau JC; Choay J; Schols D; Baba M; Pauwels R; Witvrouw M; De Clercq E; Sanofi Recherche-Centre Choay, Gentilly, France.; In order to increase the ratio of anti-HIV activity to anticoagulant activity, glycosaminoglycan derivatives selectively substituted at OH and/or COOH groups were prepared. Standard heparin, heparin fragments, or dermatan sulfate were converted to their tributylammonium or tetrabutylammonium salts. Their selective O-a
Simple assay system for detecting human T cell leukemia virus type I-binding cells and its application in titrating binding inhibitory antibodies.: Lab Invest. 1993 Nov;69(5):629-34. Unique Identifier : AIDSLINE MED/94066376; Akari H; Kannagi M; Shinjo T; Harada S; Department of Biodefence and Medical Virology, Kumamoto; University School of Medicine, Japan.; BACKGROUND: A simple and rapid assay system for the detection of human T cell leukemia virus type I (HTLV-I) binding cells was developed to assess the virus specific receptor and titrate the antibodies to block the virus binding. EXPERIMENTAL DESIGN: Cells (5 x 10(5)) were incubated with 100 microliters of the concent
Educating school nurses to care for HIV-infected children in school.: J Sch Health. 1993 Sep;63(7):307-11. Unique Identifier : AIDSLINE MED/94066386; Gross EJ; Passannante M; National Pediatric HIV Resource Center, UMD-New Jersey Medical; School, Children's Hospital of New Jersey, Newark 07107.; Effects of an educational program on school nurses knowledge and attitudes about human immunodeficiency virus (HIV) infection in children and changes in practice was investigated. Participants (N = 205) attended a one-day workshop held at 11 sites in New Jersey. Content was clinically focused and derived from a needs
Quantitative study of the control of HIV-1 gene expression.: J Theor Biol. 1993 Jul 21;163(2):199-221. Unique Identifier : AIDSLINE MED/94066453; Hammond BJ; Laboratory of Mathematical Biology, National Institute for; Medical Research, London, U.K.; The biochemical processes that together determine the expression of a human immunodeficiency virus (HIV) provirus integrated into the genome of a host cell are translated into mathematical form to give a dynamic model that can be examined quantitatively. The model includes the contribution of cellular enhancers to tra
Constitutive production of interleukin-8 (IL-8) by normal and malignant human B-cells and other cell types.: Leuk Res. 1993 Dec;17(12):1063-9. Unique Identifier : AIDSLINE MED/94066565; Srivastava MD; Srivastava R; Srivastava BI; Roswell Park Cancer Institute, Department of Laboratory Medicine,; Buffalo, NY 14263.; The culture supernatants from 43 human cell lines obtained during log phase and from purified normal peripheral blood B-lymphocytes cultured at 10(6) cells ml-1 for 48 h in RPMI 1640-5% fetal calf serum were examined for interleukin-8 (IL-8) using Elisa kits. Constitutive IL-8 production was found for 14/15 B-cell lin
Rhinoscleroma: a growing concern in the United States? Mayo Clinic experience.: Mayo Clin Proc. 1993 Dec;68(12):1151-7. Unique Identifier : AIDSLINE MED/94066571; Andraca R; Edson RS; Kern EB; Department of Otorhinolaryngology, Mayo Clinic Rochester,; Minnesota 55905.; Rhinoscleroma is a chronic, progressive, granulomatous infection of the upper airways caused by the bacterium Klebsiella rhinoscleromatis. Although most cases occur in developing countries, recent immigration patterns have led to an increasing number of patients with rhinoscleroma in the U
Rhinoscleroma in perspective [editorial]: Mayo Clin Proc. 1993 Dec;68(12):1219. Unique Identifier : AIDSLINE MED/94066586; Toohill RJ
Physicians know how to be good educators too: a comparison of the patient problem solving process and the instructional design process.: Med Teach. 1993;15(2-3):175-8. Unique Identifier : AIDSLINE MED/94066723; Benjamin S; Hamdy H; Ministry of Health, Manama, Bahrain.; Education should be viewed as one of the important roles of a physician. Yet, because physicians generally are not trained to be educators, many instructional sessions, lectures and workshop presentations are ineffective because the instructional design process has been ignored. While not a substitute for professional
The coming crisis of public health in the suburbs.: Milbank Q. 1993;71(4):543-64; discussion 565-74. Unique Identifier : AIDSLINE MED/94066923; Wallace R; Wallace D; New York Psychiatric Institute.; A process of urban decay, coupled with forced displacement and behavioral problems, affecting an increasing number of neighborhoods in large U.S. cities. The resulting social disintegration has intensified a nexus of deviant behaviors and conditions, including substance abuse, that are related to transmission of HIV a
HIV transmission between two adolescent brothers with hemophilia.: MMWR Morb Mortal Wkly Rep. 1993 Dec 17;42(49):948-51. Unique Identifier : AIDSLINE MED/94066935; In July 1992, the National Hemophilia Foundation and CDC received a report from a hemophilia-treatment center of a 19-year-old man with hemophilia (patient 2) who recently had seroconverted for antibody to human immunodeficiency virus (HIV). This report summarizes the findings of an investigation by CDC and state and
Estimates of future global tuberculosis morbidity and mortality.: MMWR Morb Mortal Wkly Rep. 1993 Dec 17;42(49):961-4. Unique Identifier : AIDSLINE MED/94066937; Tuberculosis (TB) is the leading cause of death associated with infectious diseases globally. The incidence of TB is expected to increase substantially worldwide during the next 10 years because of the interaction between the TB and human immunodeficiency virus (HIV) epidemics. This report uses TB notification data (i
[Inhibition of reproduction of the human immunodeficiency virus by sense and antisense oligodeoxynucleotides]: Mol Biol (Mosk). 1993 Sep-Oct;27(5):1039-43. Unique Identifier : AIDSLINE MED/94067062; Pokrovskii AG; Pliasunova OA; Blinov VM; Vlasov VV; Svinarchuk FP; Abramova TV; Gorn VV; Konevets DA; Inhibitory effects on human immunodeficiency virus (HIV) reproduction on lymphoid cell line MT-4 were characterized for antisense and sense oligodeoxynucleotides. It was established that antisense oligonucleotide pCGTAGTTCGTCGAGGTCCGT (MP-20) (ID50 = 0.1 microM) is a more effective HIV inhibitor than the previously de
A novel hepatitis B virus (HBV) genetic element with Rev response element-like properties that is essential for expression of HBV gene products.: Mol Cell Biol. 1993 Dec;13(12):7476-86. Unique Identifier : AIDSLINE MED/94067108; Huang J; Liang TJ; Gastrointestinal Unit, Massachusetts General Hospital, Boston.; Many viruses possess complex mechanisms involving multiple gene products and cis-regulatory elements in order to achieve a fine control of their gene expression at both transcriptional and posttranscriptional levels. Hepatitis B virus (HBV) and retroviruses share many structural and functional similarities. In this st
Phosphatidylinositol (PI) 3-kinase and PI 4-kinase binding to the CD4-p56lck complex: the p56lck SH3 domain binds to PI 3-kinase but not PI 4-kinase.: Mol Cell Biol. 1993 Dec;13(12):7708-17. Unique Identifier : AIDSLINE MED/94067131; Prasad KV; Kapeller R; Janssen O; Repke H; Duke-Cohan JS; Cantley LC; Rudd CE; Division of Tumor Immunology, Dana-Farber Cancer Institute,; Boston, Massachusetts 02115.; CD4 serves as a receptor for major histocompatibility complex class II antigens and as a receptor for the human immunodeficiency virus type 1 (HIV-1) viral coat protein gp120. It is coupled to the protein-tyrosine kinase p56lck, an interaction necessary for an optimal response of certain T cells to antigen. In additio
Enhancement of HIV-1 gp41 binding to Raji cells by PWM, LPS, interferon-gamma and interleukin-6.: Mol Immunol. 1993 Dec;30(17):1583-6. Unique Identifier : AIDSLINE MED/94067176; Chen YH; Opitz S; Bock G; Steindl F; Katinger H; Dierich MP; Ludwig-Boltzmann-Institut fur AIDS-Forschung, Innsbruck,; Austria.; Based on our finding that HIV-1 gp41 independently of CD4 can bind to several proteins (gp41 binding protein: GBP) on the human T-cell line H9, B-cell line Raji and monocyte-cell line U937, we examined the effect of mitogens and cytokines on binding of gp41 to H9, Raji and U937 cells. Flow cytometry (FACS) analysis de
Transmission from one child to another of human immunodeficiency virus type 1 with a zidovudine-resistance mutation [see comments]: N Engl J Med. 1993 Dec 16;329(25):1835-41. Unique Identifier : AIDSLINE MED/94067210; Fitzgibbon JE; Gaur S; Frenkel LD; Laraque F; Edlin BR; Dubin DT; Department of Molecular Genetics, University of Medicine and; Dentistry of New Jersey-Robert Wood Johnson Medical School,; Piscataway 08854.; BACKGROUND AND METHODS. We describe a child who apparently acquired human immunodeficiency virus type 1 (HIV-1) infection in the home setting. The suspected source of infection was a child with the acquired immunodeficiency syndrome who had received zidovudine and whose virus contained a mutation associated with in vi
HIV prevention--bringing the message home [editorial; comment]: N Engl J Med. 1993 Dec 16;329(25):1883-5. Unique Identifier : AIDSLINE MED/94067219; Simonds RJ; Rogers MF
Zidovudine in asymptomatic HIV infection [letter]: N Engl J Med. 1993 Dec 16;329(25):1895; discussion 1895-6. Unique Identifier : AIDSLINE MED/94067229; Phillips AN; Sabin CA
Images in clinical medicine. Coccidioides immitis.: N Engl J Med. 1993 Dec 23;329(26):1935. Unique Identifier : AIDSLINE MED/94067240; de la Maza LM
Case records of the Massachusetts General Hospital. Weekly clinicopathological exercises. Case 51-1993. A 36-year-old man with AIDS, increase in chronic diarrhea, and intermittent fever and chills.: N Engl J Med. 1993 Dec 23;329(26):1946-54. Unique Identifier : AIDSLINE MED/94067243
Changes in the mix of AIDS-defining conditions [letter]: N Engl J Med. 1993 Dec 23;329(26):1962. Unique Identifier : AIDSLINE MED/94067246; Weiss PJ; Wallace MR; Olson PE; Rossetti R
More on HTLV tax and mycosis fungoides [letter; comment]: N Engl J Med. 1993 Dec 30;329(27):2035; discussion 2035-6. Unique Identifier : AIDSLINE MED/94067273; Busch MP; Murphy E; Nemo G
More on HTLV tax and mycosis fungoides [letter; comment]: N Engl J Med. 1993 Dec 30;329(27):2035; discussion 2035-6. Unique Identifier : AIDSLINE MED/94067274; Youngberg GA; Karnad A
WHO widens focus of AIDS research [news]: Nature. 1993 Nov 25;366(6453):293. Unique Identifier : AIDSLINE MED/94067305; Butler D
Top US panel will map out fresh attack on AIDS [news]: Nature. 1993 Dec 2;366(6454):395. Unique Identifier : AIDSLINE MED/94067327; Macilwain C
[HIV prevalence among Surinam and Antillean drug users in Amsterdam]: Ned Tijdschr Geneeskd. 1993 Oct 23;137(43):2209-13. Unique Identifier : AIDSLINE MED/94067358; Fennema JS; van den Hoek JA; Huisman JG; Coutinho RA; GG&GD, sector Volksgezondheid en Milieu, Amsterdam.; OBJECTIVE. To determine the HIV prevalence and the frequency of injecting drugs among drug users from Surinam and the Netherlands Antilles in Amsterdam. DESIGN. Descriptive study. SETTING. Amsterdam streets. METHOD. Participants were recruited in 1992 in the street and intervi
[Splenectomy in HIV-positive patients]: Minerva Chir. 1993 Jul;48(13-14):759-61. Unique Identifier : AIDSLINE MED/94067498; Lombardo G; Talenti A; Cafferati M; Martelli S; Marzocchi D; Oddone C; I Divisione Chirurgia, USSL Torino III, Ospedale Martini, Torino.
My AIDS education Part I: Assuming the sick position.: Nurs Health Care. 1993 Sep;14(7):341-2. Unique Identifier : AIDSLINE MED/94067595; Fedor M
My AIDS education. Part II: History lessons.: Nurs Health Care. 1993 Oct;14(8):398-9. Unique Identifier : AIDSLINE MED/94067603; Fedor M
My AIDS education. Part III: Political realities.: Nurs Health Care. 1993 Nov;14(9):453-4. Unique Identifier : AIDSLINE MED/94067609; Fedor M
Oral carriage of Candida in healthy and HIV-seropositive persons.: Oral Surg Oral Med Oral Pathol. 1993 Nov;76(5):570-2. Unique Identifier : AIDSLINE MED/94067741; Hauman CH; Thompson IO; Theunissen F; Wolfaardt P; Department of Oral Pathology, Faculty of Dentistry, University of; Stellenbosch, Tygerberg, South Africa.; The prevalence of oral colonization with Candida species was studied in 28 HIV-seropositive and 28 healthy persons. Candida was cultured from 75% and 68% of HIV-positive and control persons, respectively, with a significantly higher density carriage in the HIV-seropositive group. Positive smears were seen in 39% of al
[Medical indications for HIV serological tests]: Orv Hetil. 1993 Nov 7;134(45):2491-2. Unique Identifier : AIDSLINE MED/94067759; Fust G; Horvath A; Banhegyi D; Orszagos Haematologiai, Vertranszfuzios es Immunologiai; Intezet, Budapest.
[Revised definition of AIDS cases and reclassification of HIV infections in adolescents and adults]: Orv Hetil. 1993 Nov 7;134(45):2493-6. Unique Identifier : AIDSLINE MED/94067760; Domok I
[Live attenuated viruses: a new strategy for vaccination against AIDS (news)]: Pathol Biol (Paris). 1993 Jun;41(6):513-4. Unique Identifier : AIDSLINE MED/94067879; Molina JM
[Programmed death of cells (apoptosis) (editorial)]: Patol Pol. 1993;44(3):113-9. Unique Identifier : AIDSLINE MED/94067889; Gorczyca W; Melamed MR; Darzynkiewicz Z; Zaklad Patomorfologii Nowotworow, Pomorska Akademia Medyczna,; Szczecin.; Apoptosis is a mode of cell death defin