1994

What do we know about HIV. [videorecording].: [Bethesda, Md. : NIAID, 1990] 1 videocassette (51 min., 58 sec.) : sd., col. ; 1/2 in (NIAID research grand rounds) Unique Identifier : AIDSLINE AV/9412586; Martin MA
HIV and the healthcare worker : a program in two parts. [videorecording]: Research Triangle Park, NC : Glaxo, 1992 1 videocassette : sd., col. ; 1/2 in. + 1 guide (54 p.) (The Masters of medicine series) Unique Identifier : AIDSLINE AV/9415388; Wofsy CB; Durack DT; Sexton DJ; Bartlett JA
[HIV AIDS i vardarbetet, risker och attityder.]: Stockholm : Svenska sjukhusforeningen, 1988 70 p Unique Identifier : AIDSLINE CAT/9407098
[Le:SIDA et autres maladies sexuellement transmissibles.]: Stanley, Rose-Hill, Ile Maurice : Editions de l'Ocean Indien, c1988 40 p. : ill Unique Identifier : AIDSLINE CAT/9401757; Chan Kam C
A:National study of HIV infection, AIDS, and general practice.: Newcastle upon Tyne : University of Newcastle upon Tyne, 1989 x, 94 p (Report / University of Newcastle upon Tyne, Health Care Research Unit ; no. 36) Unique Identifier : AIDSLINE CAT/9402137; Gallagher M
HIV/AIDS education : a curriculum guide for health care professionals.: New York, N.Y. : AIDS Education Center, New York University, c1989 vii, 115 p Unique Identifier : AIDSLINE CAT/9403624; Hurley PM; Arts Professions
Summary of AIDS laws from the 1988 legislative sessions.: Washington, D.C. : Intergovernmental Health Policy Project, c1989 119, 13 p Unique Identifier : AIDSLINE CAT/9404982; Bowleg IA
AIDS quarterly newsletter.: [Addis Ababa : The Ministry, v. : ill Unique Identifier : AIDSLINE CAT/9415452
American Red Cross African American HIV/AIDS instructor's manual.: [Washington, D.C.] : American National Red Cross, c1990 viii, 76 p. + 1 poster (folded) Unique Identifier : AIDSLINE CAT/9404732
Strategies for hope. No. 1-: London, U.K. : ActionAid ; Nairobi, Kenya : AMREF (African Medical and Research Foundation) ; Colchester, U.K. : World in Need, c1990- v. : ill., ports Unique Identifier : AIDSLINE CAT/9415045
The:AIDS report. Vol. 2, no. 1 (Sept./Oct 1990)-: Cambridge, Mass. : The Institute, 1990- v. : ill., ports Unique Identifier : AIDSLINE CAT/9415453
AIDS. 89-90-: Paris : New York : Medsi/McGraw Hill, c1989- v. : ill., ports Unique Identifier : AIDSLINE CAT/9414202
[Primera Encuesta Nacional sobre SIDA : informe de resultados.]: San Jose : Asociacion Demografica Costarricense, 1990 198, 25 p. : ill Unique Identifier : AIDSLINE CAT/9407169; Madrigal Pana J
Imaging of AIDS.: Philadelphia : B.C. Decker, c1991 xiii, 288 p. : ill Unique Identifier : AIDSLINE CAT/9413566; Trotot PM
AIDS research resource inventory 1983-1991 : Latin American [sic] and the Caribbean.: [Washington, D.C.?] : Pan American Health Organization/World Health Organization, [1992] xiv, 478 p. : ill Unique Identifier : AIDSLINE CAT/9412325; Weissenbacher M
The:FAHEC clinical manual for the care of patients with human immunodeficiency virus (HIV) infection or acquired immune deficiency syndrome (AIDS). 3rd ed.: [Fayetteville, N.C.] : Fayetteville Area Health Education Center, c1992 203 p Unique Identifier : AIDSLINE CAT/9410777; Ellenbogen C
The:new frontiers of oto-rhino-laryngology in Europe : proceeding [sic] of 2nd European Congress of Oto-Rhino-Laryngology and Cervico-Facial Surgery, Sorrento (Naples), June 6th-10th.: Surgery Bologna : Monduzzi, c1992 4 v. : ill Unique Identifier : AIDSLINE CAT/9411539
Laughing in the face of AIDS : a surgeon's personal battle.: Grand Rapids, Mich. : Baker Book House, c1992 160 p Unique Identifier : AIDSLINE CAT/9405612; Rozar GE; Biebel DB
The:CDC's case definition of AIDS : implications of the proposed revisions.: Washington, D.C. : Congress of the U.S., Office of Technology Assessment, [Supt. of Docs., U.S. G.P.O., distributor, 1992] vii, 93 p. : ill (HIV-related issues ; 8) Unique Identifier : AIDSLINE CAT/9411823
AIDS funding report.: Silver Spring, Md. : CD Publications, v Unique Identifier : AIDSLINE CAT/9416068
Capita selecta on aids.: Leiden : Boerhaave Commissie voor Postacademisch Onderwijs in de Geneeskunde, Rijksuniversiteit Leiden, [1993] 90 p. : ill (Boerhaave cursus) Unique Identifier : AIDSLINE CAT/9411609; Kroon FP; Geneeskunde
The:Search for antiviral drugs : case histories from concept to clinic.: Boston : Birkhauser, c1993 xii, 240 p. : ill Unique Identifier : AIDSLINE CAT/9413574; Adams J; Merluzzi VJ
Bearing witness : Gay Men's Health Crisis and the politics of AIDS.: Boulder : Westview Press, 1993 xxii, 275 p. : ill Unique Identifier : AIDSLINE CAT/9412162; Kayal PM
Social care & HIV-AIDS.: London : HMSO, 1993 x, 214 p. : ill Unique Identifier : AIDSLINE CAT/9412074
Behavioral and social sciences and the HIV/AIDS epidemic.: Syndrome Washington, DC : National Commission on AIDS, [1993] ix, 52, 6 p Unique Identifier : AIDSLINE CAT/9414664
HIV/AIDS prevention & education curriculum supplement : a manual to assist facilities.: Washington, DC (P.O. Box 17675, Washington 20041-0675) : National Association of Rehabilitation Facilities, c1993 xiv, 256 p Unique Identifier : AIDSLINE CAT/9414652; Mason C; Jaskulski T
Women and AIDS : psychological perspectives.: London : Newbury Park : Sage Publications, 1993 x, 196 p. : ill (Gender and psychology) Unique Identifier : AIDSLINE CAT/9402310; Squire C
1st Kenya HIV/AIDS/STD Conference : program and abstracts.: [Nairobi] : Ministry of Health, [1993] 63 p Unique Identifier : AIDSLINE CAT/9414673
The:biology of AIDS. 3rd ed.: Boston : Jones and Bartlett Publishers, c1994 xv, 176 p. : ill (Jones and Bartlett series in biology) Unique Identifier : AIDSLINE CAT/9418958; Fan H; Conner RF; Villarreal LP
AIDS, the politics of survival.: Amityville, N.Y. : Baywood Pub. Co., 1994 xiii, 281 p. : ill (Policy, politics, health, and medicine series) Unique Identifier : AIDSLINE CAT/9418579; Krieger N; Margo G
Information services for HIV/AIDS : recommendations to the NIH : report of a conference co-sponsored by the National Library of Medicine and the NIH Office of AIDS Research, June 28-30, 1993.: [Bethesda, Md.] : U.S. Dept. of Health and Human Services, Public Health Service, National Institutes of Health, [1994] xi, 71 p. : ill (Publication no. 94-3730) Unique Identifier : AIDSLINE CAT/9418978
Presence of HTLV-I in astroglial cells infected with cell-free virus preparation (Meeting abstract).: Chronica Dermatol; 2(3):444-5 1992. Unique Identifier : AIDSLINE ICDB/94696621; Macchi B; Graziani G; Caronti B; Lauro GM; Bonmassar E; Dept. of Experimental Medicine and Biochemical Sciences, Univ.; 'Tor Vergata,' Rome, Italy; Previous data have shown that astroglial cells express the virus core protein p19 1 wk after exposure to an HTLV-I donor cell line. In order to investigate whether HTLV-I was able to replicate within astroglial cells, glioma cell lines after 20-40 passages in vitro, were exposed to HTLV-I using a cell-free virus prepa
The dimensions of caring 1992: enhancing quality of life in palliative care. March 12-13, 1992, San Diego, CA.: The Dimensions of Caring 1992: Enhancing Quality of Life in Palliative Care. March 12-13, 1992, San Diego, CA, Green Cancer Center of Scripps Clinic and Research Foundation and San Diego Hospice, 117 p., 1992.. Unique Identifier : AIDSLINE ICDB/94696529; Anonymous; No affiliation given; The conference, Dimensions of Caring 1992: Enhancing the Quality of Life in Palliative Care, held March 12-13, 1992, in San Diego, California, was presented by the Green Cancer Center of Scripps Clinic and Research Foundation and the San Diego Hospice. There were daily opening and closing plenary presentations, but th
[Immunodeficiency syndrome: thymopentin]: Arch Monaldi Mal Torace. 1989 Jul-Dec;44(4-6):767-78. Unique Identifier : AIDSLINE MED/94092000; Micillo E; Dericoloso A; Catena E; Tranchese D; Melito P; Di Filippo O; Di Giacomo A
Dual infections of the immune system in patients with chronic active Epstein-Barr virus infection mimicking chronic fatigue syndrome.: Can Dis Wkly Rep. 1991 Jan;17 Suppl 1E:29-32. Unique Identifier : AIDSLINE MED/94073999; Purtilo DT; The etiologic bases of CFS are undetermined at the present time. It is very important to distinguish the patients with CFS as defined by the Centers for Disease Control (CDC) case definition of Holmes et al. from patients with physical and laboratory findings suggesting dual infections and/or underlying immunodeficien
[A morphological study of the liver in the acquired immunodeficiency syndrome. An analysis of 69 cases]: G E N. 1992 Apr-Jun;46(2):105-12. Unique Identifier : AIDSLINE MED/94063406; Ruiz ME; Garcia Tamayo J; Instituto Anatomopatologico, Universidad Central de Venezuela.; The morphologic findings in the liver of 69 autopsy cases with had died of AIDS are presented. The morphologic changes were represented by the presence of opportunistic germs (Histoplasma capsulatum, Mycobacteria, Cryptococcus neoformans and CMV ). Other alterati
[Terminal jaundice in progressive disseminated histoplasmosis associated with AIDS. A report of an autopsy case]: G E N. 1992 Apr-Jun;46(2):157-61. Unique Identifier : AIDSLINE MED/94063412; Sulbaran Munoz JA; Sierra de Sulbaran YB; Departamento de Anatomia Patologica, Hospital Militar Dr.; Carlos Arvelo.; The case of a 58-years-old patient with AIDS is discussed. He presented a progressive disease with discomfort, abdominal pain, hiporexia, fever and weight loss. At the time of admittance in our hospital he had hepatosplenomegaly. The patient worsened and presented asthenia, fever, oedema, ascites, pulmonary congestion
[Advances in AIDS research (editorial)]: Medicina (B Aires). 1992;52(4):374-6. Unique Identifier : AIDSLINE MED/94066763; Pasqualini CD; Bracco MM
[Physicians and AIDS: risk, compromise and social responsibility (editorial)]: Medicina (B Aires). 1992;52(6):582-5. Unique Identifier : AIDSLINE MED/94066784; Cahn P
[Accidental exposure to health care workers of blood and body fluids from patients]: Rev Med Chil. 1992 Nov;120(11):1247-53. Unique Identifier : AIDSLINE MED/94069064; Wolff M; Hidalgo S; Departamento de Medicina, Facultad de Medicina, Sede Central,; Universidad de Chile.; Due to the growing concern of Health Care Workers (HCW) regarding the possibility of acquiring blood borne infections through accidental occupational exposure and the fact that HIV and Hepatitis B infections have occurred in that setting, an evaluation of the frequency of accidents and their circumstances, suffered by
[HTLV-I clinical pathological spectrum]: Rev Med Chil. 1992 Aug;120(8):927-33. Unique Identifier : AIDSLINE MED/94069091; Cartier L; Araya F; Castillo JL; Departamento de Ciencias Neurologicas, Facultad de Medicina,; Universidad de Chile (Division Oriente), Santiago.; HTLV-I has been revealed as the etiological factor of the Tropical Spastic Paraparesis (TSP) and of the T-cell leukemia-lymphoma of the adult (ATLL). Recently, it has also been associated to some forms of polymyositis, polyarthritis, polyneuropathies, Sjogren s syndrome, thrombocytopenia and lympho-alveolitis. The cli
Paracoccidioidomycosis in a patient with HIV-1 infection [letter]: Rev Paul Med. 1992 Sep-Oct;110(5):193-4. Unique Identifier : AIDSLINE MED/94069203; Bagatin E; Goncalves VL; Sabongi VP; Sotto MN
Detection of Pneumocystis carinii in bronchoalveolar lavage fluid by dot immunobinding assay and immunofluorescence.: Eur J Med. 1992 Dec;1(8):496-8. Unique Identifier : AIDSLINE MED/94073365; Contini C; Nato F; Vullo V; Mazie JC; Mojon M; Romani R; Delia S; Sorice F; Istituto di Malattie Infecttive, Universita La Sapienza, Rome,; Italy.
Production and characterization of monoclonal antibodies to human Pneumocystis carinii for the diagnosis of P. carinii pneumonia.: Eur J Med. 1992 Jun;1(3):132-8. Unique Identifier : AIDSLINE MED/94080314; Nato F; Contini C; Zamora-Zavala C; Viscardi P; Delia S; Mojon M; Mazie JC; Hybridolab, Departement des Biotechnologies, Institut Pasteur,; Paris, France.; OBJECTIVES: Monoclonal antibodies against human Pneumocystis carinii were produced by fusion of myeloma cells (X63-AG8.653) with splenocytes from Biozzi mice that had been immunized against P. carinii cysts isolated from infected human lung. The aim of this study was to evaluate the usefulness of these monoclonal anti
Clinical relevance of herpes simplex virus in the throat of elderly with Salmonella enteritidis gastroenteritis.: Eur J Med. 1992 Jul-Aug;1(4):244-5. Unique Identifier : AIDSLINE MED/94080335; Crombach WH; Beckers EA; Claessens WL; Laboratory for Bacteriology, Virology and Immunology, St Maartens; Gasthuis, Venlo, The Netherlands.; It is not known whether the presence of Herpes simplex virus in the throat of elderly patients with severe gastroenteritis and pulmonary implications is of clinical relevance. We cultured throat swabs and faeces of elderly patients with (n = 11) and without (n = 12) severe Salmonella gastroenteritis for viruses and ba
Massive haemorrhage from rupture of a pancreatic pseudocyst after pentamidine-associated pancreatitis.: Eur J Med. 1992 Jul-Aug;1(4):251-3. Unique Identifier : AIDSLINE MED/94080338; Pais JR; Cazorla C; Novo E; Viana A; Department of Internal Medicine, Hospital Ramon y Cajal, Madrid,; Spain.; A 40 year-old man with the acquired immunodeficiency syndrome who was treated with intravenous pentamidine suffered a massive spontaneous haemorrhage caused by rupture of a pancreatic pseudocyst after pentamidine-induced pancreatitis. The patient previously presented symptomatic hypoglycaemia, severe nephrotoxicity an
Aspergillus hepatosplenic abscesses and chylous ascites: successful treatment with fluconazole.: Eur J Med. 1992 Jul-Aug;1(4):253-4. Unique Identifier : AIDSLINE MED/94080339; Soriano V; Cobo J; Gutierrez M; Castejon A; Laguna F; Gonzalez-Lahoz J; Service of Infectious Diseases, Instituto de Salud Carlos III,; Madrid, Spain.
Visceral leishmaniasis involving a cutaneous Kaposi's sarcoma lesion and free areas of skin [letter]: Eur J Med. 1992 Jul-Aug;1(4):255. Unique Identifier : AIDSLINE MED/94080340; Taillan B; Marty P; Schneider S; Telle H; Fuzibet JG; Rosenthal E; Rahal A; Lefichoux Y; Dujardin P
Fatal haemolytic uraemic syndrome in an AIDS patient [letter]: Eur J Med. 1992 Oct;1(6):378-9. Unique Identifier : AIDSLINE MED/94080355; Cotte L; Preckel MP; Cahen R; Dijoud F; Loire R; Chassard D; Trepo C
An ethical approach to screening for human immunodeficiency virus [letter; comment]: Eur J Med. 1992 Oct;1(6):382. Unique Identifier : AIDSLINE MED/94080360; Perren-Klingler G
Screening for HIV [letter; comment]: Eur J Med. 1992 Nov;1(7):446. Unique Identifier : AIDSLINE MED/94080377; Crisci C
Extrapulmonary tuberculosis. A review.: Arch Fam Med. 1992 Sep;1(1):91-8. Unique Identifier : AIDSLINE MED/94084148; Elder NC; Department of Family and Community Medicine, Oregon Health; Sciences University, Portland.; The increase in cases of tuberculosis that has occurred with the increasing number of individuals infected with the human immunodeficiency virus (HIV) has focused attention on the problems in diagnosing and treating tuberculosis. While it is primarily considered a pulmonary disease, tuberculosis has the potential to i
Zidovudine (AZT).: Arch Fam Med. 1992 Nov;1(2):250. Unique Identifier : AIDSLINE MED/94084156
Who is providing ambulatory care to Medicaid beneficiaries with acquired immunodeficiency syndrome in New York State?: Arch Fam Med. 1992 Nov;1(2):251-4. Unique Identifier : AIDSLINE MED/94084157; Howell EM; Keyes M; Mason ML; Turner BJ; Mathematica Policy Research Inc., Washington, DC.; This study examined the number of ambulatory care providers treating individuals with the acquired immunodeficiency syndrome who were Medicaid beneficiaries in New York State in 1988 and examined the distribution of this care across various practice settings. The study population was identified retrospectively in the
Fibronectin in HIV-infected patients: a prospective study.: Eur J Med. 1992 Sep;1(5):308-10. Unique Identifier : AIDSLINE MED/94084180; Raffi F; Boudart D; Merrien D; Barrier JH; Internal Medicine Department, Hotel-Dieu, Nantes, France.; Fibronectin, a non-specific opsonin involved in the clearance of microorganisms, is thought to play a role in various infectious disease processes. Its diagnostic value as a biological marker of infection and/or prognosis in human immunodeficiency virus (HIV) patients is questionable. We conducted a prospective study
Anti-idiotypic therapeutic strategies in HIV infection.: Mol Cell Biol Hum Dis Ser. 1992;1:283-308. Unique Identifier : AIDSLINE MED/94084355; Wilks D; Dalgleish AG; Department of Medicine, Addenbrooke's Hospital, Cambridge, UK.
Statistical methods for longitudinal and clustered designs with binary responses.: Stat Methods Med Res. 1992;1(3):249-73. Unique Identifier : AIDSLINE MED/94084467; Neuhaus JM; Department of Epidemiology and Biostatistics, University of; California, San Francisco 94143-0560.; Dependent binary response data arise frequently in practice due to repeated measurements in longitudinal studies or to subsampling primary sampling units as in fields such as teratology and ophthalmology. Several classes of approaches have recently been proposed to analyse such repeated binary outcome data. The differ
[Analysis of epidemiologic-sociocultural and economic course during the AIDS epidemic in the Netherlands and the scenario to the year 2000]: Przegl Lek. 1992;49(12):428. Unique Identifier : AIDSLINE MED/94089930; Skotnicki AB; Klinika Hematologii AM w Krakowie.
[Pneumocystis carinii infection. Various aspects on its clinical and laboratory diagnosis]: Rev Med Chil. 1992 Jun;120(6):634-7. Unique Identifier : AIDSLINE MED/94090063; Lorca M; Tassara R; Denegri M; Sierra P; Garcia A; Munoz P; Barria MS; Henriquez A; Caviedes I; Wu E; et al; Departamento de Pediatria, Facultad de Medicina (Division Cs.; Medicas Occidente) Universidad de Chile, Santiago.; P carinii is an opportunistic pathogenic agent able to produce severe infection that must be diagnosed promptly. We analyzed 138 samples from 100 patients suspected of having infection by P carinii. The ortho-toluidine blue and the methenamine stains were used to analyze the samples. Infection was demonstrated in 18 p
[Acalculous acute cholecystitis caused by Cryptosporidium in a patient with AIDS]: Rev Med Chil. 1992 Jul;120(7):789-93. Unique Identifier : AIDSLINE MED/94090092; Labarca J; Tagle R; Acuna G; Oddo D; Perez C; Guzman S; Departamento de Medicina Interna, Hospital Clinico de la P; Universidad Catolica de Chile, Santiago.; We report a patient with the acquired immunodeficiency syndrome who developed acute cholecystitis. Removal of the gallbladder revealed infection by Cryptosporidium spp. The clinical course after cholecystectomy was favourable. The pathogenesis and therapy of this complication in patients with AIDS is discussed.
An ethical approach to screening for human immunodeficiency virus [see comments]: Eur J Med. 1992 Jun;1(3):173-6. Unique Identifier : AIDSLINE MED/94080320; Manuel C; Auquier P; Charrel J; Enel P; Reviron D; San Marco JL; Laboratoire de Sante Publique, Faculte de Medecine, Marseille.
Short communication: possible activity of beta-carotene in patients with the AIDS related complex. A pilot study.: Med Oncol Tumor Pharmacother. 1992;9(3):151-3. Unique Identifier : AIDSLINE MED/94076882; Bianchi-Santamaria A; Fedeli S; Santamaria L; Camillo Golgi Institute of General Pathology, Centro Tumori,; University of Pavia, Italy.; In a pilot single blind study, beta-carotene (BC) supplementation produced, in ARC patients under current treatment, apparent recovery from asthenia, fever, nocturnal sweating, diarrhoea, loss in weight, and led as a result to an improvement in general health and working efficiency, but not to an improvement in multip
The British Paediatric Surveillance Unit: activities and developments in 1990 and 1991.: Commun Dis Rep CDR Rev. 1992 Dec 4;2(13):R145-8. Unique Identifier : AIDSLINE MED/94061119; Lynn R; Hall SM; British Paediatric Surveillance Unit, British Paediatric; Association, Regent's Park, London.; The British Paediatric Surveillance Unit is a joint undertaking of the British Paediatric Association, the PHLS Communicable Disease Surveillance Centre and the Department of Epidemiology at the Institute of Child Health, London. It provides an active case reporting system which aims to facilitate the surveillance of
The surveillance of communicable disease in the European Community.: Commun Dis Rep CDR Rev. 1992 Jun 19;2(7):R73-7. Unique Identifier : AIDSLINE MED/94061123; Healing TD; This article summarises the existing international structures in Europe which collate data produced by surveillance systems in individual countries. The surveillance of influenza, tuberculosis, and other infections in Europe is undertaken by the World Health Organisation (WHO), the European Community (EC), and nationa
Surveillance of HIV infection by voluntary testing in England.: Commun Dis Rep CDR Rev. 1992 Jul 17;2(8):R85-90. Unique Identifier : AIDSLINE MED/94061126; Waight PA; Rush AM; Miller E; Eighteen laboratories, which together provide primary HIV antibody testing for 43% of the population in England, collaborated in a study to record epidemiological information for all individuals voluntarily tested by them over a five year period. From the 184,113 individuals who had a first test during the study perio
Listeriosis surveillance.: Commun Dis Rep CDR Wkly. 1992 Mar 6;2(10):43. Unique Identifier : AIDSLINE MED/94061132
Regulation of HIV testing kits.: Commun Dis Rep CDR Wkly. 1992 Mar 20;2(12):51. Unique Identifier : AIDSLINE MED/94061138
AIDS and HIV-1 infection in the United Kingdom: monthly report.: Commun Dis Rep CDR Wkly. 1992 Mar 20;2(12):55-6. Unique Identifier : AIDSLINE MED/94061139
AIDS and HIV-1 infection in the United Kingdom: monthly report.: Commun Dis Rep CDR Wkly. 1992 Apr 24;2(17):77-80. Unique Identifier : AIDSLINE MED/94061148
HIV infection in a surgeon.: Commun Dis Rep CDR Wkly. 1992 May 8;2(19):85. Unique Identifier : AIDSLINE MED/94061151
Occupational exposure to HIV and use of zidovudine.: Commun Dis Rep CDR Wkly. 1992 May 8;2(19):85. Unique Identifier : AIDSLINE MED/94061152
AIDS and HIV-1 infection in the United Kingdom: monthly report.: Commun Dis Rep CDR Wkly. 1992 May 22;2(21):97-8. Unique Identifier : AIDSLINE MED/94061157
Transmission of HIV infection in the health care setting.: Commun Dis Rep CDR Wkly. 1992 May 29;2(22):99. Unique Identifier : AIDSLINE MED/94061159
AIDS and HIV-1 infection in the United Kingdom: monthly report.: Commun Dis Rep CDR Wkly. 1992 Jun 19;2(25):115-6. Unique Identifier : AIDSLINE MED/94061162
AIDS and HIV-1 infection in the United Kingdom: monthly report.: Commun Dis Rep CDR Wkly. 1992 Jul 24;2(30):137-40. Unique Identifier : AIDSLINE MED/94061167
AIDS and HIV-1 infection in the United Kingdom: monthly report.: Commun Dis Rep CDR Wkly. 1992 Jan 24;2(4):17-20. Unique Identifier : AIDSLINE MED/94061169
AIDS and HIV-1 infection in the United Kingdom: monthly report.: Commun Dis Rep CDR Wkly. 1992 Feb 21;2(8):37-8. Unique Identifier : AIDSLINE MED/94061179
Sexually transmitted diseases and HIV infection.: Commun Dis Rep CDR Wkly. 1992 Aug 21;2(34):153. Unique Identifier : AIDSLINE MED/94073284
AIDS and HIV-1 infection in the United Kingdom: monthly report.: Commun Dis Rep CDR Wkly. 1992 Aug 21;2(34):157-8. Unique Identifier : AIDSLINE MED/94073285
AIDS and HIV-1 infection in the United Kingdom: monthly report.: Commun Dis Rep CDR Wkly. 1992 Sep 18;2(38):175-6. Unique Identifier : AIDSLINE MED/94073287
Progression of the AIDS pandemic.: Commun Dis Rep CDR Wkly. 1992 Nov 20;2(47):213. Unique Identifier : AIDSLINE MED/94073288
AIDS and HIV-1 infection in the United Kingdom: monthly report.: Commun Dis Rep CDR Wkly. 1992 Nov 20;2(47):217-8. Unique Identifier : AIDSLINE MED/94073289
New guidelines on HIV testing and partner notification.: Commun Dis Rep CDR Wkly. 1992 Dec 18;2(51):231. Unique Identifier : AIDSLINE MED/94073291
AIDS and HIV-1 infection in the United Kingdom: monthly report.: Commun Dis Rep CDR Wkly. 1992 Dec 18;2(51):235-6. Unique Identifier : AIDSLINE MED/94073293
Deficiency of CD4+CD45RA+ lymphocytes in patients with glioblastoma multiforme.: Eur J Med. 1992 Oct;1(6):362-4. Unique Identifier : AIDSLINE MED/94080348; Menage P; Thibault G; Lebranchu Y; Jan M; Bardos P; Departement de Neurochirurgie, Hopital Bretonneau, Tours,; France.
Sexually transmitted diseases in England and Wales: 1981-1990.: Commun Dis Rep CDR Rev. 1992 Jan 3;2(1):R1-7. Unique Identifier : AIDSLINE MED/94084072; Catchpole MA; Data provided by genito-urinary medicine clinics, microbiology laboratories and other reports reveal a consistent picture of the epidemiology of sexually transmitted diseases in England and Wales during the 1980s. The number of new cases increased by 21% between 1981 and 1990; most of this increase being due to
Complementarities and network interactions in AIDS.: J Autoimmun. 1993 Oct;6(5):601-10. Unique Identifier : AIDSLINE MED/94059348; Susal C; Hoffman GW; Daniel V; Grant M; Opelz G; Department of Transplantation Immunology, University of; Heidelberg, Germany.; The contribution of autoimmune phenomena to the development of AIDS is not fully understood. In this paper we provide new evidence that idiotypic network interactions are operative in the development of AIDS. We furthermore present a model that involves two groups of antibodies and other molecules that are related to
Vaccination in Third World countries [editorial]: Curr Opin Immunol. 1993 Oct;5(5):683-6. Unique Identifier : AIDSLINE MED/94059426; Ada G
An ultrastructural study of HIV-infected human dendritic cells and monocytes/macrophages.: APMIS. 1993 Sep;101(9):672-80. Unique Identifier : AIDSLINE MED/94059526; Blom J; Nielsen C; Rhodes JM; Department of Molecular Cell Biology, Statens Seruminstitut,; Copenhagen, Denmark.; The ultrastructure of dendritic cells (DC) isolated from HIV-negative blood donors revealed three morphologically distinct cell types: type I had an irregularly shaped nucleus with a high content of heterochromatin and numerous short pseudopodia; type II possessed a smoother boundary, a blast-like nucleus and a few ve
Antibodies to Pneumocystis carinii in Danish blood donors and AIDS patients with and without Pneumocystis carinii pneumonia.: APMIS. 1993 Sep;101(9):707-10. Unique Identifier : AIDSLINE MED/94059531; Buhl L; Settnes OP; Andersen PL; Institute of Pathology, Aarhus University Hospital, Aarhus; Kommunehospital, Denmark.; Sera from 1) 8 AIDS patients with Pneumocystitis carinii pneumonia, 2) 13 HIV antibody-positive patients, 9 with AIDS and 4 with AIDS-related symptoms, all 13 without Pneumocystis carinii pneumonia, and 3) 36 healthy male blood donors, all HIV antibody negative, were examined for antibodies against Pneumocystis carini
Advances in AIDS Vaccine Development: 5th Annual meeting of the National Cooperative Vaccine Development Groups for AIDS. Chantilly, Virginia, August 30-September 3, 1992. Proceedings and abstracts.: AIDS Res Hum Retroviruses. 1993 Oct;9 Suppl 1:S1-167. Unique Identifier : AIDSLINE MED/94059646
Mycobacterium genavense sp. nov.: Int J Syst Bacteriol. 1993 Oct;43(4):841-3. Unique Identifier : AIDSLINE GENBANK/X60070; Bottger EC; Hirschel B; Coyle MB; Institut fur Medizinische Mikrobiologie, Medizinische Hochschule; Hannover, Germany.; Strains of a suggested novel type of mycobacterium have been repeatedly isolated from patients with AIDS. We summarize the results of tests performed to determine enzymatic activities and metabolic properties, the results of fatty acid analyses, and the results of a comparative 16S rRNA sequence determination. We prop
U.S. Congress upholds ban on HIV carriers [news]: Ann Oncol. 1993 Sep;4(8):616. Unique Identifier : AIDSLINE MED/94059786
Hodgkin's disease in the setting of HIV infection [editorial]: Ann Oncol. 1993 Sep;4(8):621-2. Unique Identifier : AIDSLINE MED/94059788; Levine AM
Hodgkin's disease during HIV1 infection: the French registry experience. French Registry of HIV-associated Tumors.: Ann Oncol. 1993 Sep;4(8):635-41. Unique Identifier : AIDSLINE MED/94059791; Andrieu JM; Roithmann S; Tourani JM; Levy R; Desablens B; le Maignan C; Gastaut JA; Brice P; Raphael M; Taillan B; Hematology-Oncology Unit, Laennec Hospital, Paris, France.; BACKGROUND: The first cases of Hodgkin s disease (HD) associated with HIV infection were reported in 1984. Since then, short series of seropositive patients suffering from HD have been published. In order to identify the characteristics, treatment response and outcome of HIV-associated Hodgkin s disease (HIV-HD), the
Role of conserved regions of class I MHC molecules in the activation of CD8+ cytotoxic T lymphocytes by peptide and purified cell-free class I molecules.: Int Immunol. 1993 Sep;5(9):1129-38. Unique Identifier : AIDSLINE MED/94059865; Takeshita T; Kozlowski S; England RD; Brower R; Schneck J; Takahashi H; DeLisi C; Margulies DH; Berzofsky JA; Molecular Immunogenetics and Vaccine Research Section, NCI, NIH,; Bethesda, MD 20892.; To analyze the molecular interactions involved in CD8+ cytotoxic T lymphocyte (CTL) recognition quantitatively, we developed a cell-free antigen presenting system. Genetically engineered soluble H-2Dd molecules coated on plastic microtiter plates could present HIV envelope peptide to an antigen-specific CTL clone, ind
Changes of IgE production, splenic helper and suppressor T lymphocytes in mice infected with Paragonimus westermani.: Korean J Parasitol. 1993 Sep;31(3):231-8. Unique Identifier : AIDSLINE MED/94059903; Min DY; Ryu JS; Shin MH; Department of Parasitology, College of Medicine, Hanyang; University, Seoul, Korea.; Effects of Paragonims westermani infection were observed in mice on the change of serum IgE level, the number of peripheral eosinophils and the distribution of Thy 1.2+ (CD3), L3T4+ (CD4), and Lyt-2+ (CD8) splenic T lymphocytes without mitogen stimulation. BALB/c mice were infected with 20 metacercariae of P. westerma
Use of nitrogen-15 kinetic isotope effects to elucidate details of the chemical mechanism of human immunodeficiency virus 1 protease.: Biochemistry. 1993 Nov 23;32(46):12380-5. Unique Identifier : AIDSLINE MED/94059947; Rodriguez EJ; Angeles TS; Meek TD; Department of Pharmaceutical Technologies, SmithKline Beecham; Pharmaceuticals, King of Prussia, Pennsylvania 19406.; We have used 15N kinetic isotope effects of the HIV-1 protease-catalyzed peptidolysis of Ac-Ser-Gln-Asn-Tyr-Pro-Val-Val-NH2 to characterize the chemical mechanism of this enzyme. In addition, the multiple isotope effects have been determined by measuring the 15N kinetic isotope effects in both H2O and D2O. The isotope
Structure of the protease from simian immunodeficiency virus: complex with an irreversible nonpeptide inhibitor.: Biochemistry. 1993 Nov 23;32(46):12498-507. Unique Identifier : AIDSLINE MED/94059962; Rose RB; Rose JR; Salto R; Craik CS; Stroud RM; Department of Biochemistry, University of California at San; Francisco 94143-0448.; A variant of the simian immunodeficiency virus protease (SIV PR), covalently bound to the inhibitor 1,2-epoxy-3-(p-nitrophenoxy)propane (EPNP), was crystallized. The structure of the inhibited complex was determined by X-ray crystallography to a resolution of 2.4 A and refined to an R factor of 19%. The variant, SIV P
An NMR study of the HIV-1 TAR element hairpin.: Biochemistry. 1993 Nov 23;32(46):12522-30. Unique Identifier : AIDSLINE MED/94059964; Jaeger JA; Tinoco I Jr; Department of Chemistry, University of California, Berkeley; 94720.; The TAR hairpin is an important part of the 5 long terminal repeat of HIV-1 and appears to be recognized by a cellular protein. A 14-base model of the native TAR hairpin 5 -GAGC[CUGGGA]-GCUC-3 (loop bases in square brackets) has been studied by proton, phosphorus, and natural abundance carbon NMR; these results are
Three-dimensional structure of a simian immunodeficiency virus protease/inhibitor complex. Implications for the design of human immunodeficiency virus type 1 and 2 protease inhibitors.: Biochemistry. 1993 Dec 7;32(48):13054-60. Unique Identifier : AIDSLINE MED/94059982; Zhao B; Winborne E; Minnich MD; Culp JS; Debouck C; Abdel-Meguid SS; Department of Macromolecular Sciences, SmithKline Beecham, King; of Prussia, Pennsylvania 19406.; Simian immunodeficiency virus (SIV) proteins have considerable amino acid sequence homology to those from human immunodeficiency virus (HIV); thus monkeys are considered useful models for the preclinical evaluation of acquired immune deficiency syndrome (AIDS) therapeutics. We have crystallized and determined the thre
Magic Johnson [letter]: J Adolesc Health. 1993 Sep;14(6):427. Unique Identifier : AIDSLINE MED/94060021; Stiffman AR; Cunningham R; Dore P
A survey of attitudes, knowledge, and behavior related to HIV testing of adolescents and young adults enrolled in alcohol and drug treatment.: J Adolesc Health. 1993 Sep;14(6):442-5. Unique Identifier : AIDSLINE MED/94060025; Friedman LS; Strunin L; Hingson R; Department of Medicine, New England Deaconess Hospital, Boston,; MA 02215.; The objectives of this study were to assess attitudes, knowledge, and behavior related to human immunodeficiency virus (HIV) antibody testing of adolescents and young adults undergoing treatment for alcohol and drug problems. Setting and subjects were 101 adolescents and young adults enrolled in a New England substanc
Sexual behavior among adolescents in Uppsala, Sweden.: J Adolesc Health. 1993 Sep;14(6):468-74. Unique Identifier : AIDSLINE MED/94060030; Klanger B; Tyden T; Ruusuvaara L; Department of Obstetrics and Gynecology, University Hospital,; Uppsala, Sweden.; The purpose of this study was to compare the sexual behavior of Swedish teenagers in the late 1980s with that in the late 1970s, when a similar study was performed in the same city. Another aim was to discover differences between boys and girls, smokers and nonsmokers, and pupils in theoretical and practical classes.
AIDS anxieties of adolescents: determinants of state and trait anxiety dimensions in a linear structural model.: J Adolesc Health. 1993 Sep;14(6):475-84. Unique Identifier : AIDSLINE MED/94060031; Strehlow U; Kampmann G; Department of Children and Adolescent Psychiatry, University of; Heidelberg, Germany.; This study presents the effects of general psychologic characteristics on acquired immunodeficiency syndrome (AIDS) anxieties and sexual behaviour of adolescents. To this end, data were collected in a complex interview and subsequently subjected to a linear structural model analysis. The questioned adolescents were di
A proportional hazards model for truncated AIDS data.: Biometrics. 1993 Sep;49(3):731-40. Unique Identifier : AIDSLINE MED/94060216; Finkelstein DM; Moore DF; Schoenfeld DA; Harvard School of Public Health, Department of Biostatistics,; Boston, Massachusetts 02115.; An important source of information on the latency period for AIDS is the data from individuals infected by contaminated blood transfusion. However, a difficulty in the analysis and interpretation of these data is that information is available only on individuals who are infected and develop the disease prior to some s
Puerperium and breast-feeding.: Curr Opin Obstet Gynecol. 1993 Oct;5(5):683-7. Unique Identifier : AIDSLINE MED/94060298; Burkman RT; Department of Obstetrics and Gynecology, Henry Ford Hospital,; Detroit, Michigan.; This review focuses on several aspects of breast-feeding, including mothers skills and attitudes, risk of HIV transmission in breast milk, lactational amenorrhea and its contraceptive effects, and the effects of anesthesia and analgesia on lactation. Also discussed is postpartum contraception and sources of referral
Assessment of the hemostatic effectiveness of human platelets treated with aminomethyltrimethyl psoralen and UV A light using a rabbit ear bleeding time technique.: Blood. 1993 Dec 1;82(11):3489-92. Unique Identifier : AIDSLINE MED/94060386; Wagner SJ; Bardossy L; Moroff G; Dodd RY; Blajchman MA; Jerome H. Holland Laboratory for the Biomedical Sciences,; American Red Cross Blood Services, Rockville, MD 20855.; The photochemical aminomethyltrimethyl psoralen (AMT), in conjunction with UV A light (UVA), has been shown to inactivate human immunodeficiency virus-1 and model viruses in platelet suspensions under conditions that have only a minimal effect on in vitro platelet properties. A rabbit ear bleeding time technique was u
Health care delivery for people with HIV infection and AIDS.: Br J Nurs. 1993 Nov 25-Dec 8;2(21):1065-9. Unique Identifier : AIDSLINE MED/94060653; Arkell S; Health care delivery for people with HIV infection and AIDS will need to change in the future to accommodate the expected increasing numbers of people affected. Nurses have an important role in preventing the spread of HIV infection and in caring for this group of people.
Using condoms to prevent transmission of HIV [letter; comment]: BMJ. 1993 Oct 16;307(6910):1007. Unique Identifier : AIDSLINE MED/94060843; Robinson NJ; Hayes R; Mulder D
Post-tropical screening. Is of little value... [letter; comment]: BMJ. 1993 Oct 16;307(6910):1008. Unique Identifier : AIDSLINE MED/94060849; Conlon CP; Peto T
Funding policies for HIV and AIDS [letter; comment]: BMJ. 1993 Oct 16;307(6910):1010. Unique Identifier : AIDSLINE MED/94060855; Adler M; Allason-Jones E; French P; George R; Mercey D
Initial and current drug use: how are they related?: Addiction. 1993 Sep;88(9):1225-31. Unique Identifier : AIDSLINE MED/94060880; Ronald PJ; Robertson JR; Edinburgh Drug Addiction Study, UK.; The present study examines how initial and current patterns of drug use are related among a group of drug users in Edinburgh. The study categorised individuals according to the year in which they first used illicit drugs. 1984 has been shown to be the year when patterns of drug use in this group began to change after
AIDS risk behaviors and knowledge among heterosexual alcoholics and non-injecting drug users.: Addiction. 1993 Sep;88(9):1257-65. Unique Identifier : AIDSLINE MED/94060883; Fitterling JM; Matens PB; Scotti JR; Allen JS Jr; Jackson Veterans Affairs Medical Center, Mississippi.; The disinhibitory effects of abusable substances on sexual behavior and the increasing HIV prevalence among heterosexuals suggest that alcoholics and non-injection drug users may be at risk for HIV infection. We examined alcohol and non-injection drug use as AIDS risk factors, AIDS risk knowledge, and the effect of AI
The tetrapeptide AcSerAspLysPro (Seraspenide), a hematopoietic inhibitor, may reduce the in vitro toxicity of 3'-azido-3'-deoxythymidine to human hematopoietic progenitors.: Stem Cells (Dayt). 1993 Sep;11(5):455-64. Unique Identifier : AIDSLINE MED/94060917; Grillon C; Bonnet D; Mary JY; Lenfant M; Najman A; Guigon M; Institut de Chimie des Substances Naturelles, CNRS, Gif sur; Yvette, France.; 3 -azido-3 -deoxythymidine ( AZT ), the main antiviral drug used in AIDS treatment, is known to induce anemia and neutropenia. These effects have been attributed to its toxicity to hematopoietic progenitors. In this report, we present a new approach to
Gynecologic issues of women with human immunodeficiency virus infection.: AWHONNS Clin Issues Perinat Womens Health Nurs. 1993;4(2):258-64. Unique Identifier : AIDSLINE MED/94061019; Jay N; Women are the fastest growing population with newly diagnosed acquired immune deficiency syndrome (AIDS) in the United States . Although little is known of specific female manifestations, research trends suggest an increase in genital tract infections and neoplasms that may be recurrent
Health hazards of nursing: identifying workplace hazards and reducing risks.: AWHONNS Clin Issues Perinat Womens Health Nurs. 1993;4(2):320-7. Unique Identifier : AIDSLINE MED/94061025; Hewitt JB; Misner ST; Levin PF; Nurses often work in settings in which they may be exposed to a wide array of psychosocial, chemical, biological, and physical hazards. The authors outline several ways in which occupational exposures occur and the general process for reducing or preventing workplace hazards. Several commonly encountered workplace haz
Localization of the human TAX-1 gene to 1q32.1: a region implicated in microcephaly and Van der Woude syndrome.: Hum Mol Genet. 1993 Sep;2(9):1461-2. Unique Identifier : AIDSLINE GENBANK/X68274; Kenwrick S; Leversha M; Rooke L; Hasler T; Sonderegger P; Department of Medicine, University of Cambridge, Addenbrooke's; Hospital, UK.
[Positive serology for syphilis in neonatal period: prevalence in secondary level maternity. Association with maternal risk factors and with positive serology for HIV-1]: Rev Assoc Med Bras. 1993 Apr-Jun;39(2):100-4. Unique Identifier : AIDSLINE MED/94061082; Guinsburg R; dos Santos AM; Leal DV; Pacheco AA; Okida KS; Trigueiro TC; Almeida MF; Kopelman BI; Disciplina de Pediatria Neonatal da Escola Paulista de Medicina,; Sao Paulo.; To study neonatal Syphilis seropositivity incidence, its association with HIV-1 seropositivity and the impact of Congenital Syphilis CDC case definition, cord blood VDRL and Indirect Hemagglutination (IHA) for Syphilis were performed in 3,664 newborns from Dec/91-July/92. A positive group was formed by those with posi
Function and homing of the lung macrophages. I. Evidence of functional heterogeneity of mobile cells of the murine lung parenchyma in the bronchoalveolar lavage (BAL).: Virchows Arch B Cell Pathol Incl Mol Pathol. 1993;64(3):191-7. Unique Identifier : AIDSLINE MED/94061308; Freudenberg N; Konarske K; Riede UN; Lamers R; Zeller S; Hammerling G; Sorg C; Usener HU; Katschinski T; Galanos C; et al; Pathologisches Institut der Universitat, Freiburg, Germany.; The object of the present investigation was to extend fundamental understanding of the composition, function and origin of bronchoalveolar lavage (BAL) cells, and to reduce the considerable gaps in our existing knowledge. BAL cells from the B10.D2 mouse were identified by morphological, enzyme cytochemical and immunoc
Hodgkin's disease [see comments]: CA Cancer J Clin. 1993 Nov-Dec;43(6):327-46. Unique Identifier : AIDSLINE MED/94061628; Weinshel EL; Peterson BA; Division of Medical Oncology, University of Minnesota Medical; School, Minneapolis.; The etiology of Hodgkin s disease is unknown, and the identity of the normal counterpart of the malignant cell involved in Hodgkin s disease remains controversial. Yet, three of every four patients diagnosed with Hodgkin s disease will be cured. This success in treatment is due in large part to the application of mode
Quantitative receptor autoradiographic analysis for angiotensin II receptors in bovine retinal microvessels: quantitation with radioluminography.: Cell Mol Neurobiol. 1993 Jun;13(3):233-45. Unique Identifier : AIDSLINE MED/94061914; Sato T; Niwa M; Himeno A; Tsutsumi K; Amemiya T; Department of Ophthalmology, Nagasaki University School of; Medicine, Japan.; 1. Specific 125I-Sar1, Ile8-Angiotensin II (125I-Sar1, Ile8-AII) binding sites in bovine retinal microvessels were investigated using the quantitative receptor autoradiographic method with pellet sections. 2. A quantitation was made with the computerized radioluminographic imaging plate system, a newly developed and h
Correlation between induction of lymphocyte apoptosis and prostaglandin E2 production by macrophages infected with HIV.: Cell Immunol. 1993 Nov;152(1):120-30. Unique Identifier : AIDSLINE MED/94062000; Mastino A; Grelli S; Piacentini M; Oliverio S; Favalli C; Perno CF; Garci E; Department of Experimental Medicine and Biochemical Sciences,; University of Rome Tor Vergata, Italy.; Several data indicate that HIV infection of antigen-presenting cells (APCs) and apoptosis of lymphocytes play important roles in pathogenesis of AIDS. We have recently demonstrated that prostaglandin E2 (PGE2) can cause thymocyte apoptosis in vivo. In the present study we have investigated the possibility that the int
Effect of CD4 engagement on CD4-T cell receptor complexes.: Cell Immunol. 1993 Nov;152(1):211-9. Unique Identifier : AIDSLINE MED/94062009; Chuck RS; Cantor CR; Tse DB; Department of Medicine, North Shore University Hospital, Cornell; University Medical College, Manhasset, New York 11030.; To detect the presence of CD4-T cell receptor (TCR) complexes, we previously developed a flow cytometric method for measuring singlet-singlet energy transfer on human T cells labeled with fluorescein isothiocyanate-conjugated anti-CD4 and tetramethylrhodamine isothiocyanate-conjugated anti-TCR. Using the same procedur
Treatment of coccidioidomycosis.: Curr Top Med Mycol. 1993;5:151-79. Unique Identifier : AIDSLINE MED/94062049; Graybill JR; Audie Murphy VA Hospital, University of Texas, Health Science; Center at San Antonio 78284-7750.; This review has traced chemotherapy of coccidioidomycosis from its unsuccessful beginnings through the present time. Although in vitro susceptibilities give initial impressions of activity of many drugs, and although animal studies identify the diseases targeted for
[Immunohistochemical study of lung tissues from patients with idiopathic pulmonary fibrosis]: Chung Hua Chieh Ho Ho Hu Hsi Tsa Chih. 1993 Jun;16(3):144-6, 186-7. Unique Identifier : AIDSLINE MED/94062060; Hou J; Dai LJ; Zhu HW; Nanjing Gu Drum Towerlou Hospital.; Immunohistochemical analysis using 24 different monoclonal and polyclonal antibodies was applied to lung biopsy and autopsy material from 9 patients with idiopathic pulmonary fibrosis (IPF) and 6 patients without lung disorders as control. Lymphoid, non-lymphoid cells and their subsets as well as extracellular matrix
[Lymphocyte subsets in labial salivary gland of Sjogren's syndrome]: Chung Kuo I Hsueh Ko Hsueh Yuan Hsueh Pao. 1993 Apr;15(2):83-8. Unique Identifier : AIDSLINE MED/94062080; Li X; PUMC Hospital, Beijing.; Using the immunohistochemical avidin-biotin-peroxidase complex (ABC) method, lymphocyte subsets in the salivary glands of 15 patients with primary Sjogren s syndrome, 7 patients with secondary Sjogren s syndrome and 4 normal controls were identified by monoclonal antibodies. The infiltrating lymphocytes were mainly T
Human immunodeficiency virus transmission between surgeons and patients in orthopaedic surgery.: Clin Orthop. 1993 Dec;(297):272-81. Unique Identifier : AIDSLINE MED/94062214; Wright JG; McGeer A; Hospital for Sick Children, Division of Orthopaedic Surgery,; Toronto, Ontario, Canada.; Surgeons are at risk for contracting human immunodeficiency virus (HIV) from patients. The risk of HIV transmission between patient and surgeon and the potential strategies to reduce the risk of HIV transmission are important. Continuous occupational exposure makes the risk of HIV transmission greater for surgeons tha
Unusual eruption of cutaneous metastases from occult gastric carcinoma shortly after HIV-1 infection.: Cutis. 1993 Sep;52(3):173-6. Unique Identifier : AIDSLINE MED/94062380; Sinicco A; Gagliano P; Caramello P; Fora R; Sciandra M; Novero D; Institute of Infectious Disease, University of Turin, Italy.; We report a case of eruptive metastases to the skin of the face and neck from a hitherto unknown gastric carcinoma, occurring in a fifty-two-year-old man (a regular blood donor), about six months after he contracted human immunodeficiency virus-1 infection. The eruption, consisting of more than thirty pea-sized cutane
Guideline for flow cytometric immunophenotyping: a report from the National Institute of Allergy and Infectious Diseases, Division of AIDS.: Cytometry. 1993 Oct;14(7):702-15. Unique Identifier : AIDSLINE MED/94062483; Calvelli T; Denny TN; Paxton H; Gelman R; Kagan J; Department of Pediatrics, Albert Einstein College of Medicine,; Bronx, New York.
Issues in biomedical ethics.: Dis Mon. 1993 Dec;39(12):869-925. Unique Identifier : AIDSLINE MED/94062504; Vevaina JR; Nora LM; Bone RC; Harborview Medical Center, San Diego, California.; Bioethics is the discipline of ethics dealing with moral problems arising in the practice of medicine and the pursuit of biomedical research. Physicians may confront ethical dilemmas regularly in their individual relationships with patients and in institutional and societal decisions on health care policy. Ethical pro
[Acute kidney failure caused by sulfadiazine stones. A complication of the therapy of toxoplasmosis in AIDS]: Dtsch Med Wochenschr. 1993 Nov 19;118(46):1683-6. Unique Identifier : AIDSLINE MED/94062559; Kronawitter U; Jakob K; Zoller WG; Rauh G; Goebel FD; Medizinische Poliklinik der Universitat, Klinikum Grosshadern,; Universitat Munchen.; A 45-year-old man with AIDS was treated for a recurrence of cerebral toxoplasmosis with sulphadiazine, 4 g, and pyrimethamine, 75 mg, daily. Owing to a lack of appetite and dysphagia he drank rather little water during the first week of treatment. On the 13th day after starting the drugs he had bilateral renal colics
[The prevention of Pneumocystis carinii pneumonia in HIV infection]: Dtsch Med Wochenschr. 1993 Nov 19;118(46):1694-7. Unique Identifier : AIDSLINE MED/94062561; Rockstroh JK; Spengler U; Sauerbruch T; Abteilung Allgemeine Innere Medizin, Medizinische; Universitatsklinik Bonn.
Failure to detect silent HIV infection by polymerase chain reaction in subjects at risk for heterosexually transmitted HIV type 1 infection.: Eur J Clin Microbiol Infect Dis. 1993 Sep;12(9):663-7. Unique Identifier : AIDSLINE MED/94062847; Luque F; Leal M; Pineda JA; Torres Y; Aguado I; Olivera M; Hernandez-Quero J; Sanchez-Quijano A; Rey C; Lissen E; Department of Biochemistry, Virgen del Rocio University Hospital,; Seville, Spain.; The prevalence of silent HIV-1 infections in subjects at risk of acquiring HIV infection by heterosexual transmission was assessed using a nested polymerase chain reaction (PCR) assay. The two groups of risk subjects consisted of 92 female prostitutes and 43 heterosexual partners of infected individuals. Appropriate p
Diagnosis of HIV-1 infection by PCR with two primer pairs.: Eur J Epidemiol. 1993 Jul;9(4):426-9. Unique Identifier : AIDSLINE MED/94063002; Quiros E; Garcia F; Gonzalez I; Cabezas T; Bernal MC; Maroto MC; Department of Microbiology, School of Medicine of Granada, Spain.; We have used two different primer pairs to assess HIV-1 infection of peripheral blood mononuclear cells (PBMC) by polymerase chain reaction (PCR). The study was carried out on 150 individuals: 50 seronegative individuals without risk behaviours for HIV-1 infection, 50 individuals with risk-behaviours but seronegative
Anti-HIV 1 antibodies prevalence in parturients through newborn testing: results of the Italian anonymous serosurvey. The Italian Collaborative Study Group of HIV Prevalence in Newborns.: Eur J Epidemiol. 1993 Jul;9(4):430-5. Unique Identifier : AIDSLINE MED/94063003; Stegagno M; Ippolito G; Costa F; Aebischer ML; Guzzanti E; Department of Child Health, University La Sapienza, Rome, Italy.; A prevalence assessment of HIV infection among parturients was performed in order to estimate the future incidence of pediatric AIDS cases and obtain data on the trend of the infection in Italy . Consecutive whole blood samples from newborns collected on filter paper from all regions
Estimation of the magnitude of the HIV epidemic among homosexual men: utilization of survey data in predictive models.: Eur J Epidemiol. 1993 Jul;9(4):436-41. Unique Identifier : AIDSLINE MED/94063004; Veugelers PJ; Van Zessen G; Hendriks JC; Sandfort TG; Coutinho RA; Van Griensven GJ; Municipal Health Service, Department of Public Health, Amsterdam,; The Netherlands.; A group of 709 randomly selected males aged 18-55 years living in the city of Amsterdam, the Netherlands , were questioned about sexual lifestyle and related behavior. A substantial proportion (10%) of these men appeared to be homo- or bisexual. Of these homo- and bisexual men,
A Cyanobacterium-like body found in the stools of an HIV+ patient with diarrhoea [letter]: Eur J Epidemiol. 1993 Jul;9(4):453-4. Unique Identifier : AIDSLINE MED/94063008; Brandonisio O; Maggi P; Panaro MA; Marangi A; Marzio R; Angarano G
Emergence of oropharyngeal candidiasis caused by non-albicans species of Candida in HIV-infected patients [letter]: Eur J Epidemiol. 1993 Jul;9(4):455-6. Unique Identifier : AIDSLINE MED/94063009; Barchiesi F; Morbiducci V; Ancarani F; Scalise G
Synergistic cytotoxicity of AZT plus alpha and gamma interferon in chronic myeloid leukemia cell line K562.: Eur J Haematol. 1993 Oct;51(4):209-13. Unique Identifier : AIDSLINE MED/94063013; Tosi P; Visani G; Ottaviani E; Gamberi B; Cenacchi A; Tura S; Istituto di Ematologia L. e A. Seragnoli, Universita di; Bologna, Italy.; We have previously reported that the antineoplastic activity of 3 -azido 3 deoxythymidine ( AZT ) can be increased by drugs that inhibit de novo thymidylate synthesis, such as 5-fluorouracil, methotrexate and hydroxyurea. In the present study we tested
The real costs of infection control.: Dent Econ. 1993 May;83(5):83-6, 88. Unique Identifier : AIDSLINE MED/94063198; Diehnelt DE
Psychosocial risk factors for HIV transmission in male drug abusers.: Genet Soc Gen Psychol Monogr. 1993 Aug;119(3):369-87. Unique Identifier : AIDSLINE MED/94063465; Brook JS; Brook DW; Whiteman M; Roberto J; Masci JR; De Catalogne J; Amundsen F; Department of Psychiatry and Behavioral Sciences New York Medical; College.; We studied the psychosocial risk factors associated with Black, Hispanic, and White (N = 257) male intravenous drug abusers needle-sharing behavior with familiar individuals and with strangers. Approximately half the subjects were HIV+. The findings supported a mediational model in that risk factors in the family dom
Inactivation of a yeast transactivator by the fused HIV-1 proteinase: a simple assay for inhibitors of the viral enzyme activity.: Gene. 1993 Nov 30;134(1):123-8. Unique Identifier : AIDSLINE MED/94063506; Murray MG; Hung W; Sadowski I; Das Mahapatra B; Schering-Plough Research Institute, Kenilworth, NJ 07033-0539.; The human immunodeficiency virus type 1 (HIV-1) proteinase (PR) and its flanking sequences have been fused in frame between the DNA-binding domain and the transcription-activation domain of the yeast protein, GAL4. As has been shown before with the 3C proteinase of Coxsackie virus B3 (CVB3) [Das Mahapatra et al., Proc
Audit of endoscopic surveillance biopsy specimens in HIV positive patients with gastrointestinal symptoms.: Gut. 1993 Oct;34(10):1429-32. Unique Identifier : AIDSLINE MED/94063602; Lim SG; Lipman MC; Squire S; Pillay D; Gillespie S; Sankey EA; Dhillon AP; Johnson MA; Lee CA; Pounder RE; University Department of Medicine, Royal Free Hospital and School; of Medicine, London.; An audit of upper gastrointestinal endoscopy in HIV infected patients with gastrointestinal symptoms assessed the frequency of disease detected by endoscopy and routine laboratory analysis of surveillance biopsy specimens. Sixty nine consecutive endoscopies were performed in 59 HIV infected patients. Endoscopic biopsy
Bleeding as a cause of death in HIV-seropositive patients with congenital clotting disorders.: Haematologia (Budap). 1993;25(2):123-9. Unique Identifier : AIDSLINE MED/94063694; Mares M; Sartori MT; Stocco D; Girolami A; Institute of Medical Semeiotics, University of Padua Medical; School, Italy.; The causes of death in a group of HIV-seropositive patients suffering from congenital clotting disorders (cCD) were studied. During the past 6 years, we have followed 19 patients with cCD and HIV infection. Eight patients fulfilled revised CDC criteria for AIDS, 6 subjects reached stage III of CDC, and 5 remained asym
AIDS.: Health Aff (Millwood). 1993 Fall;12(3):263. Unique Identifier : AIDSLINE MED/94063747
Histopathologic features in the central nervous system of 400 acquired immunodeficiency syndrome cases: implications of rates of occurrence.: Hum Pathol. 1993 Nov;24(11):1189-98. Unique Identifier : AIDSLINE MED/94063836; Rhodes RH; Department of Pathology, Case Western Reserve University School; of Medicine, Cleveland, OH.; Histopathologic lesions in the central nervous system (CNS) of 400 autopsy cases of the acquired immunodeficiency syndrome (AIDS) collected from 1982 to 1990 were studied. Lesions most closely associated with human immunodeficiency virus (HIV) infection in the CNS (perivascular macrophages, nodular encephalomyelitis,
Localization of p53 protein and human papillomavirus in anogenital squamous lesions: immunohistochemical and in situ hybridization studies in benign, dysplastic, and malignant epithelia.: Hum Pathol. 1993 Nov;24(11):1238-42. Unique Identifier : AIDSLINE MED/94063842; Walts AE; Koeffler HP; Said JW; Department of Pathology and Laboratory Medicine, Cedars-Sinai; Medical Center, Los Angeles, CA 90048.; p53 Protein is a 53-kd nuclear phosphoprotein believed to play an important role in controlling proliferation of neoplastic and normal cells. This natural tumor suppressor can be rendered ineffective (or oncogenic) by mutations in the p53 gene or by interactions with proteins synthesized by DNA-transforming viruses, i
Small lymphocytic non-Hodgkin's lymphoma of suppressor/cytotoxic T-cell phenotype [CD4(-), CD8(+)]: Hum Pathol. 1993 Nov;24(11):1253-6. Unique Identifier : AIDSLINE MED/94063844; Dorfman DM; Longtine JA; Weinberg DS; Pinkus GS; Department of Pathology, Brigham and Women's Hospital, Boston, MA; 02115.; An unusual case of small lymphocytic non-Hodgkin s lymphoma of suppressor/cytotoxic T-cell phenotype is described. The patient presented with significant involvement of the spleen, lymph nodes, and bone marrow, but without a leukemic phase. Most small lymphocytic lymphomas are of B
The pathogenesis of the neurological complications of HIV-1 infection.: Genitourin Med. 1993 Oct;69(5):333-40. Unique Identifier : AIDSLINE MED/94063870; Brew BJ; National Centre in HIV Epidemiology and Clinical Research,; Darlinghurst, Sydney, Australia.
HIV and other sexually transmitted diseases at a rural hospital in Zimbabwe.: Genitourin Med. 1993 Oct;69(5):352-6. Unique Identifier : AIDSLINE MED/94063873; Le Bacq F; Mason PR; Gwanzura L; Robertson VJ; Latif AS; Karoi District Hospital.; OBJECTIVE--To define the epidemiological characteristics of STD patients attending an outpatient clinic in rural Zimbabwe , to examine the aetiologic agents causing infection and to determine their relationship with HIV infection. SUBJECTS--319 men and 146 women, making a sample o
Outpatient follow-up in women with HIV infection in Parkside Health Authority (UK).: Genitourin Med. 1993 Oct;69(5):370-2. Unique Identifier : AIDSLINE MED/94063877; Horner PJ; McBride M; Coker RJ; Crowley S; Harris JR; Murphy SM; Weber JN; Renton AM; Department of Genitourinary Medicine and Communicable Diseases,; St Mary's Hospital, London, UK.; OBJECTIVE--To describe patterns of attendance for follow-up among HIV infected women in Parkside, UK and their correlates. DESIGN--Retrospective cohort study. SUBJECTS--103 HIV infected women. MAIN OUTCOME MEASURES--Whether patients attended for follow-up between three and 18 months. RESULTS--31% of women were married
Defective IgG2 response to Pneumovax in HIV seropositive patients.: Genitourin Med. 1993 Oct;69(5):373-6. Unique Identifier : AIDSLINE MED/94063878; Unsworth DJ; Rowen D; Carne C; Sonnex C; Baglin T; Brown DL; Department of Clinical Immunology, Addenbrooke's Hospital,; Cambridge, UK.; OBJECTIVE--To determine whether HIV (Human Immunodeficiency Virus) antibody positive adults are capable of mounting an effective immune response when immunized with polyvalent pneumococcal vaccine. DESIGN--28 patients (nine homosexual men, one bisexual man, three heterosexual females, 10 injecting drug abusers, five h
Attitudes of medical students to HIV and AIDS.: Genitourin Med. 1993 Oct;69(5):377-80. Unique Identifier : AIDSLINE MED/94063879; Evans JK; Bingham JS; Pratt K; Carne CA; Department of Genitourinary Medicine, Middlesex Hospital, London.; OBJECTIVE--To assess the knowledge and attitudes of medical students to HIV/AIDS and whether attitudes correlate with knowledge and clinical experience. To determine if students felt adequately prepared to deal with medical and psychological aspects of HIV/AIDS. SUBJECTS AND METHODS--The subjects consisted of 190 Lond
Hepatitis B infection post Engerix B vaccination [letter]: Genitourin Med. 1993 Oct;69(5):406-7. Unique Identifier : AIDSLINE MED/94063888; Huengsberg MI; Radcliffe KW; Boxall EH
Non tuberculous cavitory disease in a west African man with AIDS.: Genitourin Med. 1993 Oct;69(5):408. Unique Identifier : AIDSLINE MED/94063889; Jebakumar S; Goorney B; Mandal BK; Regional Department of Infectious Diseases, Monsall Hospital,; Manchester, UK.
HIV-1 gp41 binding to human peripheral blood mononuclear cells occurs preferentially to B Lymphocytes and monocytes.: Immunobiology. 1993 Aug;188(4-5):323-9. Unique Identifier : AIDSLINE MED/94063979; Chen YH; Bock G; Vornhagen R; Steindl F; Katinger H; Dierich MP; Ludwig Boltzmann Institute for AIDS Research, Innsbruck, Austria.; Based on our findings that HIV-1 gp41 independently of CD4 can bind to the human helper T lymphoid cell line H9, B cell line Raji and monocyte cell line U937, we characterized putative binding of HIV-1 gp41 to human peripheral blood lymphocytes (PBLs) and monocytes. Using flow cytometry (FACS), we demonstrated that th
Caveat surgeon: do orthopaedic surgeons take adequate precautions against blood-borne viral infections, in particular the human immunodeficiency virus (HIV)?: Injury. 1993 Sep;24(8):511-3. Unique Identifier : AIDSLINE MED/94064124; Asante DK; Tait GR; Glasgow Royal Infirmary, UK.; One year ago the British Orthopaedic Association issued guidelines for the prevention of cross-infection with special reference to HIV and the hepatitis viruses. We were interested to establish whether the guidelines were being widely applied and whether they had changed general orthopaedic practice. We distributed a
Epstein-Barr virus subtype distribution in angioimmunoblastic lymphadenopathy.: Int J Cancer. 1993 Nov 11;55(5):748-52. Unique Identifier : AIDSLINE MED/94064161; Borisch B; Caioni M; Hurwitz N; Dommann-Scherrer C; Odermatt B; Waelti E; Laeng RH; Kraft R; Laissue J; Pathologisches Institut, Universitat Bern.; The tissues of 16 patients bearing a T-cell lymphoma of angioimmunoblastic lymphadenopathy type (AILD-TCL) were investigated for the distribution of Epstein-Barr virus (EBV) subtypes 1 and 2. EBV-association had been proven in these cases by polymerase chain reaction (PCR) for EBV-DNA, in situ hybridization (ISH) for
Discrimination against people with HIV/AIDS [news]: Int Nurs Rev. 1993 Sep-Oct;40(5):132. Unique Identifier : AIDSLINE MED/94064234
Tuberculosis is the leading cause of death attributable to a single infectious pathogen [news]: Int Nurs Rev. 1993 Sep-Oct;40(5):133. Unique Identifier : AIDSLINE MED/94064235
WHO is recommending sweeping reforms in prisons [news]: Int Nurs Rev. 1993 Sep-Oct;40(5):133. Unique Identifier : AIDSLINE MED/94064236
Educating nurses to change their attitudes about caring for patients with HIV/AIDS.: Int Nurs Rev. 1993 Sep-Oct;40(5):144-9. Unique Identifier : AIDSLINE MED/94064239; Hewitt HH; Department of Advanced Nursing Education, University of the West; Indies, Jamaica.; Changing nurses attitude about caring for HIV/AIDS patients is a challenge for nursing leaders, who have no choice but to promote an attractive and acceptable environment in which nurses can practice safely, compassionately and knowledgeably. Below, how nursing administrators and educators can develop strategies to m
Preface: AIDS in Israel--1993.: Isr J Med Sci. 1993 Oct;29(10 Suppl):1-2. Unique Identifier : AIDSLINE MED/94064273; Maayan S; Handzel ZT; Department of Clinical Microbiology and Infectious Diseases,; Hadassah University Hospital, Jerusalem, Israel.
HIV infection and intravenous drug abuse: world perspective and epidemiology in Israel.: Isr J Med Sci. 1993 Oct;29(10 Suppl):11-4. Unique Identifier : AIDSLINE MED/94064275; Dan M; Infectious Diseases Unit, Edith Wolfson Hospital, Holon, Israel.; As the second largest group of persons to have been infected with human immunodeficiency virus (HIV) and the main source of HIV transmission to heterosexual partners in the industrialized world, intravenous drug abusers (IVDAs) play an increasingly important role in the AIDS epidemic. The situation is particularly ala
Clinical, epidemiological and natural history study of HIV-1 infection among seropositive homo/bisexuals in Israel, 1986-92. A collaborative study in three medical centers [published erratum appears in Isr J Med Sci 1993 Nov;29(11):following 755]: Isr J Med Sci. 1993 Oct;29(10 Suppl):15-8. Unique Identifier : AIDSLINE MED/94064276; Yust I; Maayan S; Burke M; Vardinon N; Moses A; Burstein R; Hendlzel Z; Bentwich Z; Department of Medicine A, Tel Aviv Medical Center (Ichilov; Hospital, Israel.; The clinical and epidemiological aspects of HIV-1 seropositive homo/bisexuals at three AIDS screening clinics in Israel were analyzed retrospectively for the 4-year period 1986-92. Of 1,526 individuals who attended the clinics a total of 238 (15.5%) were found to be HIV-1 seroposit
The epidemiology of adult AIDS and HIV infection in Israel.: Isr J Med Sci. 1993 Oct;29(10 Suppl):2-6. Unique Identifier : AIDSLINE MED/94064278; Slater PE; Costin C; Department of Epidemiology, Ministry of Health, Jerusalem,; Israel.; Between 1980 and 1992, 227 AIDS cases and 1,010 HIV seropositives were diagnosed in Israel , 222 AIDS cases and 965 seropositives occurring in persons aged 13 years and older. Among the AIDS cases, the predominant risk groups were male homo/bisexuals, intravenous drug abusers (IVDAs
Early and complete detection of HIV exposure.: Isr J Med Sci. 1993 Oct;29(10 Suppl):31-3. Unique Identifier : AIDSLINE MED/94064281; Jehuda-Cohen T; Pediatric Research Unit, B. Rappaport Faculty of Medicine,; Technion, Haifa, Israel.; Currently, HIV diagnosis relies on serology. Yet in groups at high risk for HIV serology is not sufficient because of the window period between infection and seroconversion. There is a growing body of reports on HIV-infected yet seronegative individuals. Some tests have been developed to identify exposure to HIV by it
Host immunity and the course of HIV infection.: Isr J Med Sci. 1993 Oct;29(10 Suppl):34-6. Unique Identifier : AIDSLINE MED/94064282; Bentwich Z; Wainberg MA; Ruth Ben-Ari Institute of Clinical Immunology, Kaplan Hospital,; Rehovot, Israel.; HIV infection and disease are determined to a large extent by the host s immune response. Exposure to the virus alone does not lead necessarily to long-lasting infection and the progress of HIV infection once established varies in different individuals. The development of host immunity, while either protective or enha
Sexual behavior of heterosexual men and women attending an HIV testing clinic.: Isr J Med Sci. 1993 Oct;29(10 Suppl):37-40. Unique Identifier : AIDSLINE MED/94064283; Soskolne V; Maayan S; Dormoi NE; Department of Social Medicine, Hebrew University-Hadassah (Braun); School of Public Health and Community Medicine, Jerusalem,; Israel.; The prevalence of high risk sexual behaviors was assessed among heterosexual men (n = 154) and women (n = 109) voluntarily attending an HIV testing clinic in Jerusalem. Men were found to be involved more frequently than women in nonmonogamous relationships (66% vs. 45% respectively, P
Israeli youth and AIDS: knowledge and attitude changes among high school students following an AIDS education program.: Isr J Med Sci. 1993 Oct;29(10 Suppl):41-7. Unique Identifier : AIDSLINE MED/94064284; Schenker II; Greenblatt CL; Department of Medical Ecology, Hebrew University-Hadassah (Braun); School of Public Health and Community Medicine, Jerusalem,; Israel.; A pilot project conducted in three Jerusalem schools in 1990-91 demonstrated that medical students who had received extensive training in teaching about AIDS and its prevention were able to influence the level of knowledge and attitudes on this subject among high school students. Research findings showed moderate to l
A culturally specific educational program to reduce the risk of HIV and HBV transmission among Ethiopian immigrants to Israel II: Evaluating the effect of the training program on veteran immigrant trainees.: Isr J Med Sci. 1993 Oct;29(10 Suppl):48-54. Unique Identifier : AIDSLINE MED/94064285; Shtarkshall R; Soskolne V; Chemtov D; Rosen H; Department of Social Medicine, Hebrew University-Hadassah (Braun); School of Public Health and Community Medicine, Jerusalem,; Israel.; We describe the evaluation of a program for training veteran Ethiopian immigrants to be health educators/cultural mediators. This educational intervention project was designed to lower the risk of transmission of HIV and HBV among the immigrants who arrived in Israel in Operation S
HIV/AIDS among Palestinian Arabs [published erratum appears in Isr J Med Sci 1993 Nov;29(11):following 755]: Isr J Med Sci. 1993 Oct;29(10 Suppl):7-10. Unique Identifier : AIDSLINE MED/94064286; Maayan S; Shinar E; Aefani M; Soughayer M; el Khoudary R; Rahav G; Manny N; Department of Clinical Microbiology, Hadassah University; Hospital, Jerusalem, Israel.; We studied 24 HIV-positive Palestinians who presented for medical care in the West Bank , Jerusalem and the Gaza Strip between 1987 and 1992. Three individuals, all males, were detected by bloo
Comparison of QEEG and response accuracy in good vs poorer performers during a vigilance task.: Int J Psychophysiol. 1993 Sep;15(2):123-33. Unique Identifier : AIDSLINE MED/94064457; Valentino DA; Arruda JE; Gold SM; Department of Psychology, University of Rhode Island, Kingston; 02881.; Subjects performed an auditory continuous performance test requiring them to detect targets in a series of letters presented at a rate of 2/s. 2-min samples of EEG were obtained from eight bipolar sites during a resting condition and during early and late (7-10 min) test performance. EEG power spectra from 27 subjects
Mer-N5075A, a potential HIV-1 protease inhibitor, produced by Streptomyces chromofuscus.: J Antibiot (Tokyo). 1993 Oct;46(10):1622-4. Unique Identifier : AIDSLINE MED/94064515; Kaneto R; Chiba H; Dobashi K; Kojima I; Sakai K; Shibamoto N; Nishida H; Okamoto R; Akagawa H; Mizuno S; Central Research Laboratories, Mercian Corporation, Fujisawa,; Japan.
Monoclonality in reactive lymphadenopathy: gene rearrangement and multiparameter analysis.: Hematol Pathol. 1993;7(3):143-52. Unique Identifier : AIDSLINE MED/94064529; Farhi DC; McGuire PW; Luckey CN; Department of Pathology and Laboratory Medicine, Emory University; School of Medicine, Atlanta, Georgia.; Multiparameter analysis of lymph nodes with follicular, interfollicular, and/or atypical hyperplasia was undertaken to search for monoclonality. Twenty-three patients aged 7 to 75 years (mean 32 years) were studied. One patient had a history of lymphoma; two were HIV-positive. Nodes were removed for clinical suspicion
Herpes zoster: daily marking of new vesicles in therapeutic studies. A clinical method for objective assessment of the end of the eruptive phase.: J Am Acad Dermatol. 1993 Dec;29(6):970-3. Unique Identifier : AIDSLINE MED/94064955; Runne U; Ochsendorf FR; Department of Dermatology, J.W. Goethe University,; Frankfurt/Main, Germany.; BACKGROUND: The efficacy of a therapeutic agent must be evaluated by objective criteria. However, in herpes zoster (HZ) studies there has been no generally accepted objective clinical criterion. OBJECTIVE: Our purpose was to establish a clinical method for determining objectively the point in time at which the eruptiv
Earvin Magic Johnson's HIV serostatus disclosure: effects on men's perceptions of AIDS.: J Consult Clin Psychol. 1993 Oct;61(5):887-91. Unique Identifier : AIDSLINE MED/94064980; Kalichman SC; Russell RL; Hunter TL; Sarwer DB; Department of Psychiatry and Mental Health Sciences, Medical; College of Wisconsin, Milwaukee 53226.; The effects of celebrity self-disclosure of human immunodeficiency virus (HIV) seropositivity on perceptions of HIV and Acquired Immunodeficiency Syndrome (AIDS) were investigated. AIDS-related interest and knowledge measures were collected from 468 men before and after basketball star Earvin Magic Johnson s self-disc
Augmentation of in vitro cytolytic activity of LAK cells with heated ATL-derived cell lines.: J Dermatol. 1993 Aug;20(8):457-65. Unique Identifier : AIDSLINE MED/94065001; Nakayama J; Toshitani A; Hattori T; Moroi Y; Hori Y; Department of Dermatology, Faculty of Medicine, Kyushu; University, Fukuoka, Japan.; Three adult T-cell leukemia/lymphoma-derived cell lines, MT-2, MJ, and HUT102, were investigated to determine how they responded to hyperthermia, lymphokine-activated killer (LAK) cells, or a combination of both in vitro. All three cell lines showed a similar sensitivity to LAK cells, but revealed varying degrees of s
Truth or consequences: dishonesty in dating and HIV/AIDS-related issues in a college-age population.: J Am Coll Health. 1993 Sep;42(2):51-4. Unique Identifier : AIDSLINE MED/94065012; Stebleton MJ; Rothenberger JH; University of Minnesota, Minneapolis.; This article examines the issue of dishonesty in dating among college students as it relates to the HIV/AIDS epidemic in the United States . The authors surveyed 171 under-graduates at a large midwestern university in January 1991. They conducted an analysis by gender and found signific
Comparison of anthropometric measures of men with HIV: asymptomatic, symptomatic, and AIDS.: J Am Diet Assoc. 1993 Dec;93(12):1404-8. Unique Identifier : AIDSLINE MED/94065074; Parisien C; Gelinas MD; Cossette M; Department of Nutrition, University of Montreal, Quebec, Canada.; OBJECTIVE: Anthropometric measures were performed to determine differences in estimated fat mass, lean body mass, and body weight among three groups of men infected with human immunodeficiency virus (HIV). DESIGN: This study was cross-sectional. SETTING: Local centers of community services and support groups for perso
Reversion of the SCID phenotype by human T cell grafts. Development of cross-species immunocompetence.: J Immunol. 1993 Dec 1;151(11):5948-54. Unique Identifier : AIDSLINE MED/94065148; Donjon CM; Morkowski H; Cheung RK; Leeder JS; Dosch HM; Department of Pediatrics, University of Toronto, Hospital For; Sick Children, Ontario, Canada.; Due to defective recombinase function, mice with severe combined immunodeficiency (SCID) lack functional lymphocytes and can accept human lymphoid xenografts. Xenografted animals (SCIDhum) are thought to provide a neutral environment for in vivo studies of normal, malignant or HIV-infected human cells. SCIDhum often d
Shared T cell-defined antigens on independently derived tumors.: J Immunol. 1993 Dec 1;151(11):6302-10. Unique Identifier : AIDSLINE MED/94065184; Sahasrabudhe DM; Burstyn D; Dusel JC; Hibner BL; Collins JL; Zauderer M; Cancer Center, University of Rochester School of Medicine and; Dentistry, NY 14642.; We report that a subset of tumors independently derived from a cloned line of contact-inhibited, non-tumorigenic murine fetal fibroblasts confer cross-protective immunity against each other in vivo. Concordant with the in vivo cross-protection, cytolytic T cell clones from mice immunized with one of these tumor lines
C33 antigen and M38 antigen recognized by monoclonal antibodies inhibitory to syncytium formation by human T cell leukemia virus type 1 are both members of the transmembrane 4 superfamily and associate with each other and with CD4 or CD8 in T cells.: J Immunol. 1993 Dec 1;151(11):6470-81. Unique Identifier : AIDSLINE MED/94065201; Imai T; Yoshie O; Shionogi Institute for Medical Science, Osaka, Japan.; C33 Ag and M38 Ag had been identified by mAb inhibitory to HTLV-1-induced syncytium formation. The cDNA encoding C33 Ag had revealed that it belongs to the newly defined transmembrane 4 superfamily (TM4SF). M38 Ag was detected on virtually all human cell lines and fresh leukocytes except for most granulocytes. It was
Further characterization of the interaction between the C1q subcomponent of human C1 and the transmembrane envelope glycoprotein gp41 of HIV-1.: J Immunol. 1993 Dec 1;151(11):6583-92. Unique Identifier : AIDSLINE MED/94065213; Thielens NM; Bally IM; Ebenbichler CF; Dierich MP; Arlaud GJ; Laboratoire d'Enzymologie Moleculaire, Institut de Biologie; Structurale, Grenoble, France.; Previous studies have provided evidence for activation of the human C1 complex by HIV-1, resulting from direct interaction between C1q and the external portion of the viral transmembrane envelope protein, rsgp41. The present study was undertaken to locate more precisely, within C1q and rsgp41, the sites involved in th
Various questions on AIDS.: J Indian Med Assoc. 1993 Aug;91(8):214. Unique Identifier : AIDSLINE MED/94065226; Mukherjee S; Department of Medicine, Medical College, Calcutta.
Quinolinic acid in the cerebrospinal fluid of children with symptomatic human immunodeficiency virus type 1 disease: relationships to clinical status and therapeutic response.: J Infect Dis. 1993 Dec;168(6):1380-6. Unique Identifier : AIDSLINE MED/94065260; Brouwers P; Heyes MP; Moss HA; Wolters PL; Poplack DG; Markey SP; Pizzo PA; Pediatric Branch, National Cancer Institute, NIH Clinical Center,; Bethesda, MD 20892.; Quinolinic acid (QUIN) is a neurotoxin implicated in the neurologic deficits associated with human immunodeficiency virus type 1 (HIV-1) infection. Forty children with symptomatic HIV-1 disease had elevated (P
Safety and immunogenicity of a fully glycosylated recombinant gp160 human immunodeficiency virus type 1 vaccine in subjects at low risk of infection. National Institute of Allergy and Infectious Diseases AIDS Vaccine Evaluation Group Network.: J Infect Dis. 1993 Dec;168(6):1387-95. Unique Identifier : AIDSLINE MED/94065261; Belshe RB; Clements ML; Dolin R; Graham BS; McElrath J; Gorse GJ; Schwartz D; Keefer MC; Wright P; Corey L; et al; Dept. of Medicine, St. Louis University School of Medicine, MO; 63104.; Recombinant gp160 derived from human immunodeficiency virus type 1 (HIV-1)IIIB and produced in mammalian tissue culture cells using a vaccinia virus expression system (rgp160-mam) was evaluated as a vaccine in combination with alum and deoxycholate adjuvant. Sixty low-risk, uninfected subjects received 12.5 micrograms
Cross-reactive response to human immunodeficiency virus type 1 (HIV-1) gp120 and HLA class I heavy chains induced by receipt of HIV-1-derived envelope vaccines.: J Infect Dis. 1993 Dec;168(6):1396-403. Unique Identifier : AIDSLINE MED/94065262; De Santis C; Robbioni P; Longhi R; Lopalco L; Siccardi AG; Beretta A; Roberts NJ Jr; Department of Biological and Technological Research, Ospedale S.; Raffaele, Milan, Italy.; Autoantibodies specific to HLA class I antigens were detected in the sera of persons vaccinated with human immunodeficiency virus type 1-derived recombinant vaccines by using synthetic peptides representing the amino acid sequences recognized by an HLA class I/gp120 cross-reactive monoclonal antibody. Study subjects r
The association between circumcision status and human immunodeficiency virus infection among homosexual men.: J Infect Dis. 1993 Dec;168(6):1404-8. Unique Identifier : AIDSLINE MED/94065263; Kreiss JK; Hopkins SG; Department of Epidemiology, University of Washington, Seattle.; To evaluate whether uncircumcised status is correlated with acquisition of human immunodeficiency virus (HIV), 502 homosexual men were surveyed; 85% were circumcised. HIV infection was significantly associated with uncircumcised status (odds ratio [OR], 2.2; 95% confidence interval [CI], 1.2, 3.8), nonwhite race, intr
Early abnormalities of the antibody response against Mycobacterium tuberculosis in human immunodeficiency virus infection.: J Infect Dis. 1993 Dec;168(6):1409-14. Unique Identifier : AIDSLINE MED/94065264; Saltini C; Amicosante M; Girardi E; Antonucci G; Ippolito G; Ameglio F; Monno T; Congedo P; Angarano G; Babudieri S; et al; Institute of Tuberculosis and Chest Diseases, University of; Modena, Italy.; Among human immunodeficiency virus (HIV)-infected persons, those who react against purified protein derivative (PPD) have higher risk of tuberculosis. Since PPD testing has limited predictive power in HIV-positive populations, new markers of antituberculous immunity were sought by analyzing antibodies to Mycobacterium
Systemic cell-mediated immune reactivity in women with recurrent vulvovaginal candidiasis.: J Infect Dis. 1993 Dec;168(6):1458-65. Unique Identifier : AIDSLINE MED/94065271; Fidel PL Jr; Lynch ME; Redondo-Lopez V; Sobel JD; Robinson R; Division of Infectious Diseases, Wayne State University, School; of Medicine, Detroit, Michigan.; It has been suggested that impaired cell-mediated immunity (CMI) against Candida antigens is responsible for susceptibility to recurrent vulvovaginal candidiasis (RVVC) in adult women. To address this, we conducted a comprehensive longitudinal study examining in vivo and in vitro systemic CMI reactivity in RVVC patien
Primary human immunodeficiency virus type 1 infection: review of pathogenesis and early treatment intervention in humans and animal retrovirus infections.: J Infect Dis. 1993 Dec;168(6):1490-501. Unique Identifier : AIDSLINE MED/94065276; Niu MT; Stein DS; Schnittman SM; Medical Branch, NIAID, NIH, Bethesda, MD 20892.; Primary human immunodeficiency virus type 1 (HIV-1) infection can present clinically as the abrupt onset of a febrile illness resembling acute mononucleosis. The symptoms coincide with high titers of culturable plasma viremia, cell-associated virus, and antigenemia, which rapidly decrease coincident with the emergence
Intravitreal ganciclovir concentration after intravenous administration in AIDS patients with cytomegalovirus retinitis: implications for therapy.: J Infect Dis. 1993 Dec;168(6):1506-9. Unique Identifier : AIDSLINE MED/94065278; Kuppermann BD; Quiceno JI; Flores-Aguilar M; Connor JD; Capparelli EV; Sherwood CH; Freeman WR; Department of Ophthalmology, University of California, San Diego,; School of Medicine.; To determine whether therapeutic intravitreal concentrations of ganciclovir are achieved after intravenous administration, vitreous samples were obtained intraoperatively from 23 eyes of 22 AIDS patients with retinal detachments associated with cytomegalovirus (
Evidence of previous infection with Mycobacterium avium-Mycobacterium intracellulare complex among healthy subjects: an international study of dominant mycobacterial skin test reactions.: J Infect Dis. 1993 Dec;168(6):1553-8. Unique Identifier : AIDSLINE MED/94065289; von Reyn CF; Barber TW; Arbeit RD; Sox CH; O'Connor GT; Brindle RJ; Gilks CF; Hakkarainen K; Ranki A; Bartholomew C; et al; Infectious Disease Section, Dartmouth-Hitchcock Medical Center,; Lebanon, NH 03756.; Skin tests with 0.1 mL of intermediate-strength Mycobacterium tuberculosis purified protein derivative (PPD) and 0.1 mL of Mycobacterium avium sensitin were conducted on 484 healthy subjects from diverse geographic sites. Reactions of > or = 5 mm to one antigen that exceeded the reaction to the other by > or = 3 mm we
Low serum levels of oral antimycobacterial agents in patients with disseminated Mycobacterium avium complex disease.: J Infect Dis. 1993 Dec;168(6):1559-62. Unique Identifier : AIDSLINE MED/94065290; Gordon SM; Horsburgh CR Jr; Peloquin CA; Havlik JA Jr; Metchock B; Heifets L; McGowan JE Jr; Thompson SE 3d; Department of Medicine, Emory University School of Medicine,; Atlanta, Georgia.; Twenty-seven human immunodeficiency virus-infected patients with disseminated Mycobacterium avium complex disease who were treated with oral antimycobacterial agents (clofazimine, ciprofloxacin, ethambutol, and rifampin) were studied to evaluate the usefulness of monitoring serum drug concentrations and testing in vit
Defective antifungal activity of monocyte-derived macrophages from human immunodeficiency virus-infected children against Aspergillus fumigatus.: J Infect Dis. 1993 Dec;168(6):1562-5. Unique Identifier : AIDSLINE MED/94065291; Roilides E; Holmes A; Blake C; Pizzo PA; Walsh TJ; Infectious Diseases Section, National Cancer Institute, National; Institutes of Health, Bethesda, Maryland 20892.; Invasive aspergillosis recently has been encountered in adults and children with human immunodeficiency virus (HIV) infection even without known risk factors, such as neutropenia or corticosteroid therapy. Macrophages play a significant role in the host defenses against Aspergillus organisms by ingesting conidia and p
Small subunit rRNA sequence of Enterocytozoon bieneusi and its potential diagnostic role with use of the polymerase chain reaction.: J Infect Dis. 1993 Dec;168(6):1570-5. Unique Identifier : AIDSLINE GENBANK/L07123; Zhu X; Wittner M; Tanowitz HB; Kotler D; Cali A; Weiss LM; Department of Pathology (Division of Parasitology and Tropical; Medicine, Albert Einstein College of Medicine, Bronx, New York; 10461.; In the past several years, microsporidia have become recognized as another important group of opportunistic infections of immunocompromised patients, especially those with AIDS. Enteric infections with the noncultivatable microsporidian parasite Enterocytozoon bieneusi have been diagnosed from AIDS patients with chron
Detection of Toxoplasma gondii by competitive DNA amplification of bronchoalveolar lavage samples.: J Infect Dis. 1993 Dec;168(6):1585-8. Unique Identifier : AIDSLINE MED/94065296; Bretagne S; Costa JM; Vidaud M; Tran J; Nhieu V; Fleury-Feith J; Laboratoire de Parasitologie, Hopital Henri Mondor, Creteil,; France.; The prevalence of pulmonary toxoplasmosis was assessed by a prospective analysis of 144 bronchoalveolar lavage (BAL) samples using competitive polymerase chain reaction (PCR) to avoid false-negative results due to PCR techniques. Six samples were excluded because they contained amplification reaction inhibitors. None
Spontaneous lymphocyte proliferation in human T lymphotropic virus type II infection is associated with increased provirus load.: J Infect Dis. 1993 Dec;168(6):1599-600. Unique Identifier : AIDSLINE MED/94065303; Prince HE; Swanson P
Treatment trials for primary human immunodeficiency virus type 1 infection [letter]: J Infect Dis. 1993 Dec;168(6):1601-2. Unique Identifier : AIDSLINE MED/94065304; Niu MT; Stein DS; Schnittman SM
[Progress on the study of allergy and immunology in the field of internal medicine]: Nippon Naika Gakkai Zasshi. 1993 Sep 10;82(9):1305-12. Unique Identifier : AIDSLINE MED/94065371; Kimura I
[Autoimmune thyroiditis]: Nippon Naika Gakkai Zasshi. 1993 Sep 10;82(9):1341-55. Unique Identifier : AIDSLINE MED/94065375; Nagataki S
Effect of health education programme on knowledge about AIDS and HIV transmission in paramedical personnel working in Benha hospitals.: J Egypt Public Health Assoc. 1993;68(1-2):143-59. Unique Identifier : AIDSLINE MED/94065527; Wassif OM; el-Gendy MF; Saleh MA; el-Sawaf EM; Department of Community, Environmental and Occupational Medicine,; Benha Faculty of Medicine, Zagazig University.; Accurate information about acquired immunodeficiency Syndrome (AIDS) and human immunodeficiency virus (HIV) is important for prevention. This study is intended to asses AIDS knowledge in paramedical personnel working in Benha Hospitals and to measure the effect of health education programme done on knowledge about AID
H-2Dd exploits a four residue peptide binding motif.: J Exp Med. 1993 Dec 1;178(6):1877-92. Unique Identifier : AIDSLINE MED/94065556; Corr M; Boyd LF; Padlan EA; Margulies DH; Molecular Biology Section, National Institute of Allergy and; Infectious Diseases, National Institutes of Health, Bethesda,; Maryland 20892.; We have characterized the amino acid sequences of over 20 endogenous peptides bound by a soluble analog of H-2Dd, H-2Dds. Synthetic analogs corresponding to self, viral, tumor, or motif peptides were then tested for their ability to bind to H-2Dd by serologic epitope induction assays using both purified soluble protei
Patient attitudes toward rooming with persons with HIV infection.: J Fam Pract. 1993 Dec;37(6):564-8. Unique Identifier : AIDSLINE MED/94065608; Seltzer E; Schulman KA; Brennan PJ; Lynn LA; Department of Medicine, University of Pennsylvania, Philadelphia.; BACKGROUND. Early in the HIV epidemic, hospitals developed strict isolation policies for patients with HIV infection, some of which have not been revised. The objectives of this study were to examine patient attitudes about rooming with persons with various medical conditions, including HIV, and to assess their knowle
Multiple pneumonias in a man infected with HIV.: J Fam Pract. 1993 Dec;37(6):610-5. Unique Identifier : AIDSLINE MED/94065614; Carmichael JK; Parikh TM; Department of Family Medicine, University of Arizona College of; Medicine, Tucson 85719.; There are many pathogens responsible for pneumonia in persons infected with HIV. This case report describes a patient with pneumonias diagnosed sequentially and caused by Pneumocystis carinii, Mycobacterium gordonae, and Coccidioides immitis. It demonstrates the importance of pursuing a definitive or additional diagno
Hexamethylene bisacetamide activates the human immunodeficiency virus type 1 provirus by an NF-kappa B-independent mechanism.: J Gen Virol. 1993 Nov;74 ( Pt 11):2401-8. Unique Identifier : AIDSLINE MED/94065666; Vlach J; Pitha PM; Oncology Center, Johns Hopkins University, Baltimore, Maryland; 21231.; Expression of the human immunodeficiency virus type 1 (HIV-1) provirus in T lymphocytic and monocytic cells can be induced by treatment with hexamethylene bisacetamide (HMBA). The induction occurs at the transcriptional level within 1 to 3 h after the addition of the drug, and is not associated with detectable changes
Feline immunodeficiency virus gene expression: analysis of the RNA splicing pattern and the monocistronic rev mRNA.: J Gen Virol. 1993 Nov;74 ( Pt 11):2409-17. Unique Identifier : AIDSLINE GENBANK/M59418; Tomonaga K; Shin YS; Fukasawa M; Miyazawa T; Adachi A; Mikami T; Department of Veterinary Microbiology, Faculty of Agriculture,; University of Tokyo, Japan.; The transcription pattern of the feline immunodeficiency virus (FIV) genome in a feline CD4+ cell line was examined. In addition to the genomic RNA (9.2 kb), at least five FIV-specific transcripts [5.2, 4.4 (doublet), 1.7 and 1.4 kb] were detected by using subgenomic restriction enzyme fragments of an FIV molecular cl
Complete sequence conservation of the human T cell leukaemia virus type 1 tax gene within a family cluster showing different pathologies.: J Gen Virol. 1993 Nov;74 ( Pt 11):2531-7. Unique Identifier : AIDSLINE MED/94065685; Major ME; Nightingale S; Desselberger U; Regional Virus Laboratory, East Birmingham Hospital, U.K.; We have amplified, through PCR, the full-length tax gene of human T cell leukaemia virus type 1 (HTLV-1) derived from proviral DNA of peripheral blood lymphocytes of five first degree relatives of Afro-Caribbean origin. One patient (the father) had adult T cell leukaemia (ATL), one (the mother) tropical spastic parapa
Current management of cytomegalovirus disease.: J Med Virol. 1993;Suppl 1:106-11. Unique Identifier : AIDSLINE MED/94065689; Griffiths PD; Department of Virology, Royal Free Hospital School of Medicine,; London, United Kingdom.; Cytomegalovirus ( CMV ) is an important pathogen for the fetus, for allograft recipients, and for acquired immunodeficiency syndrome (AIDS) patients; the clinical features in each of these groups of patients are described. CMV may also act as a cofactor to acceler
Cytomegalovirus infection in acquired immune-deficiency syndrome.: J Med Virol. 1993;Suppl 1:128-33. Unique Identifier : AIDSLINE MED/94065693; Katlama C; Departement de Pathologie, Infectieuse, Tropicale et de Sante; Publique, Hopital de la Salpetriere, Paris, France.; Cytomegalovirus ( CMV ) infection is very common in acquired immune deficiency syndrome (AIDS) with approximately 40% of patients presenting CMV visceral involvement at advanced stage disease. The most common localizations are retinitis and gastrointestinal involv
Potential for combined therapy with 348U87, a ribonucleotide reductase inhibitor, and acyclovir as treatment for acyclovir-resistant herpes simplex virus infection.: J Med Virol. 1993;Suppl 1:146-9. Unique Identifier : AIDSLINE MED/94065697; Safrin S; Schacker T; Delehanty J; Hill E; Corey L; Department of Medicine, Epidemiology and Biostatistics,; University of California, San Francisco.; Inhibitors of the ribonucleotide reductase of herpes simplex viruses (HSV) potentiate the activity of acyclovir in vitro and in animal studies. In addition, the combination of the ribonucleotide reductase inhibitor 348U87 and acyclovir has synergistic therapeutic effects against
Valaciclovir (BW256U87): the L-valyl ester of acyclovir.: J Med Virol. 1993;Suppl 1:150-3. Unique Identifier : AIDSLINE MED/94065698; Jacobson MA; Medical Service, San Francisco General Hospital, CA 94110.; Valaciclovir (BW256U87) is an L-valyl ester of acyclovir , which is extensively and almost completely converted to acyclovir. In healthy human volunteers, single valaciclovir doses of 100-1000 mg resulted in dose-proportional increases in acyclovir area under the curve (AUC). The
Impact of herpesvirus infections in the future.: J Med Virol. 1993;Suppl 1:158-64. Unique Identifier : AIDSLINE MED/94065700; Levin MJ; University of Colorado Health Sciences Center, School of; Medicine, Denver.; Numerous diverse, often opposing, trends will determine the frequency (and severity) of herpesvirus infections in the future. A major factor is the growing population of iatrogenically immunocompromised patients, accruing especially from large increases in organ and autologous bone marrow transplantation. Of even grea
Acyclovir: discovery, mechanism of action, and selectivity.: J Med Virol. 1993;Suppl 1:2-6. Unique Identifier : AIDSLINE MED/94065702; Elion GB; Wellcome Research Laboratories, Research Triangle Park, North; Carolina.; The reasons for acyclovir s activity and selectivity in cells infected with HSV or VZV may be summarized as follows: 1. Activation by a HSV- or VZV-specified TK. 2. Greater sensitivity of viral DNA polymerase than of the cellular polymerases to ACV-TP. 3. Inactivation of the viral DNA polymerase, but not the cellular
Herpes simplex virus infections during the decade since the licensure of acyclovir.: J Med Virol. 1993;Suppl 1:7-12. Unique Identifier : AIDSLINE MED/94065711; Corey L; Department of Laboratory Medicine, University of Washington,; Seattle 98144.; The development and use of acyclovir accelerated in the area of the natural history, epidemiology, and biology of herpes simplex viruses. The development of serologic assays that differentiate HSV-1 from HSV-2 demonstrated the worldwide distribution of
Behcet's disease and Sjogren syndrome in a patient with HTLV-I-associated myelopathy [letter]: J Neurol Sci. 1993 Oct;119(1):121-2. Unique Identifier : AIDSLINE MED/94065845; Kanazawa H; Ijichi S; Eiraku N; Igakura T; Higuchi I; Nakagawa M; Kuriyama M; Tanaka S; Osame M
HIV infection [letter]: J Obstet Gynecol Neonatal Nurs. 1993 Sep-Oct;22(5):400-1. Unique Identifier : AIDSLINE MED/94065945; Hutchinson MK; Department of Individual and Family Studies, University of; Delaware, Newark.
Preparation and anti-HIV activity of O-acylated heparin and dermatan sulfate derivatives with low anticoagulant effect.: J Med Chem. 1993 Nov 12;36(23):3546-55. Unique Identifier : AIDSLINE MED/94066102; Barzu T; Level M; Petitou M; Lormeau JC; Choay J; Schols D; Baba M; Pauwels R; Witvrouw M; De Clercq E; Sanofi Recherche-Centre Choay, Gentilly, France.; In order to increase the ratio of anti-HIV activity to anticoagulant activity, glycosaminoglycan derivatives selectively substituted at OH and/or COOH groups were prepared. Standard heparin, heparin fragments, or dermatan sulfate were converted to their tributylammonium or tetrabutylammonium salts. Their selective O-a
Simple assay system for detecting human T cell leukemia virus type I-binding cells and its application in titrating binding inhibitory antibodies.: Lab Invest. 1993 Nov;69(5):629-34. Unique Identifier : AIDSLINE MED/94066376; Akari H; Kannagi M; Shinjo T; Harada S; Department of Biodefence and Medical Virology, Kumamoto; University School of Medicine, Japan.; BACKGROUND: A simple and rapid assay system for the detection of human T cell leukemia virus type I (HTLV-I) binding cells was developed to assess the virus specific receptor and titrate the antibodies to block the virus binding. EXPERIMENTAL DESIGN: Cells (5 x 10(5)) were incubated with 100 microliters of the concent
Educating school nurses to care for HIV-infected children in school.: J Sch Health. 1993 Sep;63(7):307-11. Unique Identifier : AIDSLINE MED/94066386; Gross EJ; Passannante M; National Pediatric HIV Resource Center, UMD-New Jersey Medical; School, Children's Hospital of New Jersey, Newark 07107.; Effects of an educational program on school nurses knowledge and attitudes about human immunodeficiency virus (HIV) infection in children and changes in practice was investigated. Participants (N = 205) attended a one-day workshop held at 11 sites in New Jersey. Content was clinically focused and derived from a needs
Quantitative study of the control of HIV-1 gene expression.: J Theor Biol. 1993 Jul 21;163(2):199-221. Unique Identifier : AIDSLINE MED/94066453; Hammond BJ; Laboratory of Mathematical Biology, National Institute for; Medical Research, London, U.K.; The biochemical processes that together determine the expression of a human immunodeficiency virus (HIV) provirus integrated into the genome of a host cell are translated into mathematical form to give a dynamic model that can be examined quantitatively. The model includes the contribution of cellular enhancers to tra
Constitutive production of interleukin-8 (IL-8) by normal and malignant human B-cells and other cell types.: Leuk Res. 1993 Dec;17(12):1063-9. Unique Identifier : AIDSLINE MED/94066565; Srivastava MD; Srivastava R; Srivastava BI; Roswell Park Cancer Institute, Department of Laboratory Medicine,; Buffalo, NY 14263.; The culture supernatants from 43 human cell lines obtained during log phase and from purified normal peripheral blood B-lymphocytes cultured at 10(6) cells ml-1 for 48 h in RPMI 1640-5% fetal calf serum were examined for interleukin-8 (IL-8) using Elisa kits. Constitutive IL-8 production was found for 14/15 B-cell lin
Rhinoscleroma: a growing concern in the United States? Mayo Clinic experience.: Mayo Clin Proc. 1993 Dec;68(12):1151-7. Unique Identifier : AIDSLINE MED/94066571; Andraca R; Edson RS; Kern EB; Department of Otorhinolaryngology, Mayo Clinic Rochester,; Minnesota 55905.; Rhinoscleroma is a chronic, progressive, granulomatous infection of the upper airways caused by the bacterium Klebsiella rhinoscleromatis. Although most cases occur in developing countries, recent immigration patterns have led to an increasing number of patients with rhinoscleroma in the U
Rhinoscleroma in perspective [editorial]: Mayo Clin Proc. 1993 Dec;68(12):1219. Unique Identifier : AIDSLINE MED/94066586; Toohill RJ
Physicians know how to be good educators too: a comparison of the patient problem solving process and the instructional design process.: Med Teach. 1993;15(2-3):175-8. Unique Identifier : AIDSLINE MED/94066723; Benjamin S; Hamdy H; Ministry of Health, Manama, Bahrain.; Education should be viewed as one of the important roles of a physician. Yet, because physicians generally are not trained to be educators, many instructional sessions, lectures and workshop presentations are ineffective because the instructional design process has been ignored. While not a substitute for professional
The coming crisis of public health in the suburbs.: Milbank Q. 1993;71(4):543-64; discussion 565-74. Unique Identifier : AIDSLINE MED/94066923; Wallace R; Wallace D; New York Psychiatric Institute.; A process of urban decay, coupled with forced displacement and behavioral problems, affecting an increasing number of neighborhoods in large U.S. cities. The resulting social disintegration has intensified a nexus of deviant behaviors and conditions, including substance abuse, that are related to transmission of HIV a
HIV transmission between two adolescent brothers with hemophilia.: MMWR Morb Mortal Wkly Rep. 1993 Dec 17;42(49):948-51. Unique Identifier : AIDSLINE MED/94066935; In July 1992, the National Hemophilia Foundation and CDC received a report from a hemophilia-treatment center of a 19-year-old man with hemophilia (patient 2) who recently had seroconverted for antibody to human immunodeficiency virus (HIV). This report summarizes the findings of an investigation by CDC and state and
Estimates of future global tuberculosis morbidity and mortality.: MMWR Morb Mortal Wkly Rep. 1993 Dec 17;42(49):961-4. Unique Identifier : AIDSLINE MED/94066937; Tuberculosis (TB) is the leading cause of death associated with infectious diseases globally. The incidence of TB is expected to increase substantially worldwide during the next 10 years because of the interaction between the TB and human immunodeficiency virus (HIV) epidemics. This report uses TB notification data (i
[Inhibition of reproduction of the human immunodeficiency virus by sense and antisense oligodeoxynucleotides]: Mol Biol (Mosk). 1993 Sep-Oct;27(5):1039-43. Unique Identifier : AIDSLINE MED/94067062; Pokrovskii AG; Pliasunova OA; Blinov VM; Vlasov VV; Svinarchuk FP; Abramova TV; Gorn VV; Konevets DA; Inhibitory effects on human immunodeficiency virus (HIV) reproduction on lymphoid cell line MT-4 were characterized for antisense and sense oligodeoxynucleotides. It was established that antisense oligonucleotide pCGTAGTTCGTCGAGGTCCGT (MP-20) (ID50 = 0.1 microM) is a more effective HIV inhibitor than the previously de
A novel hepatitis B virus (HBV) genetic element with Rev response element-like properties that is essential for expression of HBV gene products.: Mol Cell Biol. 1993 Dec;13(12):7476-86. Unique Identifier : AIDSLINE MED/94067108; Huang J; Liang TJ; Gastrointestinal Unit, Massachusetts General Hospital, Boston.; Many viruses possess complex mechanisms involving multiple gene products and cis-regulatory elements in order to achieve a fine control of their gene expression at both transcriptional and posttranscriptional levels. Hepatitis B virus (HBV) and retroviruses share many structural and functional similarities. In this st
Phosphatidylinositol (PI) 3-kinase and PI 4-kinase binding to the CD4-p56lck complex: the p56lck SH3 domain binds to PI 3-kinase but not PI 4-kinase.: Mol Cell Biol. 1993 Dec;13(12):7708-17. Unique Identifier : AIDSLINE MED/94067131; Prasad KV; Kapeller R; Janssen O; Repke H; Duke-Cohan JS; Cantley LC; Rudd CE; Division of Tumor Immunology, Dana-Farber Cancer Institute,; Boston, Massachusetts 02115.; CD4 serves as a receptor for major histocompatibility complex class II antigens and as a receptor for the human immunodeficiency virus type 1 (HIV-1) viral coat protein gp120. It is coupled to the protein-tyrosine kinase p56lck, an interaction necessary for an optimal response of certain T cells to antigen. In additio
Enhancement of HIV-1 gp41 binding to Raji cells by PWM, LPS, interferon-gamma and interleukin-6.: Mol Immunol. 1993 Dec;30(17):1583-6. Unique Identifier : AIDSLINE MED/94067176; Chen YH; Opitz S; Bock G; Steindl F; Katinger H; Dierich MP; Ludwig-Boltzmann-Institut fur AIDS-Forschung, Innsbruck,; Austria.; Based on our finding that HIV-1 gp41 independently of CD4 can bind to several proteins (gp41 binding protein: GBP) on the human T-cell line H9, B-cell line Raji and monocyte-cell line U937, we examined the effect of mitogens and cytokines on binding of gp41 to H9, Raji and U937 cells. Flow cytometry (FACS) analysis de
Transmission from one child to another of human immunodeficiency virus type 1 with a zidovudine-resistance mutation [see comments]: N Engl J Med. 1993 Dec 16;329(25):1835-41. Unique Identifier : AIDSLINE MED/94067210; Fitzgibbon JE; Gaur S; Frenkel LD; Laraque F; Edlin BR; Dubin DT; Department of Molecular Genetics, University of Medicine and; Dentistry of New Jersey-Robert Wood Johnson Medical School,; Piscataway 08854.; BACKGROUND AND METHODS. We describe a child who apparently acquired human immunodeficiency virus type 1 (HIV-1) infection in the home setting. The suspected source of infection was a child with the acquired immunodeficiency syndrome who had received zidovudine and whose virus contained a mutation associated with in vi
HIV prevention--bringing the message home [editorial; comment]: N Engl J Med. 1993 Dec 16;329(25):1883-5. Unique Identifier : AIDSLINE MED/94067219; Simonds RJ; Rogers MF
Zidovudine in asymptomatic HIV infection [letter]: N Engl J Med. 1993 Dec 16;329(25):1895; discussion 1895-6. Unique Identifier : AIDSLINE MED/94067229; Phillips AN; Sabin CA
Images in clinical medicine. Coccidioides immitis.: N Engl J Med. 1993 Dec 23;329(26):1935. Unique Identifier : AIDSLINE MED/94067240; de la Maza LM
Case records of the Massachusetts General Hospital. Weekly clinicopathological exercises. Case 51-1993. A 36-year-old man with AIDS, increase in chronic diarrhea, and intermittent fever and chills.: N Engl J Med. 1993 Dec 23;329(26):1946-54. Unique Identifier : AIDSLINE MED/94067243
Changes in the mix of AIDS-defining conditions [letter]: N Engl J Med. 1993 Dec 23;329(26):1962. Unique Identifier : AIDSLINE MED/94067246; Weiss PJ; Wallace MR; Olson PE; Rossetti R
More on HTLV tax and mycosis fungoides [letter; comment]: N Engl J Med. 1993 Dec 30;329(27):2035; discussion 2035-6. Unique Identifier : AIDSLINE MED/94067273; Busch MP; Murphy E; Nemo G
More on HTLV tax and mycosis fungoides [letter; comment]: N Engl J Med. 1993 Dec 30;329(27):2035; discussion 2035-6. Unique Identifier : AIDSLINE MED/94067274; Youngberg GA; Karnad A
WHO widens focus of AIDS research [news]: Nature. 1993 Nov 25;366(6453):293. Unique Identifier : AIDSLINE MED/94067305; Butler D
Top US panel will map out fresh attack on AIDS [news]: Nature. 1993 Dec 2;366(6454):395. Unique Identifier : AIDSLINE MED/94067327; Macilwain C
[HIV prevalence among Surinam and Antillean drug users in Amsterdam]: Ned Tijdschr Geneeskd. 1993 Oct 23;137(43):2209-13. Unique Identifier : AIDSLINE MED/94067358; Fennema JS; van den Hoek JA; Huisman JG; Coutinho RA; GG&GD, sector Volksgezondheid en Milieu, Amsterdam.; OBJECTIVE. To determine the HIV prevalence and the frequency of injecting drugs among drug users from Surinam and the Netherlands Antilles in Amsterdam. DESIGN. Descriptive study. SETTING. Amsterdam streets. METHOD. Participants were recruited in 1992 in the street and intervi
[Splenectomy in HIV-positive patients]: Minerva Chir. 1993 Jul;48(13-14):759-61. Unique Identifier : AIDSLINE MED/94067498; Lombardo G; Talenti A; Cafferati M; Martelli S; Marzocchi D; Oddone C; I Divisione Chirurgia, USSL Torino III, Ospedale Martini, Torino.
My AIDS education Part I: Assuming the sick position.: Nurs Health Care. 1993 Sep;14(7):341-2. Unique Identifier : AIDSLINE MED/94067595; Fedor M
My AIDS education. Part II: History lessons.: Nurs Health Care. 1993 Oct;14(8):398-9. Unique Identifier : AIDSLINE MED/94067603; Fedor M
My AIDS education. Part III: Political realities.: Nurs Health Care. 1993 Nov;14(9):453-4. Unique Identifier : AIDSLINE MED/94067609; Fedor M
Oral carriage of Candida in healthy and HIV-seropositive persons.: Oral Surg Oral Med Oral Pathol. 1993 Nov;76(5):570-2. Unique Identifier : AIDSLINE MED/94067741; Hauman CH; Thompson IO; Theunissen F; Wolfaardt P; Department of Oral Pathology, Faculty of Dentistry, University of; Stellenbosch, Tygerberg, South Africa.; The prevalence of oral colonization with Candida species was studied in 28 HIV-seropositive and 28 healthy persons. Candida was cultured from 75% and 68% of HIV-positive and control persons, respectively, with a significantly higher density carriage in the HIV-seropositive group. Positive smears were seen in 39% of al
[Medical indications for HIV serological tests]: Orv Hetil. 1993 Nov 7;134(45):2491-2. Unique Identifier : AIDSLINE MED/94067759; Fust G; Horvath A; Banhegyi D; Orszagos Haematologiai, Vertranszfuzios es Immunologiai; Intezet, Budapest.
[Revised definition of AIDS cases and reclassification of HIV infections in adolescents and adults]: Orv Hetil. 1993 Nov 7;134(45):2493-6. Unique Identifier : AIDSLINE MED/94067760; Domok I
[Live attenuated viruses: a new strategy for vaccination against AIDS (news)]: Pathol Biol (Paris). 1993 Jun;41(6):513-4. Unique Identifier : AIDSLINE MED/94067879; Molina JM
[Programmed death of cells (apoptosis) (editorial)]: Patol Pol. 1993;44(3):113-9. Unique Identifier : AIDSLINE MED/94067889; Gorczyca W; Melamed MR; Darzynkiewicz Z; Zaklad Patomorfologii Nowotworow, Pomorska Akademia Medyczna,; Szczecin.; Apoptosis is a mode of cell death defined by characteristic morphological, biochemical and molecular changes. It was first described as a shrinkage necrosis, and then this term was replaced by apoptosis to emphasize its role opposite mitosis in tissue kinetics. During apoptosis the cell decrease in size, loose contact
Qualitative approaches in nursing research. The centrality of caring: a case study.: NLN Publ. 1993 Aug;(19-2535):338-58. Unique Identifier : AIDSLINE MED/94067961; Beauchamp CJ; This chapter has provided a rudimentary example of an exploratory/descriptive case study, utilizing phenomenological methods of data analysis. As discussed in the previous chapter, clearly delineated methods for case studies are not prevalent in the same way that other research methods are. The clear and fundamental d
Design of hammerhead ribozymes for the inhibition of gene expression ex vivo by exogenous application.: Nucleic Acids Symp Ser. 1993;(29):115. Unique Identifier : AIDSLINE MED/94067988; Eckstein F; Aurup H; Benseler F; Heidenreich O; Marschall P; Ng M; Thomson J; Tuschl T; Max-Planck-Institut fur Experimentelle Medizin, Gottingen,; Germany.
Multiple site-specific cleavage of HIV RNA by transcribed ribozymes from shotgun-type trimming plasmid.: Nucleic Acids Symp Ser. 1993;(29):121-2. Unique Identifier : AIDSLINE MED/94067991; Ohkawa J; Yuyama N; Takebe Y; Nisikawa S; Homann M; Sczakiel G; Taira K; National Institute of Bioscience and Human Technology, Agency of; Industrial Science & Technology, MITI, Tsukuba Science City,; Japan.; We have constructed a multiple-ribozyme expression system (designated shotgun type expression system). This system made it possible to express multiple ribozymes without reducing of the activities of each ribozyme. By using this system, multiple ribozymes specific for five different target sites in HIV-1 RNA were tran
Stability of the TAR RNA and its complex with arginine.: Nucleic Acids Symp Ser. 1993;(29):167-8. Unique Identifier : AIDSLINE MED/94068015; Sugimoto N; Ohmichi T; Tanaka A; Matsumura A; Sasaki M; Department of Chemistry, Faculty of Science, Konan University,; Kobe, Japan.; Most stable secondary structures and their stabilization energies of the TAR RNA with +1 to +104 nucleotide-sequence region were calculated at different temperatures by using thermodynamic parameters for RNA structure prediction. The most stable secondary structure has one bulge and one loop within the region of +20 t
Cleavage of the highly conserved hairpin-loop region of HIV-1 by synthetic ribozymes.: Nucleic Acids Symp Ser. 1993;(29):177-8. Unique Identifier : AIDSLINE MED/94068021; Shimayama T; Nishikawa S; Taira K; National Institute of Bioscience and Human Technology, Agency of; Industrial Science & Technology, MITI, Tsukuba Science City,; Japan.; Hammerhead ribozymes can be considered as molecular scissors for suppressing AIDS virus. It is attractive to target single-stranded region of HIV-1 RNA because single-stranded RNA interactions or kissing induce hybridization. We, therefore, chose a highly conserved hairpin-loop structure, that is located in the 5 lon
The synthesis of alternating alpha,beta-oligodeoxyribonucleotides with alternating (3'-->3')- and (5'-->5')-internucleotic linkages as potential therapeutic agents.: Nucleic Acids Symp Ser. 1993;(29):3-4. Unique Identifier : AIDSLINE MED/94068047; Koga M; Geyer SJ; Regan JB; Beaucage SL; Division of Hematologic Products, Food and Drug Administration,; Bethesda, MD 20892.; A simplified synthesis of alpha-2 -deoxyribonucleoside derivatives has been developed and the solid-phase preparation of antisense alpha,beta-oligodeoxyribonucleotides with alternating (3 -->3 )- and (5 -->5 )-internucleotidic phosphodiester linkages, targeted against HIV-1 tat mRNA, has been accomplished. Hybridizati
Biologically active oligodeoxyribonucleotides--I: Syntheses and anti-HIV-1 activities of 5'-modified pentadecadeoxyribonucleotides.: Nucleic Acids Symp Ser. 1993;(29):59-61. Unique Identifier : AIDSLINE MED/94068063; Hotoda H; Momota K; Furukawa H; Nakamura T; Kaneko M; Kimura S; Shimada K; Bioscience Research Laboratories, Sankyo Company Ltd., Tokyo,; Japan.; 5 -Modified pentadecadeoxyribonucleotides with a sequence (5 -TGGGAGGTGGGTCTG-3 ) (15mer) complimentary (antisense) to the tat 2nd splicing acceptor region of human immunodeficiency virus type 1 (HIV-1) were prepared and evaluated for anti-HIV-1 activity. The modified antisense oligodeoxyribonucleotides (AS-ODNs) were
Remarkable acceleration for the deamination of carbocyclic purine nucleosides by adenosine deaminase under high-pressure.: Nucleic Acids Symp Ser. 1993;(29):95-6. Unique Identifier : AIDSLINE MED/94068081; Katagiri N; Shiraishi T; Toyota A; Sato H; Kaneko C; Pharmaceutical Institute, Tohoku University, Sendai, Japan.; Deamination of an anti-HIV carbocyclic adenine nucleoside, 9-[c-4,t-5-bis(hydroxymethyl)cyclopent-2-en-r-1-yl]-9H-adenine [(+/-)-BCA] and (+/-)-diamino-carbovir by adenosine deaminase under high-pressure (4 kbar) was carried out. Deamination of the former gave the corresponding (-)-hypoxanthine derivative whereas that
Healthy living? [news]: Nurs Times. 1993 Mar 17-23;89(11):16-7. Unique Identifier : AIDSLINE MED/94068096; Mason P
Value judgements [news]: Nurs Times. 1993 Mar 17-23;89(11):18. Unique Identifier : AIDSLINE MED/94068097; Cole A
Backwards steps.: Nurs Times. 1993 Mar 17-23;89(11):3. Unique Identifier : AIDSLINE MED/94068101
Right to privacy for staff with HIV urged [news]: Nurs Times. 1993 Mar 17-23;89(11):5. Unique Identifier : AIDSLINE MED/94068106; Carlisle D
HIV/AIDS: positive steps.: Nurs Times. 1993 Mar 17-23;89(11):54-6. Unique Identifier : AIDSLINE MED/94068107; Lang C
AIDS aetiology and HIV-1 [news]: Nurs Times. 1993 Mar 24-30;89(12):10. Unique Identifier : AIDSLINE MED/94068112
Barred from safe sex [news]: Nurs Times. 1993 Mar 24-30;89(12):16-7. Unique Identifier : AIDSLINE MED/94068113; Linehan T
Spelling it out [news]: Nurs Times. 1993 Mar 24-30;89(12):18. Unique Identifier : AIDSLINE MED/94068114; Carlisle D
Council to take a firmer line on HIV [news]: Nurs Times. 1993 Mar 24-30;89(12):6. Unique Identifier : AIDSLINE MED/94068127; Carlisle D
Hairy leukoplakia in a child with AIDS--a rare symptom: case report.: Pediatr Dent. 1993 Jul-Aug;15(4):280-1. Unique Identifier : AIDSLINE MED/94068176; Ferguson FS; Archard H; Nuovo GJ; Nachman S; Department of Children's Dentistry, School of Dental Medicine,; State University of New York at Stony Brook.
Neglected pathogens: bacterial infections in persons with human immunodeficiency virus infection. A review of the literature (1).: Pharmacotherapy. 1993 Sep-Oct;13(5):415-39. Unique Identifier : AIDSLINE MED/94068179; Fish DN; Danziger LH; Division of Pharmacy Practice, School of Pharmacy, University of; Colorado Health Sciences Center, Denver.; Bacterial infections, including those that cause infection in the healthy host as well as those that are more opportunistic, occur very commonly among persons infected with the human immunodeficiency virus (HIV). Bacterial infections are a direct result of the severe humoral and cellular immune defects found in these
HIV-infected children in the pediatric emergency department.: Pediatr Emerg Care. 1993 Oct;9(5):265-9. Unique Identifier : AIDSLINE MED/94068201; Pinkert H; Harper MB; Cooper T; Fleisher GR; Department of Pediatrics, Albert Einstein College of Medicine,; Bronx, NY.; Forty-three nonhemophiliac, confirmed HIV-positive children followed by the Children s Hospital AIDS Program made 184 visits to the children s Emergency Department (ED) during 1988 and 1989. The mean age was 30 +/- 28 months with a median of 25 months, a mode of 10 months, and a range from two days to 19 years. CD4 co
[Evaluation of humoral immune response in patients with asymptomatic and symptomatic HIV infection. Analysis of titers of anti-Hbs, antibodies against cytomegalovirus, herpes simplex virus type I, rubella virus and toxoplasma gondii]: Pol Arch Med Wewn. 1993 Aug;90(2):112-8. Unique Identifier : AIDSLINE MED/94068215; Radkowski M; Laskus T; Kopicz-Kaminska EW; Mian M; Szymanska B; Babiuch L; Slusarczyk J; Zaklad Immunopatologii, Instytut Chorob Zakaznych i; Pasozytniczych Akademii Medycznej, Warszawie.; 40 asymptomatic HIV carriers and 45 AIDS patients were tested for anti-HBs (Hepatitis B Virus surface antigen), anti-RV (Rubella virus), anti-Toxo (Toxoplasma gondii), anti- CMV (Cytomegalovirus) and anti-HSV-1 (Herpes simplex virus type 1) antibody titers and co
Kaposi's sarcoma mimicking cellulitis.: Postgrad Med. 1993 Dec;94(8):139-44, 149. Unique Identifier : AIDSLINE MED/94068265; Oehler RL; Sinnott JT; Arepally G; Dunn YP; Emory University School of Medicine, Atlanta.; Although Kaposi s sarcoma is not the most common cause of death in AIDS patients, it is often one of the initial opportunistic illnesses associated with human immunodeficiency virus infection. Extensive plaque formation and edema in the lower extremities may take on the appearance of cellulitis, and in dark-skinned pe
[Hemophagocytic syndrome in HIV infection]: Presse Med. 1993 Sep 11;22(26):1217-20. Unique Identifier : AIDSLINE MED/94068322; Bourquelot P; Oksenhendler E; Wolff M; Fegueux S; Piketty C; D'Agay MF; Clauvel JP; Service d'Immuno-Hematologie, Hopital Saint-Louis, Paris.; This report describes the clinical spectrum and outcome of the hemophagocytic syndrome (HS) in 5 HIV infected patients. All 5 patients presented with fever, hepatomegaly and/or splenomegaly, confusion or coma and respiratory symptoms. Severe anemia was associated with thrombocytopenia and with neutropenia in 4 cases.
[Diagnosis of diffuse encephalopathies in adults with HIV infection. I]: Presse Med. 1993 Sep 11;22(26):1226-31. Unique Identifier : AIDSLINE MED/94068325; Gray F; Belec L; Geny C; Schouman-Claeys E; Laboratoire d'Anatomie pathologique (Neuropathologie), Hopital; Raymond Poincare et Faculte de Medecine Paris-Ouest, Garches.; The diagnostic approach of focal central nervous system lesions in AIDS patients is now well established. In contrast, it is extremely difficult to determine the cause of diffuse encephalopathies, occurring frequently at the terminal stage of AIDS. Imaging is usually non specific and laboratory investigations are seld
[Efficacy of thalidomide against esophageal ulceration in HIV infection (letter)]: Presse Med. 1993 Sep 11;22(26):1233. Unique Identifier : AIDSLINE MED/94068328; Bodokh I; Lacour JP; Rainero C; Castanet J; Michiels JF; Ortonne JP
[Cortical blindness revealing progressive multifocal leukoencephalitis in AIDS (letter)]: Presse Med. 1993 Sep 11;22(26):1236. Unique Identifier : AIDSLINE MED/94068334; Wyplosz B; Herry I; Blanche P; Sicard D
[Central and peripheral nervous system motor conduction rate in HIV infection]: Presse Med. 1993 Sep 25;22(28):1302-6. Unique Identifier : AIDSLINE MED/94068336; Grapperon J; Trousset A; Jaubert D; Laboratoire de Neurophysiologie clinique, Hopital d'Instruction; des Armees Sainte-Anne, Toulon naval.; In order to assess the central motor pathways of HIV-infected patients motor evoked potentials were recorded on the upper limbs after transcranial and cervical magnetic stimulations and compared with peripheral conduction velocities. Motor evoked potentials were measured on both sides of 28 patients, mostly at the AID
[HIV infection. Risky behavior in drug addicts using intravenous drugs. Experience in the Alpes-Maritimes region]: Presse Med. 1993 Oct 2;22(29):1347-51. Unique Identifier : AIDSLINE MED/94068347; Pradier C; Bardeau JJ; Simon PJ; Bentz-Gribelin L; Bonifassi L; Jestin D; Dugourd M; Dellamonica P; Centre d'Information et de Soins de l'Immunodeficience humaine,; Hopital de l'Archet.; HIV risk behaviours among intravenous drug users (IVDUs) were studied in southeast France , where the prevalence of HIV infection is high. Data were collected from a self-reported questionnaire distributed to drug addicts admitted in the health care or social institutions of the Alp
[Intolerance to sulfonamides in HIV infected subjects. Toxic and allergic origin]: Presse Med. 1993 Oct 2;22(29):1363-5. Unique Identifier : AIDSLINE MED/94068350; Mathelier-Fusade P; Leynadier F; Service Medecine interne, Hopital Rothschild, Paris.; Intolerance to sulfonamides is very frequent in HIV-infected subjects and 10 times more common than in the general population. There are 2 types of intolerance to sulfonamides: early reactions with urticaria or angioedema, which are IgE-dependent, and late reactions with febrile rash, which occur between the 6th and 1
[Pasteurellosis in an HIV infected patient (letter) (see comments)]: Presse Med. 1993 Oct 2;22(29):1366. Unique Identifier : AIDSLINE MED/94068352; Raguin G; Guiot JD; Aerts J; Dehaye B; Desplaces N
[Atypical mycobacteria infections in AIDS. Role and diagnosis]: Presse Med. 1993 Oct 9;22(30):1405-12. Unique Identifier : AIDSLINE MED/94068364; Chidiac C; Mouton Y; Service des Maladies infectieuses et tropicales, Centre; Hospitalier de Tourcoing.; Atypical mycobacteria are responsible for systemic infections which occur late in the course of AIDS. The Mycobacterium avium intracellulare complex is the most frequently blamed species. Clinical and laboratory data are not specific; they consist of protracted fever, gastrointestinal and respiratory disorders entangl
Myocardial risk factors other than human immunodeficiency virus infection may contribute to histologic cardiomyopathic changes in acquired immune deficiency syndrome.: Mod Pathol. 1993 Sep;6(5):560-4. Unique Identifier : AIDSLINE MED/94068395; Segal BH; Factor SM; Department of Pathology, Albert Einstein College of Medicine,; Bronx, New York 10461.; This study was designed to evaluate whether myocardial risk factors other than those strictly related to human immunodeficiency virus infection contribute to histologic cardiomyopathic changes in acquired immunodeficiency syndrome patients. We analyzed 91 consecutive adult human immunodeficiency virus-positive autopsy
Epstein-Barr virus and primary lung lymphoma: a study utilizing the polymerase chain reaction.: Mod Pathol. 1993 Sep;6(5):575-80. Unique Identifier : AIDSLINE MED/94068398; Hytiroglou P; Strauchen JA; Vrettou E; Papadimitriou CS; Fasy TM; Morgello S; Lillian and Henry M. Stratton-Hans Popper Department of; Pathology, Mount Sinai School of Medicine, New York, New York; 10029.; Seven cases of primary lung lymphoma were analyzed for the presence of Epstein-Barr virus DNA sequences by the polymerase chain reaction. The series included: four cases of diffuse, small lymphocytic lymphoma; one case of diffuse, intermediate lymphocytic lymphoma; one case of diffuse, small cleaved cell lymphoma; and
Genetic analysis of homomeric interactions of human immunodeficiency virus type 1 integrase using the yeast two-hybrid system.: Proc Natl Acad Sci U S A. 1993 Nov 15;90(22):10593-7. Unique Identifier : AIDSLINE MED/94068447; Kalpana GV; Goff SP; Department of Biochemistry and Molecular Biophysics, Columbia; University College of Physicians and Surgeons, New York, NY; 10032.; The retroviral integrase protein (IN) is responsible for catalyzing a concerted integration reaction in which the two termini of linear viral DNA are joined to host DNA. To probe the potential for IN to form protein multimers, we used the yeast two-hybrid system. The coexpression of a GAL4 DNA binding domain-IN fusion
Cooperative inhibition of NF-kappa B and Tat-induced superactivation of human immunodeficiency virus type 1 long terminal repeat.: Proc Natl Acad Sci U S A. 1993 Dec 1;90(23):11044-8. Unique Identifier : AIDSLINE MED/94068541; Biswas DK; Ahlers CM; Dezube BJ; Pardee AB; Division of Cell Growth and Regulation, Dana-Farber Cancer; Institute, Boston, MA.; Human immunodeficiency virus type 1 (HIV-1) long terminal repeat (LTR)-regulated gene expression is stimulated independently by the cellular trans-activator NF-kappa B and the viral protein Tat. Noncytotoxic concentrations of the drug pentoxifylline (PTX) inhibited interaction of NF-kappa B with its motif and the stim
Importance of independence in ribozyme reactions: kinetic behavior of trimmed and of simply connected multiple ribozymes with potential activity against human immunodeficiency virus [see comments]: Proc Natl Acad Sci U S A. 1993 Dec 1;90(23):11302-6. Unique Identifier : AIDSLINE MED/94068591; Ohkawa J; Yuyama N; Takebe Y; Nishikawa S; Taira K; National Institute of Bioscience and Human Technology, Agency of; Industrial Science and Technology, Ministry of International; Trade and Industry, Tsukuba Science City, Japan.; The kinetic behavior of ribozymes derived from two types of multiple-ribozyme expression vector were examined. In some cases, multiple ribozymes were expressed as a single RNA molecule and all the ribozymes were simply connected in tandem (connected type). In other cases, multiple ribozymes were flanked by cis-acting
Hospital bed usage by people with HIV disease: experience in a provincial setting.: Public Health. 1993 Sep;107(5):355-62. Unique Identifier : AIDSLINE MED/94068834; O'Brien SJ; Burch J; Mayon-White RT; Department of Epidemiology and Public Health, School of Health; Care Sciences, Medical School, University, Newcastle upon Tyne.; In order to describe hospital bed usage by people with HIV disease in a provincial setting, a retrospective analysis of admissions to hospital wards in Oxford was undertaken for people admitted to hospital with all HIV-related illnesses or complications of HIV-related treatment. A total of 83 people were identified as
Attitudes of practicing nurses as predictors of intended care behavior with persons who are HIV positive: testing the Ajzen-Fishbein Theory of Reasoned Action.: Res Nurs Health. 1993 Dec;16(6):441-50. Unique Identifier : AIDSLINE MED/94068975; Laschinger HK; Goldenberg D; Faculty of Nursing, University of Western Ontario, Canada.; The purpose of this descriptive correlational study was to examine practicing nurses attitudes, subjective norms, and intentions to care for HIV positive patients, using the Theory of Reasoned Action. One hundred and forty-one subjects completed a questionnaire developed according to guidelines described by Ajzen and
[Multiple leiomyomas in AIDS. Description of a case]: Radiol Med (Torino). 1993 Oct;86(4):541-3. Unique Identifier : AIDSLINE MED/94069003; Cecconi L; Mazzuoli G; Busi Rizzi E; Schinina V; Costantino Costabile A; Servizio di Radiologia, Ospedale Lazzaro Spallanzani, Roma.
[Preliminary study of HTLV-I seroprevalence in Chilean Indian populations]: Rev Med Chil. 1993 Mar;121(3):241-6. Unique Identifier : AIDSLINE MED/94069114; Cartier L; Tajima K; Araya F; Castillo JL; Zaninovic V; Hayami M; Imai J; Born P; Cardenas M; Moreno J; et al; Departamento de Ciencias Neurologicas, Facultad de Medicina,; Universidad de Chile (Division Oriente), Hospital del Salvador; de Santiago.; Aiming to seek the origin and define the prevalence of HTLV-1 infections, 464 blood samples from aboriginal populations proceeding from isolated regions of the north and south of Chile were studied. Antibodies against HTLV were measured with agglutination tests and confirmed with im
[Etiologic diagnosis of pneumonia in HIV-AIDS patients. Usefulness of fibrobronchoscopy]: Rev Med Chil. 1993 Mar;121(3):279-85. Unique Identifier : AIDSLINE MED/94069120; Henriquez A; Srur E; Giglio M; Fernandez A; Cona E; Lorca M; Garcia A; Northland R; Segovia J; Gutierrez S; et al; Servicio de Medicina, Hospital San Juan de Dios, Santiago de; Chile.; AIM: to assess the usefulness of fiberoptic bronchoscopy in the etiologic diagnosis of pulmonary infiltrates in patients with AIDS. PATIENTS AND METHODS: in 25 patients with AIDS and pneumonia, 31 fiberoptic bronchoscopies with bronchoalveolar lavage were performed; in 11 occasions, a transbronchial biopsy was also pe
Polyvalent pneumococcal polysaccharide vaccines; a review of the literature.: Rev Hosp Clin Fac Med Sao Paulo. 1993 May-Jun;48(3):130-8. Unique Identifier : AIDSLINE MED/94069234; Requejo HI; Department of Immunology, Instituto Adolfo Lutz, Sao Paulo.; Streptococcus pneumoniae is a leading cause of morbidity and mortality, mainly in children, elders and individuals with AIDS or AIDS-related complex, being a frequent bacterial cause of pneumonia, otitis media, sinusitis, bacteremia and meningitis. Polyvalent pneumococcal capsular polysaccharide vaccines contain the 2
IgM response to a human Pneumocystis carinii surface antigen in HIV-infected patients with pulmonary symptoms.: Scand J Infect Dis. 1993;25(4):515-20. Unique Identifier : AIDSLINE MED/94069287; Lundgren B; Kovacs JA; Mathiesen L; Nielsen JO; Lundgren JD; Department of Infectious Diseases and Microbiology, University of; Copenhagen, Hvidovre Hospital, Denmark.; We have developed an ELISA to detect IgM antibodies to a major human Pneumocystis carinii surface antigen (gp95), and investigated the IgM response in 128 HIV-infected patients who underwent bronchoscopy for evaluation of pulmonary symptoms. Only 5 (4%) patients had IgM antibodies to P. carinii gp95. Four of the 5 pat
Varmus: the view from Bethesda [interview by Eliot Marshall]: Science. 1993 Nov 26;262(5138):1364-6. Unique Identifier : AIDSLINE MED/94069310; Varmus H
AIDS prevention trial seeks answers [news]: Science. 1993 Dec 3;262(5139):1510. Unique Identifier : AIDSLINE MED/94069336
Ribozymes: killing the messenger [news]: Science. 1993 Dec 3;262(5139):1512-4. Unique Identifier : AIDSLINE MED/94069337; Barinaga M
Effect of platelet-associated virus on assays of HIV-1 in plasma [letter; comment]: Science. 1993 Dec 3;262(5139):1585-6. Unique Identifier : AIDSLINE MED/94069353; Lee TH; Stromberg RR; Henrard D; Busch MP
Modelling the efficacy of prophylactic and curative therapies for preventing the spread of tuberculosis in Africa.: Trans R Soc Trop Med Hyg. 1993 Jul-Aug;87(4):406-11. Unique Identifier : AIDSLINE MED/94069674; Heymann SJ; Department of Health Care Policy, Harvard Medical School, Boston,; MA 02115.; Concerns have been raised about whether the interaction between tuberculosis and human immunodeficiency virus (HIV) may lead worldwide to a recrudescent tuberculosis pandemic. These concerns are particularly grave in Africa which has a high prevalence of both tuberculosis and HIV. This study used a computer simulation
Soluble CD23 as a sensitive marker for Epstein-Barr virus-related disorders after liver transplantation.: Transplantation. 1993 Nov;56(5):1109-13. Unique Identifier : AIDSLINE MED/94069721; Kato H; Inamoto T; Nakamura H; Furuke K; Uemoto S; Tanaka K; Ozawa K; Hori T; Yodoi J; Second Department of Surgery, Kyoto University, Japan.; Plasma levels of the soluble fragments of Fc epsilon RII/CD23 (sCD23/IgE-binding factor) were measured to assess the level of activation of B lymphocytes associated with Epstein-Barr virus infection in 28 patients who received living-related liver transplantation and were treated with FK506 and steroids. In 6 patients
[Periodic medical examination, update 1992. 3. Anti-HIV antibody screening. Canadian work group on the periodic medical examination]: Union Med Can. 1993 Sep-Oct;122(5):322-8, 330-2. Unique Identifier : AIDSLINE MED/94069851
Endonexin II, present on human liver plasma membranes, is a specific binding protein of small hepatitis B virus (HBV) envelope protein.: Virology. 1993 Dec;197(2):549-57. Unique Identifier : AIDSLINE MED/94069927; Hertogs K; Leenders WP; Depla E; De Bruin WC; Meheus L; Raymackers J; Moshage H; Yap SH; Division of Liver and Pancreatic Diseases, University Hospital; Gasthuisberg, Leuven, Belgium.; Binding of viral envelope proteins to specific receptors on human hepatocytes is considered to be an important step in HBV infection. In this study, we demonstrate that a 34-kDa human liver plasma membrane protein specifically binds to small HBsAg in a Ca(2+)-dependent manner. By partial amino acid sequence analysis o
High rate of infection with the human T-cell leukemia retrovirus type II in four Indian populations of Argentina.: Virology. 1993 Dec;197(2):576-84. Unique Identifier : AIDSLINE MED/94069930; Ferrer JF; Del Pino N; Esteban E; Sherman MP; Dube S; Dube DK; Basombrio MA; Pimentel E; Segovia A; Quirulas S; et al; Comparative Leukemia and Retrovirus Unit, University of; Pennsylvania, Kennett Square 19348-1692.; Sera from 215 non-drug-injecting Toba and Mataco-Mataguayo pure Indians belonging to four communities in northern Argentina were examined using assays that allow differentiation between reactivities due to type-specific antigens of the human T-cell leukemia/lymphoma virus (HTLV)
Specific interaction of the human immunodeficiency virus Tat proteins with a cellular protein kinase.: Virology. 1993 Dec;197(2):601-8. Unique Identifier : AIDSLINE MED/94069933; Herrmann CH; Rice AP; Baylor College of Medicine, Division of Molecular Virology,; Houston, Texas 77030.; The human immunodeficiency virus types 1 and 2 (HIV-1 and HIV-2) Tat proteins are related transcriptional activators whose effects are likely to be mediated by a cellular factor. Using an in vitro kinase assay, we have shown that the Tat protein of HIV-2 and the activation domain of the Tat protein of HIV-1 specifical
Transmission of human immunodeficiency virus type 1 (HIV-1) from mother to child correlates with viral phenotype.: Virology. 1993 Dec;197(2):624-9. Unique Identifier : AIDSLINE MED/94069936; Scarlatti G; Hodara V; Rossi P; Muggiasca L; Bucceri A; Albert J; Fenyo EM; Department of Virology, Karolinska Institute, Stockholm, Sweden.; The aim of this study was to investigate if the risk of mother-to-child transmission of human immunodeficiency virus type 1 (HIV-1) is influenced by the biological phenotype of the mother s virus. Virus isolates from 30 HIV-1 infected mothers and 12 infected children born to these mothers were analyzed for replication
Transient HTLV-I infection of a human glioma cell line following cell-free exposure.: Virology. 1993 Dec;197(2):767-9. Unique Identifier : AIDSLINE MED/94069952; Graziani G; Faraoni I; Zhang J; Caronti B; Lauro G; Bonmassar E; Macchi B; Department of Experimental Medicine and Biochemical Sciences,; University of Rome Tor Vergata, Rome, Italy.; The human T-lymphotropic virus type I (HTLV-I) has been recently associated with cases of tropical spastic paraparesis and human myelopathy. In order to study whether cells of neuroectodermic origin were susceptible to HTLV-I infection, a human glioma cell line T67 was exposed in vitro to HTLV-I by a cell-free method
NF kappa B upstream regulatory sequences of the HIV-1 LTR are involved in the inhibition of HIV-1 promoter activity by the NS proteins of autonomous parvoviruses H-1 and MVMp.: Virology. 1993 Dec;197(2):770-3. Unique Identifier : AIDSLINE MED/94069953; Faisst SR; Faisst S; Grangette C; Schlehofer JR; Rommelaere J; Unite d'Oncologie Moleculaire, CNRS 1160, Institut Pasteur de; Lille, France.; To investigate parvoviral interference with human immunodeficiency virus type 1 (HIV-1) in human cells that are normally susceptible to HIV-1 infection, nonstructural (NS) proteins of the parvoviruses H-1 virus and minute virus of mice were studied for their effect on the activity of the HIV-1 promoter in a variety of
Identification of HIV1 determinants for T lymphoid cell line infection.: Virology. 1993 Dec;197(2):817-24. Unique Identifier : AIDSLINE MED/94069963; Carrillo A; Trowbridge DB; Westervelt P; Ratner L; Department of Medicine, Washington University School of Medicine,; St Louis, Missouri 63110.; Determinants responsible for HIV-1 infection of T lymphoid cell lines were identified by functional analysis of chimeric proviral clones derived from T-cell line tropic-(HXB2) and non-T-cell line-tropic isolates (YU2, ADA). Replacement of the HXB2 V3 envelope loop sequence with that derived from YU2 resulted in a viru
Comprehensive delineation of antigenic and immunogenic properties of peptides derived from the nef HIV-1 regulatory protein.: Vaccine. 1993;11(11):1083-92. Unique Identifier : AIDSLINE MED/94070114; Estaquier J; Boutillon C; Gras-Masse H; Ameisen JC; Capron A; Tartar A; Auriault C; Centre d'Immunologie des Maladies Transmissibles et Allergiques,; Unite mixte Inserm U 167-CNRS 624, Institut Pasteur, Lille,; France.; The Human Immunodeficiency Virus (HIV-1) nef regulatory protein, a protein involved in AIDS pathology, was used as a model to investigate and analyze B- and T-cell epitopes. In this paper, we describe the potential structural basis of antigenic and immunogenic reactivity of synthetic peptides derived from the macromol
Further studies on the adjuvanticity of stearyl tyrosine and ester analogues.: Vaccine. 1993;11(11):1129-34. Unique Identifier : AIDSLINE MED/94070122; Penney CL; Ethier D; Dionne G; Nixon-George A; Zaghouani H; Michon F; Jennings H; Bona CA; Immunomodulator Research, BioChem Pharma Inc., Laval, Quebec,; Canada.; A new family of immunoadjuvants, long-chain stearyl esters of amino acids and peptides, are described and examined with bacterial and viral vaccines. The parent compound, stearyl tyrosine, displayed significant adjuvant activity with these vaccines. Stearyl glycyl glycine displayed superior activity with viral vaccine
HBV and HCV infection in kidney transplant recipients.: Acta Gastroenterol Latinoam. 1993;23(2):75-81. Unique Identifier : AIDSLINE MED/94070270; Frider B; Castano G; Sookoian S; Livellara B; Kina M; Sabatiello R; Castiglione T; Iotti R; Vazquez MC; Hepatology Service, Argerich County Hospital, Buenos Aires,; Argentina.; The risk of HBV and HCV liver infection in kidney graft recipients was evaluated in 35 patients. All were tested for anti-HBc, HBsAg, HBeAg, anti-HBs, Anti-HBe, anti-HCV (c-100-3 and c-100-3, c-22, 33-c), anti-HDV and anti-HIV by ELISA, and for HBV-DNA by hybridization. Liver biopsy, immunostaining for HBcAg and Knode
HIV infection: a pharmacist's resource. APhA Editorial Board on Pharmaceutical Care for Patients with HIV Infection.: Am Pharm. 1993 Nov;NS33(11):67-79; quiz 78-9. Unique Identifier : AIDSLINE MED/94070639
Type 2 Epstein-Barr virus genome and latent membrane protein-1 expression in a T-cell-rich lymphoma of probable B-cell lineage.: Am J Clin Pathol. 1993 Nov;100(5):541-9. Unique Identifier : AIDSLINE MED/94070702; Dolcetti R; Carbone A; Zagonel V; De Re V; Gloghini A; Frisan T; Boiocchi M; Division of Experimental Oncology 1, Istituto Nazionale di; Ricovero e Cura a Carattere Scientifico, Aviano (PN), Italy.; In a 79-year-old white woman, a lymphoproliferative disorder that was associated with type 2 Epstein-Barr virus (EBV) infection or reactivation, documented by three subsequent lymph node biopsies, was studied. After an initial phase with features of reactive lymphadenopathy with exhaustion of the follicular germinal c
A comparison of the Coulter STKS, Coulter S+IV, and manual analysis of white blood cell differential counts in a human immunodeficiency virus-infected population.: Am J Clin Pathol. 1993 Dec;100(6):611-7. Unique Identifier : AIDSLINE MED/94070716; Cohen AJ; Peerschke EI; Steigbigel RT; Department of Medicine, School of Medicine, State University of; New York at Stony Brook 11794.; The white blood cell differential counts obtained by manual analysis and those obtained by automated analysis using Coulter STKS and Coulter S+IV cell counters (Coulter Electronics, Hialeah, FL) in a human immunodeficiency virus (HIV)-infected population were compared. Linear correlation analyses showed the STKS to be
Comparative study of spleen pathology in drug abusers with thrombocytopenia related to human immunodeficiency virus infection and in patients with idiopathic thrombocytopenic purpura. A morphometric, immunohistochemical, and ultrastructural study.: Am J Clin Pathol. 1993 Dec;100(6):633-42. Unique Identifier : AIDSLINE MED/94070719; Marti M; Feliu E; Campo E; Palacin A; Berga L; Casals FJ; Urbano Ispizua A; Cardesa A; Rozman C; Departamento de Anatomia Patologica, Hospital Clinic i; Provincial, University of Barcelona, Spain.; A morphometric and immunohistochemical study was performed to assess the spleen s alterations in patients with autoimmune thrombocytopenia and in drug abusers with thrombocytopenia (DAT) related to human immunodeficiency virus (HIV) infection. A total of 34 patients were included in the study: 20 DAT patients and 14 w
Because it's there [editorial; comment] [see comments]: Am J Gastroenterol. 1993 Dec;88(12):1991-3. Unique Identifier : AIDSLINE MED/94070773; Koretz RL
Failure of providers to vaccinate HIV-infected men against hepatitis B: a missed opportunity [see comments]: Am J Gastroenterol. 1993 Dec;88(12):2015-8. Unique Identifier : AIDSLINE MED/94070777; Rabeneck L; Risser JM; Murray NG; McCabe BK; Lacke CE; Lucco LJ; Department of Medicine, Baylor College of Medicine, VA Medical; Center, Houston, Texas.; OBJECTIVE: To carry out an audit of hepatitis B immunization practices in an outpatient HIV clinic. METHODS: We reviewed the medical records of all new HIV-infected patients seen between October 1, 1990 and December 31, 1991. RESULTS: The 125 patients were men with a mean age and CD4 count of 43 yr and 240 cells/mm3,
A multicenter case-controlled study of percutaneous endoscopic gastrostomy in HIV-seropositive patients.: Am J Gastroenterol. 1993 Dec;88(12):2059-66. Unique Identifier : AIDSLINE MED/94070787; Cappell MS; Godil A; Division of Gastroenterology, UMDNJ-Robert Wood Johnson Medical; School, New Brunswick.; OBJECTIVES: Malnutrition is an important cause of morbidity and mortality in AIDS patients. Percutaneous endoscopic gastrostomy (PEG) is a safe and effective method of providing nutrition in HIV-seronegative patients who are unable to swallow food, but have an otherwise functional alimentary tract. This study analyzes
Asymptomatic primary biliary cirrhosis in HTLV-I-associated myelopathy.: Am J Gastroenterol. 1993 Dec;88(12):2107-9. Unique Identifier : AIDSLINE MED/94070796; Ijichi T; Miyata K; Mori S; Nakajima K; Okanoue T; Tsuchihashi Y; Department of Neurology and Gerontology, Kyoto Prefectural; University of Medicine, Japan.; A 54-yr-old woman was admitted for complaints of slowly progressive gait and bladder disturbance, and HTLV-I-associated myelopathy (HAM/TSP) was diagnosed by positive antibodies to HTLV-I, both in her serum and cerebrospinal fluid. In the course of a diagnostic evaluation, she was found to have asymptomatic primary bi
Spontaneous healing of a cytomegalovirus esophageal ulceration in a patient with acquired immunodeficiency syndrome.: Am J Gastroenterol. 1993 Dec;88(12):2111-2. Unique Identifier : AIDSLINE MED/94070798; Wilcox CM; Schwartz DA; Department of Medicine, Emory University School of Medicine,; Atlanta, Georgia.
Liver biopsy in patients with acquired immunodeficiency syndrome [letter]: Am J Gastroenterol. 1993 Dec;88(12):2139-40. Unique Identifier : AIDSLINE MED/94070812; Marano BJ Jr; Bonanno CA
T- and B-cell markers in colonic nodular lymphoid hyperplasia in HIV infection [letter; comment]: Am J Gastroenterol. 1993 Dec;88(12):2144-5. Unique Identifier : AIDSLINE MED/94070819; Barnard GF; Banner BF
HTLV-I associated adult T-cell leukaemia/lymphoma in Hong Kong [letter]: Am J Hematol. 1994 Jan;45(1):100-1. Unique Identifier : AIDSLINE MED/94070823; Liang R
Risk factors for development of rhegmatogenous retinal detachment in patients with cytomegalovirus retinitis [see comments]: Am J Ophthalmol. 1993 Dec 15;116(6):713-20. Unique Identifier : AIDSLINE MED/94070904; Freeman WR; Friedberg DN; Berry C; Quiceno JI; Behette M; Fullerton SC; Munguia D; Department of Ophthalmology, University of California San Diego; School of Medicine.; We studied 259 patients to determine the time-dependent risk and risk factors for the development of retinal detachment in patients with cytomegalovirus retinitis. The six-month and one-year retinal detachment rates (by eye) were 11% and 24%, respectively. Increasing retinal surfac
Ophthalmic manifestations of infections with Cryptococcus neoformans in patients with the acquired immunodeficiency syndrome.: Am J Ophthalmol. 1993 Dec 15;116(6):721-7. Unique Identifier : AIDSLINE MED/94070905; Kestelyn P; Taelman H; Bogaerts J; Kagame A; Abdel Aziz M; Batungwanayo J; Stevens AM; Van de Perre P; Department of Ophthalmology, Centre Hospitalier de Kigali,; Rwanda.; The present study was undertaken to determine the nature and the prevalence of ophthalmic manifestations of infections with Cryptococcus neoformans in human immunodeficiency virus seropositive patients and to analyze whether the presence or absence of ocular signs is associated with improved survival. Eighty human imm
Aggravation of both Trypanosoma cruzi and murine leukemia virus by concomitant infections.: Am J Trop Med Hyg. 1993 Nov;49(5):589-97. Unique Identifier : AIDSLINE MED/94070930; Silva JS; Barral-Netto M; Reed SG; School of Medicine of Ribeirao Preto, University of Sao Paulo,; Brazil.; Given the dissemination of acquired immunodeficiency syndrome (AIDS) in Latin America, where Chagas disease is endemic, there is a present and increasing risk of concurrent infections with human immunodeficiency virus (HIV) and Trypanosoma cruzi. We used the model of murine acquired immunodeficiency syndrome (MAIDS)
Experimental AIDS drug, d4T, now available to patients in critical need [news]: Ann Allergy. 1993 Nov;71(5):A-27. Unique Identifier : AIDSLINE MED/94071206
Tuberculosis and HIV infection: epidemiology, pathogenesis, and clinical aspects.: Ann Allergy. 1993 Nov;71(5):421-8; quiz 428-33. Unique Identifier : AIDSLINE MED/94071209; Graham NM; Chaisson RE; Department of Epidemiology, Johns Hopkins University School of; Hygiene and Public Health.; Human immunodeficiency virus infection has profoundly affected the epidemiology, natural history, and clinical presentation of TB. It has also contributed in part to the recent epidemic of MDR-TB in the US and significantly reduced the sensitivity (but not the specificity) of the tuberculin skin test. Further research
Kristine Gebbie urges nurses to be active in war against AIDS [interview by Kathryn Scott]: Am Nurse. 1993 Oct;25(9):10. Unique Identifier : AIDSLINE MED/94071281; Gebbie K
[Validation of the virus inactivation capacity of a procedure of human plasma albumin purification by chromatography]: Ann Pharm Fr. 1993;51(2):78-93. Unique Identifier : AIDSLINE MED/94071366; Stoltz JF; Geschier C; Rivat C; Sertillanges P; Grandgeorges M; Liautaud J; Regnault V; Dumont L; Centre Regional de Transfusion Sanguine, CHU Brabois,; Vandoeuvre-les-Nancy.; Almost the whole of the human plasma albumin preparations intended for clinical or biological uses is at present fractionated by cold ethanol precipitation technics based on the Cohn method. However, ion-exchange chromatographic processes have been recently developed. The aim of this work was the evaluation of the vir
The gp120 glycoprotein of human immunodeficiency virus type 1 binds to sensory ganglion neurons.: Ann Neurol. 1993 Dec;34(6):855-63. Unique Identifier : AIDSLINE MED/94071420; Apostolski S; McAlarney T; Quattrini A; Levison SW; Rosoklija G; Lugaressi A; Corbo M; Sadiq SA; Lederman S; Hays AP; et al; Department of Neurology, Columbia University-College of; Physicians and Surgeons, New York, NY 10032.; Using immunofluorescence microscopy we found that gp120 binds to the surface of rat dorsal root ganglia neurons and human neuroblastoma cells but not to rat fibroblasts or glial cells. The binding of gp120 to neurons was eliminated by pretreatment with trypsin, which removes cell-surface proteins, but not with chlorof
Demonstration of human T-cell lymphotropic virus type I (HTLV-I) from an HTLV-I seronegative south Indian patient with chronic, progressive spastic paraparesis.: Ann Neurol. 1993 Dec;34(6):867-70. Unique Identifier : AIDSLINE MED/94071422; Nishimura M; Mingioli E; McFarlin DE; Jacobson S; Neuroimmunology Branch, National Institutes of Health, Bethesda,; MD 20892.; Here we describe a human T-cell lymphotropic virus type I (HTLV-I) seronegative patient from South India with a chronic, progressive spastic paraparesis from which HTLV-I has been isolated from peripheral blood lymphocytes. HTLV-I pol and tax viral sequences were detected in DNA fro
Modulatory effect of N-acetyl-L-cysteine on the HIV-1 multiplication in chronically and acutely infected cell lines.: Antiviral Res. 1993 Sep;22(1):31-43. Unique Identifier : AIDSLINE MED/94071426; Pani A; Marongiu ME; La Colla P; Dipartimento di Biologia Sperimentale, Universita di Cagliari,; Italy.; N-acetyl-L-cysteine (NAC) is known to antagonize the PMA- or cytokine-stimulated HIV-1 replication in latently and acutely infected monocytic and lymphocytic cell lines, and to reduce the virus multiplication in acutely infected, PHA-stimulated PBMC. We here report on the modulatory effects of NAC on the HIV-1 multipl
Detection of human immunodeficiency virus type 1 and human papillomavirus type 16 in acquired immunodeficiency syndrome-related and classic Kaposi's sarcoma [letter]: Arch Dermatol. 1993 Dec;129(12):1620-2. Unique Identifier : AIDSLINE MED/94071481; Fujiwara H; Hashimoto K; Fujiwara K; Mehregan AH
Fever among outpatients with advanced human immunodeficiency virus infection.: Arch Intern Med. 1993 Aug 23;153(16):1909-12. Unique Identifier : AIDSLINE MED/94071557; Sepkowitz KA; Telzak EE; Carrow M; Armstrong D; Infectious Disease Service, Memorial Sloan-Kettering Cancer; Center, New York, NY.; BACKGROUND: Fever is common among persons with human immunodeficiency virus (HIV) infection. However, the clinical implications of fever in this population have not been evaluated. We therefore undertook a prospective study of fever in persons with advanced HIV infection to determine the incidence and etiology of feve
Recombinant human erythropoietin treatment: investigational new drug protocol for the anemia of the acquired immunodeficiency syndrome. Overall results [published erratum appears in Arch Intern Med 1994 May 23;154(10):1072]: Arch Intern Med. 1993 Dec 13;153(23):2669-75. Unique Identifier : AIDSLINE MED/94071570; Phair JP; Abels RI; McNeill MV; Sullivan DJ; Comprehensive AIDS Center, Northwestern University Medical; School, Chicago, IL.; BACKGROUND: Anemia associated with human immunodeficiency virus infection may be due to reduced erythropoiesis related to the disease itself or to concomitant medications (eg, zidovudine). Clinical studies have shown recombinant human erythropoietin (r-HuEPO) to be effective in correcting the anemia of zidovudine-trea
A comparison of Streptococcus pyogenes (group A streptococcal) bacteremia at an urban and a suburban hospital. The importance of intravenous drug use.: Arch Intern Med. 1993 Dec 13;153(23):2679-84. Unique Identifier : AIDSLINE MED/94071571; Navarro VJ; Axelrod PI; Pinover W; Hockfield HS; Kostman JR; Department of Medicine, Temple University Health Sciences Center,; Philadelphia, PA.; BACKGROUND: There has been a recent resurgence of severe infections with Streptococcus pyogenes, including bacteremias and a toxic shock-like syndrome. The purpose of this study was to examine the influence of intravenous drug use on the incidence, clinical epidemiology, and severity of S pyogenes bacteremia. METHODS:
Lack of association of human immunodeficiency virus seroconversion with visits to foreign ports in US Navy personnel.: Arch Intern Med. 1993 Dec 13;153(23):2685-91. Unique Identifier : AIDSLINE MED/94071572; Garland FC; Garland CF; Gorham ED; Miller MR; Cunnion SO; Berg SW; Balazs LL; Department of Health Sciences and Epidemiology, Naval Health; Research Center, San Diego, Calif.; BACKGROUND: The US Navy visits ports on all continents and many islands of the world, many of which are reported to have a high endemicity of human immunodeficiency virus (HIV) infection. The objective of this study was to determine whether visits to foreign ports by active-duty navy personnel were associated with inc
Tuberculosis in a correctional facility.: Arch Intern Med. 1993 Dec 13;153(23):2692-5. Unique Identifier : AIDSLINE MED/94071573; Pelletier AR; DiFerdinando GT Jr; Greenberg AJ; Sosin DM; Jones WD Jr; Bloch AB; Woodley CL; Division of Field Epidemiology, National Center for Infectious; Diseases, Atlanta, GA.; BACKGROUND: After the identification of five suspected cases of tuberculosis (TB) in a Nassau County (New York) jail during a 3-week period, an epidemiologic investigation was begun to document the number of cases of TB infection and disease associated with the jail, the characteristics of current or former inmates wi
Microsporidia. Emerging pathogens in immunodeficient persons [editorial; comment]: Arch Pathol Lab Med. 1993 Dec;117(12):1243-5. Unique Identifier : AIDSLINE MED/94071605; Bryan RT; Weber R
An analysis of patient accidents in hospital.: Aust Clin Rev. 1993;13(3):141-9. Unique Identifier : AIDSLINE MED/94071744; Goodwin MB; Westbrook JI; St Vincent's Hospital, Sydney, NSW, Australia.; An analysis of patient accidents occurring at St Vincent s Hospital, Sydney in 1990 was undertaken using data obtained from the hospital s computerized accident database. Ward, age and sex specific fall rates were calculated from a total of 800 patient-related accidents and incidents reported. Ninety per cent of all a
[Feline immunodeficiency syndrome--a review]: Berl Munch Tierarztl Wochenschr. 1993 Oct;106(10):325-8. Unique Identifier : AIDSLINE MED/94071804; Muluneh A; Institut fur Mikrobiologie und Infektionskrankheiten,; Veterinarmedizinische Fakultat, Universitat Leipzig.; A review is given on Feline Immunodeficiency Syndrome with reference being made to aetiology, epidemiology, pathogenesis and pathology, clinical symptoms, differential diagnosis, immunity, therapy and prophylaxis.
Natural autoantibodies cross-react with a peptide derived from the second conserved region of HIV-1 envelope glycoprotein gp120.: Biochem Biophys Res Commun. 1993 Nov 15;196(3):1019-24. Unique Identifier : AIDSLINE MED/94071848; Velikovic V; Metlas R; Danilo V; Cavor L; Pejinovic N; Dujuc A; Zakhariev S; Guarnaccia C; Pongor S; Laboratory for Multidisciplinary Research 180/2, Institute of; Nuclear Sciences, VINCA, Beograd, Yugoslavia.; It was recently shown that peptide NTM (RSANFTDNAKTIIVQLNESV), corresponding to residues 280-299 in the second conserved domain of HIV-1 envelope glycoprotein gp120, has spectral and sequence similarity with human vasoactive intestinal peptide, VIP (Veljkovic et al., Biochem. Biophys. Res. Commun., 189, 705-710, 1992)
Glycoprotein of human immunodeficiency virus type 1 synthesized in chronically infected Molt3 cells acquires heterogeneous oligosaccharide structures.: Biochem Biophys Res Commun. 1993 Nov 15;196(3):1335-42. Unique Identifier : AIDSLINE MED/94071894; Pal R; di Marzo Veronese F; Nair BC; Rittenhouse S; Hoke G; Mumbauer S; Sarngadharan MG; Advanced BioScience Laboratories, Inc., Kensington, Maryland; 20895.; Diversity of oligosaccharide structures on the glycoprotein of HIV-1 was studied in individual clones of Molt3 cells chronically infected with HIV-1IIIB. A glycoprotein of molecular weight 140 kD (gp140) was found to be shed into the medium from one of these clones, which unlike normally processed gp120, contained sig
ILCA's position paper statement on HIV [letter]: J Hum Lact. 1993 Jun;9(2):80-1. Unique Identifier : AIDSLINE MED/94072096; Chastain RM
A rapid method for site-specific mutagenesis using larger plasmids as templates.: Biotechniques. 1993 Oct;15(4):700-4. Unique Identifier : AIDSLINE MED/94072202; Watkins BA; Davis AE; Cocchi F; Reitz MS Jr; National Cancer Institute, National Institutes of Health,; Bethesda, MD 20892.; To facilitate the introduction of specific point mutations in plasmids that are too large to be amplified efficiently by a single PCR, we have developed a method for site-directed mutagenesis by generating partial plasmid fragments, which introduces changes as simply as conventional techniques. Plasmids containing a f
A versatile ELISA-PCR assay for mRNA quantitation from a few cells.: Biotechniques. 1993 Oct;15(4):730-7. Unique Identifier : AIDSLINE MED/94072206; Alard P; Lantz O; Sebagh M; Calvo CF; Weill D; Chavanel G; Senik A; Charpentier B; Institut de Recherches Scientifiques sur le Cancer, Villejuif,; France.; Gene expression studies require a sensitive and quantitative assay of mRNA amounts present in small samples. We describe a general method of quantifying specific mRNA quickly and easily from purified RNA or directly from a few cells by PCR and enzyme-linked immunosorbent assay (ELISA) revelation of the resulting produ
The patient profile approach to assessing the cost of AIDS and HIV infection.: J Public Health Med. 1993 Sep;15(3):235-42. Unique Identifier : AIDSLINE MED/94072236; Morton A; McCallum AK; Parkin DW; Bhopal RS; Department of Epidemiology and Public Health, Medical School,; University of Newcastle upon Tyne.; Despite interest in the costs associated with HIV infection, little useful information exists to aid those planning patient care. The results of costing studies, which are mainly North American, are difficult to apply to the National Health Service. Moreover, they have generally ignored HIV infection before formal dia
Detection of human T-cell lymphotropic virus type-1 proviral DNA in the saliva of an adult T-cell leukaemia/lymphoma patient using the polymerase chain reaction.: Br J Dermatol. 1993 Nov;129(5):637-41. Unique Identifier : AIDSLINE MED/94072419; Taniguchi S; Maekawa N; Yashiro N; Hamada T; Department of Dermatology, Osaka City University Medical School,; Japan.; We report a case of adult T-cell leukaemia/lymphoma (ATLL), in whom the polymerase chain reaction (PCR) on genomic DNA from saliva demonstrated the monoclonal integration of human T-cell lymphotropic virus type-1 (HTLV-1) proviral DNA in lymphocytes in the saliva. These results provided evidence of the possibility of
Prognostic value of a novel circulating serum 90K antigen in HIV-infected haemophilia patients.: Br J Haematol. 1993 Sep;85(1):207-9. Unique Identifier : AIDSLINE MED/94072452; Longo G; Natoli C; Rafanelli D; Tinari N; Morfini M; Rossi-Ferrini P; D'Ostilio N; Iacobelli S; Chair of Medical Oncology, University 'G. D'Annunzio', Chieti,; Italy.; We evaluated the prognostic role of a novel tumour-associated antigen, termed 90K, in a cohort of HIV+ asymptomatic haemophilia patients with known duration of seropositivity and median follow-up of about 7 years. The circulating levels of 90K are higher in HIV+ asymptomatic patients than HIV- controls. The antigen le
High incidence of lymphoid infiltration on labial salivary gland biopsy in non-Hodgkin's lymphomas: clinical implications.: Br J Haematol. 1993 Sep;85(1):93-8. Unique Identifier : AIDSLINE MED/94072475; Morel P; Quiquandon I; Janin A; Dupriez B; Desablens B; Gosselin B; Bauters F; Service des Maladies du Sang, Hopital Huriez, CHRU, Lille,; France.; Sjogren s syndrome (SS) is characterized by an increased risk of developing a non-Hodgkin s lymphoma (NHL). We performed labial salivary gland biopsy (LSGB) in 103 patients with untreated NHL, negative for human immunodeficiency virus. Median age was 58 years (range 21-79) and M/F
Fetal immunodeficiency: a consequence of placental insufficiency.: Br J Obstet Gynaecol. 1993 Nov;100(11):1000-4. Unique Identifier : AIDSLINE MED/94072523; Thilaganathan B; Plachouras N; Makrydimas G; Nicolaides KH; Harris Birthright Research Centre for Fetal Medicine, King's; College Hospital School of Medicine, London, UK.; OBJECTIVE: To study the effect of placental insufficiency on fetal lymphocyte subpopulations. STUDY DESIGN: Cross sectional study of 19 growth retarded fetuses undergoing cordocentesis at 24 to 37 weeks gestation. Flow cytometry was used to enumerate fetal blood lymphocyte subpopulations. RESULTS: The mean T (CD3+), B
Macrophages and Mycobacterium tuberculosis: the key to pathogenesis.: Immunol Ser. 1994;60:249-61. Unique Identifier : AIDSLINE MED/94072661; Rook GA; University College London Medical School, England.
Monocyte-Mycobacterium avium complex interactions: studies of potential virulence factors for humans.: Immunol Ser. 1994;60:263-79. Unique Identifier : AIDSLINE MED/94072662; Johnson JL; Ellner JJ; Shiratsuchi H; Case Western Reserve University, Cleveland, Ohio.
Alveolar macrophage interaction with Pneumocystis carinii.: Immunol Ser. 1994;60:417-36. Unique Identifier : AIDSLINE MED/94072673; Koziel H; O'Riordan D; Warner A; Rose RM; New England Deaconess Hospital, Boston, Massachusetts.
The macrophage and HIV-1.: Immunol Ser. 1994;60:569-87. Unique Identifier : AIDSLINE MED/94072684; Ho WZ; Cherukuri R; Douglas SD; Children's Hospital of Philadelphia, University of Pennsylvania; School of Medicine.; As described above, monocytes/macrophages from such diverse areas as the CNS, lungs, peripheral blood, cord blood, and liver are susceptible to infection by HIV-1 and may serve as reservoirs for transmitting the virus throughout the body. In contrast to lymphocytes, the chronic and low-level mode of infection that HIV
Treatment of aspergillosis with itraconazole.: Ann Pharmacother. 1993 Oct;27(10):1206-11. Unique Identifier : AIDSLINE MED/94072790; Jennings TS; Hardin TC; Pharmacy Service, Audie L. Murphy Memorial Veterans Hospital, San; Antonio, TX 78284.; OBJECTIVE: To review the role of itraconazole as oral therapy for the major infections caused by Aspergillus spp.: allergic bronchopulmonary aspergillosis, aspergilloma, and invasive aspergillosis. DATA SOURCES: A MEDLINE search of articles published in the English language between 1986 and 1993 was used to identify r
Prophylaxis of HIV infection following occupational exposure.: Ann Pharmacother. 1993 Oct;27(10):1243-56. Unique Identifier : AIDSLINE MED/94072794; Fish DN; Division of Pharmacy Practice, School of Pharmacy, University of; Colorado Health Sciences Center, Denver 80262.; OBJECTIVE: To review the risk of HIV infection following occupational exposure, the theoretical basis for chemoprophylaxis, investigative experience with chemoprophylaxis in animals and humans, and the economic aspects of postexposure chemoprophylaxis. DATA SOURCES: English-language articles and conference proceedings
Enteroenteric fistula of the duodenum in a patient with AIDS and Mycobacterium avium-intracellulare infection.: J Assoc Acad Minor Phys. 1993;4(4):138-42. Unique Identifier : AIDSLINE MED/94072812; Simko V; Chandrasekaran P; Gillon S; De Soto F; Section of Gastroenterology, Brooklyn Veterans Administration; Medical Center, NY 11209.; Upper gastrointestinal endoscopy revealed a double lumen in the second portion of the duodenum in a 39-year-old man with advanced acquired immunodeficiency syndrome (AIDS). The lesion was not lined with an epithelium and improved with antituberculous therapy. These findings, as well as both an extensive transmural inf
Enhanced expression, secretion, and large-scale purification of recombinant HIV-1 gp120 in insect cell using the baculovirus egt and p67 signal peptides [published erratum appears in Protein Expr Purif 1994 Feb;5(1):103]: Protein Expr Purif. 1993 Oct;4(5):349-57. Unique Identifier : AIDSLINE MED/94072850; Murphy CI; McIntire JR; Davis DR; Hodgdon H; Seals JR; Young E; Department of Molecular Biology, Cambridge Biotech Corporation,; Worcester, Massachusetts 01605.; The expression of glycosylated and secreted recombinant mammalian proteins in baculovirus-infected insect cells is often much less efficient than that of other foreign proteins in this system. In an effort to improve the expression and secretion of such proteins we have constructed baculovirus vectors which contain th
Overexpression of HIV-1 proteins in Escherichia coli by a modified expression vector and their one-step purification.: Protein Expr Purif. 1993 Oct;4(5):367-72. Unique Identifier : AIDSLINE MED/94072852; Cheynet V; Verrier B; Mallet F; Unite Mixte 103 CNRS, BioMerieux, Ecole Normale Superieure de; Lyon, France.; A synthetic expression system, pMH, was constructed for high-level expression and rapid purification of HIV-1 proteins in Escherichia coli, by introducing two synthetic sequences. The first sequence permitted a high-level expression via a second ribosome-binding site plus an A/T-rich region. This minicistron between t
AIDS row closes German health office [news]: BMJ. 1993 Oct 23;307(6911):1023. Unique Identifier : AIDSLINE MED/94072883; Karcher HL
Heterosexual transmission of HIV in injecting drug users.: BMJ. 1993 Nov 6;307(6913):1184-5. Unique Identifier : AIDSLINE MED/94072965; Ronald PJ; Robertson JR; Wyld R; Weightman R; Edinburgh Drug Addiction Study.
Transmission of infectious diseases in prison [letter]: BMJ. 1993 Nov 6;307(6913):1212. Unique Identifier : AIDSLINE MED/94072980; Mathei C; van Damme P; Meheus A
Time for community change: what has outreach to offer? [editorial]: Addiction. 1993 Oct;88(10):1317-20. Unique Identifier : AIDSLINE MED/94072992; Rhodes T
HIV risk among women injecting drug users who are in jail.: Addiction. 1993 Oct;88(10):1351-60. Unique Identifier : AIDSLINE MED/94072997; Magura S; Kang SY; Shapiro J; O'Day J; National Development and Research Institutes, Inc., New York, NY; 10013.; Female offender populations and females in jail include large proportions of injecting drug users (IDUs), who are at high risk of contracting or transmitting HIV. Women IDUs (n = 165) were recruited and interviewed at New York City s central jail facility for women. The study examined these women s patterns of HIV ris
Prisoners and HIV/AIDS [news]: Addiction. 1993 Oct;88(10):1447. Unique Identifier : AIDSLINE MED/94073007
A decade of AIDS literature: author response [letter; comment]: Bull Med Libr Assoc. 1993 Oct;81(4):442. Unique Identifier : AIDSLINE MED/94073126; Pratt GF
Responses of health care professionals to proposed mandatory HIV testing.: Arch Fam Med. 1993 Jan;2(1):38-44. Unique Identifier : AIDSLINE MED/94073337; Passannante MR; Louria DB; Department of Preventive Medicine and Community Health,; University of Medicine and Dentistry of New Jersey-New Jersey; Medical School, Newark.; OBJECTIVE: to survey active health professionals to assess the response to and impact of a mandatory human immunodeficiency virus (HIV) testing policy on health care providers and the communities in which they practice. DESIGN AND SETTING: Anonymous four-page survey of active health professionals at 13 hospitals in no
Is anybody talking to physicians about acquired immunodeficiency syndrome and sex? A national survey of patients.: Arch Fam Med. 1993 Jan;2(1):45-51. Unique Identifier : AIDSLINE MED/94073338; Gerbert B; Bleecker T; Bernzweig J; School of Dentistry, University of California, San Francisco.; OBJECTIVE: We wanted to know what proportion of the US population had spoken with a physician about sex and the acquired immunodeficiency syndrome (AIDS). In particular, we wanted to know whether patients who were at risk for sexually transmitted diseases, including human immunodeficiency virus (HIV), had had such dis
Reflections after 9 years of working with patients with acquired immunodeficiency syndrome. What I have learned.: Arch Fam Med. 1993 Jan;2(1):55-8. Unique Identifier : AIDSLINE MED/94073339; Bauman KA; Department of Family Practice and Community Health, John A. Burns; School of Medicine, University of Hawaii at Manoa, Wahiawa.
HIV and other viruses in surgery: a continued occupational risk.: Adv Card Surg. 1993;4:237-53. Unique Identifier : AIDSLINE MED/94073552; Fry DE; Department of Surgery, University of New Mexico School of; Medicine, Albuquerque.; Hepatitis viruses and HIV represent known and suspected occupational risks to surgeons. A better understanding of these diseases will allow surgeons to provide better and more compassionate care for their patients. It is essential that surgeons view blood as a toxic substance in the operating room. Reducing potential
Virus-like particles in synovial fluids from patients with rheumatoid arthritis.: Br J Rheumatol. 1993 Dec;32(12):1044-8. Unique Identifier : AIDSLINE MED/94073613; Stransky G; Vernon J; Aicher WK; Moreland LW; Gay RE; Gay S; Division of Clinical Immunology and Rheumatology, University of; Alabama at Birmingham.; Based on the elevated expression of oncogenes in proliferating transformed-appearing synoviocytes we searched for the possible involvement of a viral agent in the pathogenesis of RA. We report the detection of virus-like particles with retroviral C type morphology in SF, which lack the typical morphologic as well as i
Eye protection for the vascular surgeon.: Br J Surg. 1993 Nov;80(11):1379-80. Unique Identifier : AIDSLINE MED/94073643; Berridge DC; Lees TA; Chamberlain J; Jones NA; Department of Vascular Surgery, Freeman Hospital, High Heaton,; Newcastle upon Tyne, UK.; Contamination occurring during vascular surgery was studied prospectively using a surgical mask incorporating a Splashguard visor. Over a 16-week period 78 vascular procedures were included; 44 were of or = 2 h. Contamination on both mask and visor from blood spots was recorded at the e
Human immunodeficiency virus and infectious considerations.: Crit Care Clin. 1993 Oct;9(4):741-63. Unique Identifier : AIDSLINE MED/94073763; Esposito TJ; Aprahamian C; Campbell W; Department of Surgery, Stritch School of Medicine, Loyola; University, Maywood, Illinois.; In summary, HIV is a retrovirus with devastating consequences for those infected. Primary modes of transmission are through sexual contact and parenteral exposure to infected blood and body fluids. Prevalence of the virus among trauma patients, risk of exposure, and infection of health care workers are variable and to
Successful treatment of a patient with adult T-cell leukemia by daily oral administration of low-dose etoposide. Decrease in the amount of HTLV-I proviral DNA revealed by the polymerase chain reaction method.: Cancer. 1993 Dec 15;72(12):3614-7. Unique Identifier : AIDSLINE MED/94073804; Kojima H; Hori M; Shibuya A; Nagasawa T; Miwa M; Abe T; Division of Hematology, University of Tsukuba, Ibaraki, Japan.; BACKGROUND. Oral administration of low-dose etoposide is known to be effective against various malignancies, including malignant lymphoma. However, the effectiveness of low-dose etoposide as a treatment for adult T-cell leukemia (ATL) has not been established. METHODS. A 74-year-old woman with ATL in acute phase was t
1,2-Di-O-acetyl-5-O-benzoyl-3-deoxy-3-fluoro-D-xylofuranose. A versatile precursor for the synthesis of 3-deoxy-3-fluoro-beta-D-xylofuranosyl nucleosides as potential antiviral agents.: Carbohydr Res. 1993 Oct 18;249(1):1-17. Unique Identifier : AIDSLINE MED/94073886; Gosselin G; Puech F; Genu-Dellac C; Imbach JL; Universite de Montpellier II, Laboratoire de Chimie; Bio-organique, U.R.A., France.
Studies on the mechanism of complement-mediated inhibition of antibody binding to HIV gp41.: Clin Exp Immunol. 1993 Dec;94(3):490-3. Unique Identifier : AIDSLINE MED/94074222; Hidvegi T; Prohaszka Z; Ujhelyi E; Thielens NM; Dierich MP; Hampl H; Arlaud G; Nagy K; Fust G; National Institute of Haematology, Blood Transfusion and; Immunology, Budapest, Hungary.; We have previously demonstrated that HIV envelope gp41 binding to specific antibodies decreases after preincubation of fluid-phase gp41 in normal human serum. This inhibition is proven to be mediated by the classical complement pathway. In this study recombinant gp41 (rgp41) and/or synthetic peptides were preadsorbed
[A case of Klippel-Trenaunay-Weber syndrome--special reference to myelopathy]: Rinsho Shinkeigaku. 1993 Jul;33(7):746-53. Unique Identifier : AIDSLINE MED/94074247; Moritoyo T; Hashimoto K; Furuzono H; Nagamatsu K; Department of Neurology, Oita Prefectural Hospital.; A 49-year-old woman with Klippel-Trenaunay-Weber syndrome (KTW) is reported. She had characteristic features of KTW; cutaneous angiomas on her back, left knee and both plantae, varicosities on both legs, and hypertrophy of the left leg. In addition she had rare complications of KTW; asymmetric skull bone, hemicranial
[A case of flaccid paraplegia associated with HTLV-I infection]: Rinsho Shinkeigaku. 1993 Jul;33(7):754-8. Unique Identifier : AIDSLINE MED/94074248; Kyuno K; Ito H; Hasegawa H; Saito T; Kowa H; Department of Neurology, Kitasato University East Hospital.; A 63-year-old female began to have progressive gait disturbance at the age of 50. Neurologic examination revealed weakness and hypotonus of bilateral leg muscles. Deep tendon reflexes were hypoactive with positive Babinski sign and vibration sense was diminished in the legs. HTLV-I antibody titers were elevated both i
[HTLV-I associated myelopathy presenting with profound atrophy of unilateral lower limb]: Rinsho Shinkeigaku. 1993 Jul;33(7):781-3. Unique Identifier : AIDSLINE MED/94074254; Asahina M; Nakajima M; Yoshiyama Y; Katayama K; Hirayama K; Department of Neurology, Narita Red Cross Hospital.; A 63-year-old woman had suffered from progressive weakness and wasting of the right lower limb for seven years. In the lower limbs, there were profound muscular atrophy and weakness on the right, and mild weakness with spasticity on the left. Muscle strength of the upper limbs was normal. Sensory examination was norma
Alveolar macrophage subpopulations in patients with active pulmonary tuberculosis.: Chest. 1993 Dec;104(6):1773-8. Unique Identifier : AIDSLINE MED/94074406; Kuo HP; Yu CT; Department of Thoracic Medicine, Chang Gung Memorial Hospital,; Taipei, Taiwan, Republic of China.; Alveolar macrophages are a heterogeneous cell population. The heterogeneity of alveolar macrophages recovered by bronchoalveolar lavage (BAL) from 12 patients with active pulmonary tuberculosis (TB) and 10 normal subjects was studied using Percoll density fractionation. The numbers and subsets (on the basis of CD3, CD
Mycobacterium gordonae: a treatable disease in HIV-positive patients.: Chest. 1993 Dec;104(6):1779-85. Unique Identifier : AIDSLINE MED/94074407; Lessnau KD; Milanese S; Talavera W; Department of Pulmonary/Critical Care Medicine, Cabrini Medical; Center, New York 10003.; PURPOSE: To evaluate the pathogenicity of Mycobacterium gordonae in patients with and without human immunodeficiency virus (HIV) infection. PATIENTS AND METHODS: Twenty-one HIV-positive and 15 HIV-negative patients in a tertiary care center. A descriptive, case-control, and cohort study with a review of the literature
[Autologous blood transfusion]: Dtsch Med Wochenschr. 1993 Dec 10;118(49):1828-9. Unique Identifier : AIDSLINE MED/94074508; Gluck, D; Kubanek B; Abteilung Transfusionsmedizin der Universitat,; DRK-Blutspendezentrale, Ulm.
A cooperative interaction between NF-kappa B and Sp1 is required for HIV-1 enhancer activation.: EMBO J. 1993 Sep;12(9):3551-8. Unique Identifier : AIDSLINE MED/94074554; Perkins ND; Edwards NL; Duckett CS; Agranoff AB; Schmid RM; Nabel GJ; Howard Hughes Medical Institute, University of Michigan Medical; Center, Department of Internal Medicine, Ann Arbor 48109-0650.; The human immunodeficiency virus (HIV-1) long terminal repeat (LTR) contains two binding sites for NF-kappa B in close proximity to three binding sites for the constitutive transcription factor, Sp1. Previously, stimulation of the HIV enhancer in response to mitogens has been attributed to the binding of NF-kappa B to
Value of the CD25+ CD16+ cell determination in defining the prognosis of operable breast cancer patients.: Eur J Gynaecol Oncol. 1993;14(5):412-8. Unique Identifier : AIDSLINE MED/94074582; Iaffaioli RV; Frasci G; Rinaldi L; Del Vecchio L; Tortoriello A; Facchini G; Perone V; Montesarchio V; Vacca C; Vaia F; et al; Cattedra di Oncologia Medica Universita di Cagliari.; The immunologic status of 40 breast cancer patients with operable disease and 50 healthy women was studied at the Division of Medical Oncology of the 2nd Medical School in Naples. Skin tests and lymphocyte subpopulation determination were performed. The same tests were repeated after surgery in the cancer patients. At
Antiviral agents for ocular adenovirus infections.: Eye. 1993;7 ( Pt 3 Suppl ):18-20. Unique Identifier : AIDSLINE MED/94074710; Cook SD; Bristol Eye Hospital, UK.; Despite significant knowledge of the molecular biology and genetics of adenovirus, no specific antiviral agent has been developed for use in adenovirus infections. This contrasts with the situation in herpes simplex virus (HSV) and human immunodeficiency virus (HIV) infections, in which antiviral agents target specifi
Initial affects of the expanded AIDS case definition.: Del Med J. 1993 Oct;65(10):671-4. Unique Identifier : AIDSLINE MED/94074750
Duodenal morphology and intensity of infection in AIDS-related intestinal cryptosporidiosis.: Gastroenterology. 1993 Dec;105(6):1769-75. Unique Identifier : AIDSLINE MED/94074860; Genta RM; Chappell CL; White AC Jr; Kimball KT; Goodgame RW; Department of Medicine, Baylor College of Medicine, Houston,; Texas.; BACKGROUND: The pathogenesis of intestinal cryptosporidiosis is not known. Previous studies have shown that the intensity of infection varies between patients. The hypothesis of this study is that intestinal injury is related to the intensity of infection. METHODS: The histological abnormalities associated with Crypto
[Gastrointestinal manifestations in AIDS]: Harefuah. 1993 Nov 15;125(10):364-7. Unique Identifier : AIDSLINE MED/94074920; Broide E; Scapa E; Abramowich D; Eshchar J
[AIDS and the physician]: Harefuah. 1993 Nov 15;125(10):379-82. Unique Identifier : AIDSLINE MED/94074924; Ishay R
[Dideoxynucleoside therapy in acquired immunodeficiency syndrome]: Harefuah. 1993 Nov 1;125(9):272-9. Unique Identifier : AIDSLINE MED/94074934; Rahav G; Maayan S
[Pregnancy and the human immunodeficiency virus]: Harefuah. 1993 Nov 1;125(9):280-4. Unique Identifier : AIDSLINE MED/94074935; Paz I; Seidman OS; Stevenson DK; Mashiach S
The acquired immunodeficiency syndrome and the evolution of new micro-organisms: a pathologist's view [editorial; comment]: Hum Pathol. 1993 Sep;24(9):935-6. Unique Identifier : AIDSLINE MED/94074980; Rotterdam H
[Comic books and prevention of STD and AIDS. Critical analysis of 7 documents]: Hygie. 1993 Sep;12(3):16-9. Unique Identifier : AIDSLINE MED/94074991; Bonnin F; Michaud C
Mobilizing support to strengthen the role of schools in preventing HIV infection, STD and other significant health problems.: Hygie. 1993 Sep;12(3):20-1. Unique Identifier : AIDSLINE MED/94074992; Dhillon HS; O'Byrne D; Kolbe L; Baldo M; Jones JT
Strengthening the role of schools in preventing HIV infection, STD, and other important health problems.: Hygie. 1993 Sep;12(3):22-3. Unique Identifier : AIDSLINE MED/94074993; Jones J; Bunde-Birouste A
Developing and implementing school policies to address HIV infection and other health policies.: Hygie. 1993 Sep;12(3):23-4. Unique Identifier : AIDSLINE MED/94074994; Isaksson A; Bahri S; O'Byrne D; Chowdhung S; Reinders J; Fraser K
Developing and implementing curricula to address HIV infection and other important health problems.: Hygie. 1993 Sep;12(3):25-6. Unique Identifier : AIDSLINE MED/94074995; Baldo M; Metcalfe O; Barthes AM; Collins J; Ricard E; Marx E; Schaalma H
Preparing school personnel to address HIV infection.: Hygie. 1993 Sep;12(3):26-8. Unique Identifier : AIDSLINE MED/94074996; Williams J; Dhillon HS; Bunde-Birouste A; Bertinato L; Jha S; Sathrun P; Robertson A
Developing and implementing school health services to address HIV/AIDS.: Hygie. 1993 Sep;12(3):28-31. Unique Identifier : AIDSLINE MED/94074997; Dick B; Warren C; Jones J; Davidson D; Jha S
IUHPE global development. International Union for Health Promotion and Education.: Hygie. 1993 Sep;12(3):32-4, 36-9. Unique Identifier : AIDSLINE MED/94074998
[International AIDS Congress; Berlin, June 7-11, 1993]: Immun Infekt. 1993 Oct;21(5):147-8. Unique Identifier : AIDSLINE MED/94075006; Discher T
Spleen and thymus cell subsets modified by long-term morphine administration and murine AIDS--II.: Int J Immunopharmacol. 1993 Nov;15(8):909-18. Unique Identifier : AIDSLINE MED/94075076; Lopez MC; Chen GJ; Colombo LL; Huang DS; Darban HR; Watzl B; Watson RR; Department of Family and Community Medicine, Arizona Health; Sciences Center, University of Arizona, Tucson 85724.; Intravenous heroin abusers suffer a great variety of infections, including AIDS (acquired immune deficiency syndrome). We developed an experimental mouse model to evaluate the long-term effect of in vivo morphine administration during retrovirus-induced immune dysfunction. Mice were treated daily for 11 weeks with inc
The human immunodeficiency virus type 1 long terminal repeat is activated by monofunctional and bifunctional DNA alkylating agents in human lymphocytes.: J Biol Chem. 1993 Dec 15;268(35):26719-24. Unique Identifier : AIDSLINE MED/94075370; Quinto I; Ruocco MR; Baldassarre F; Mallardo M; Dragonetti E; Scala G; Dipartimento di Biochimica e Biotecnologie Mediche, Universita; degli Studi Federico II, Naples, Italy.; The activation of the human immunodeficiency virus, type 1 (HIV-1) by the DNA alkylating agents ethyl methanesulfonate, methyl methanesulfonate, and mitomycin C was observed in human B lymphocytes transiently transfected with plasmids in which the HIV-1 long terminal repeat (LTR) directed the expression of the bacteri
Eukaryotic initiation factor 5A is a cellular target of the human immunodeficiency virus type 1 Rev activation domain mediating trans-activation.: J Cell Biol. 1993 Dec;123(6 Pt 1):1309-20. Unique Identifier : AIDSLINE MED/94075396; Ruhl M; Himmelspach M; Bahr GM; Hammerschmid F; Jaksche H; Wolff B; Aschauer H; Farrington GK; Probst H; Bevec D; et al; SANDOZ Research Institute, Vienna, Austria.; Expression of human immunodeficiency virus type 1 (HIV-1) structural proteins requires the presence of the viral trans-activator protein Rev. Rev is localized in the nucleus and binds specifically to the Rev response element (RRE) sequence in viral RNA. Furthermore, the interaction of the Rev activation domain with a
Ptosis and headache in an i.v. drug abuser.: Hosp Pract (Off Ed). 1993 Dec 15;28(12):18-20. Unique Identifier : AIDSLINE MED/94075467; Yang H; Jayaram S; Neurology Section, Medical Center, Jersey City, NJ.
[A study on AIDS knowledge initial report. Investigation of nurse school and university students]: Nippon Ika Daigaku Zasshi. 1993 Oct;60(5):342-6. Unique Identifier : AIDSLINE MED/94075484; Satsuta K; Department of Hygiene and Public Health, Nippon Medical School.
Results of retroactive testing of human semen donors for cystic fibrosis and human immunodeficiency virus by polymerase chain reaction.: Hum Reprod. 1993 Sep;8(9):1435-7. Unique Identifier : AIDSLINE MED/94075506; Fugger EF; Maddalena A; Schulman JD; Fairfax Cryobank, VA 22031.; Retroactive testing for cystic fibrosis carrier status was performed on 149 semen donors and 100 donor applicants; 162 human immunodeficiency virus (HIV-1) sero-negative non-active semen donors and 45 HIV-1 sero-negative actively donating semen donors were also retroactively tested for HIV-1 by polymerase chain reacti
Use of virologic assays for detection of human immunodeficiency virus in clinical trials: recommendations of the AIDS Clinical Trials Group Virology Committee.: J Clin Microbiol. 1993 Oct;31(10):2557-64. Unique Identifier : AIDSLINE MED/94075526; Hammer S; Crumpacker C; D'Aquila R; Jackson B; Lathey J; Livnat D; Reichelderfer P; New England Deaconess Hospital, Cambridge, Massachusetts.
Quantitative evaluation of hepatitis C virus RNA in patients with concurrent human immunodeficiency virus infections.: J Clin Microbiol. 1993 Oct;31(10):2679-82. Unique Identifier : AIDSLINE MED/94075546; Sherman KE; O'Brien J; Gutierrez AG; Harrison S; Urdea M; Neuwald P; Wilber J; Fitzsimons Army Medical Center, Aurora, Colorado 80045-5001.; Quantitation of the hepatitis C virus (HCV) provides a powerful epidemiologic and therapeutic method for the evaluation of infected patients. In this study semiquantitative reverse transcriptase polymerase chain reaction (PCR) is compared with a new branched DNA signal amplification methodology. Samples from HCV-infec
Cytomegalovirus antigenemia: clinical correlations in transplant recipients and in persons with AIDS [see comments]: J Clin Microbiol. 1993 Oct;31(10):2824-7. Unique Identifier : AIDSLINE MED/94075581; Mazzulli T; Rubin RH; Ferraro MJ; D'Aquila RT; Doveikis SA; Smith BR; The TH; Hirsch MS; Infectious Disease Unit, Massachusetts General Hospital, Boston.; We evaluated a rapid immunoperoxidase technique for the detection of cytomegalovirus ( CMV ) antigenemia in peripheral blood neutrophils of 56 transplant recipients (117 specimens) and 36 persons with AIDS (59 specimens). Antig
The burdens of race and history on Black Americans' attitudes toward needle exchange policy to prevent HIV disease.: J Public Health Policy. 1993 Autumn;14(3):320-47. Unique Identifier : AIDSLINE MED/94075592; Thomas SB; Quinn SC; Emory University School of Public Health, Atlanta, GA 30329.; We must enter the second decade of AIDS with the knowledge that existing public health efforts have failed to stop the disproportionate spread of HIV disease among Americans of African descent. This article presents the cold epidemiological facts which lay bare the moral tragedy that Black Americans are being killed b
Iron overload in multiply transfused patients who are HIV seropositive.: J Clin Pathol. 1993 Nov;46(11):1036-8. Unique Identifier : AIDSLINE MED/94075700; Goldin RD; Wilkins M; Dourakis S; Parkin J; Lindley R; Department of Histopathology, St Mary's Hospital Medical School,; London.; AIMS--To assess histologically the amount of iron deposited in liver biopsy specimens from HIV positive patients; and to perform estimations of liver iron on tissue from patients with an increase in parenchymal stainable iron. To correlate the amount of blood transfused and the degree of iron overload. METHODS--Liver
Cerebrospinal fluid concentration of fibronectin in patients with HIV-1 infection and central nervous system disorders.: J Clin Pathol. 1993 Nov;46(11):1039-41. Unique Identifier : AIDSLINE MED/94075701; Torre D; Zeroli C; Ferrario G; Bonetta G; Fiori GP; Martegani R; Division of Infectious Diseases, Regional Hospital, Varese,; Italy.; AIMS--To evaluate the fibronectin concentrations in the cerebrospinal fluid of HIV-1 infected patients with central nervous system disorders. METHODS--Fibronectin was determined by an immunoturbidimetric assay in 41 HIV-1 infected patients with AIDS dementia complex, progressive mu
Amebiasis and nonpathogenic intestinal protozoa.: Infect Dis Clin North Am. 1993 Sep;7(3):467-85. Unique Identifier : AIDSLINE MED/94075781; Aucott JN; Ravdin JI; Department of Medicine, Case Western University School of; Medicine, Cleveland, Ohio.; Infection with single or multiple species of intestinal protozoa is common in humans and can result in either asymptomatic colonization or symptoms of intestinal disease. Entamoeba histolytica serves as a paradigm for invasive colonic protozoal infection. The key to diagnosis and treatment of amebiasis is knowledge of
Leishmaniasis.: Infect Dis Clin North Am. 1993 Sep;7(3):527-46. Unique Identifier : AIDSLINE MED/94075784; Evans TG; Department of Medicine, University of Utah, Salt Lake City.; Leishmanial infections include three major clinical syndromes: visceral, cutaneous, and mucosal leishmaniasis. Visceral leishmaniasis, usually due to Leishmania donovani, has received increasing attention in the United States because of the growing number of cases seen in AIDS patients
Parasitic infections in AIDS patients. Cryptosporidiosis, isosporiasis, microsporidiosis, cyclosporiasis.: Infect Dis Clin North Am. 1993 Sep;7(3):569-86. Unique Identifier : AIDSLINE MED/94075786; Wittner M; Tanowitz HB; Weiss LM; Department of Parasitology, Albert Einstein College of Medicine,; Bronx, New York.; AIDS is characteristically associated with several intracellular enteric protozoan infections that often cause chronic and sometimes fatal intractable large-volume diarrhea. Until the AIDS epidemic, several of these parasitic infections were almost unknown as causes of human disease. This article reviews the diseases
Issues in toxoplasmosis.: Infect Dis Clin North Am. 1993 Sep;7(3):587-604. Unique Identifier : AIDSLINE MED/94075787; McCabe R; Chirurgi V; Department of Medicine, University of California Medical School.; Toxoplasma has become a well-recognized cause of disease in the last decade, primarily due to the prominence of AIDS. Diagnosis of toxoplasmic encephalitis is discussed, with emphasis on serologic tests, their pitfalls, and empiric therapeutic trials. Randomized trials for treatment of toxoplasmic encephalitis are few
Schistosomiasis.: Infect Dis Clin North Am. 1993 Sep;7(3):635-53. Unique Identifier : AIDSLINE MED/94075790; Lucey DR; Maguire JH; Department of Medicine, Uniformed Services University of the; Health Sciences, Bethesda, Maryland.; Schistosomiasis is a curable parasitic infection that, if left untreated, can persist for 30 years even though the parasite cannot reproduce in its human host. Tissue pathology, particularly of the GI and GU tracts, is associated with the granulomatous immune response to parasite eggs. Schistosomiasis is not endemic t
Visualization of the endogenous NF-kappa B p50 subunit in the nucleus of follicular dendritic cells in germinal centers.: J Immunol. 1994 Jan 1;152(1):12-21. Unique Identifier : AIDSLINE MED/94075814; Feuillard J; Korner M; Fourcade C; Costa A; Binet JL; Debre P; Raphael M; Departement d'Hematologie, Hopital Pitie Salpetriere, Paris,; France.; NF-kappa B, a 50 kDa/65 kDa (p50/p65) heterodimer, is a ubiquitous transcription factor involved in the positive regulation of various immune genes. The aim of this study was to determine whether NF-kappa B is related to a particular cell type and/or differentiation step during immunopoiesis. Using in situ hybridizati
[Studies on the usefulness of saliva for detection of antibodies to HIV-1]: Kansenshogaku Zasshi. 1993 Oct;67(10):1031-7. Unique Identifier : AIDSLINE MED/94075856; Ichikawa S; Tsukano K; Ito A; Gao ZZ; Soda K; Department of Public Health, Yokohama City University School of; Medicine.; It has been reported that antibodies to HIV-1 could be detected in saliva of patients with AIDS. We studied whether saliva is potentially useful for screening of HIV-1 infected persons. Pairs of serum and saliva were collected from both 19 HIV-1 seropositive outpatients (CDC type, II:15, III:1, IV:3) of AIDS clinic in
Prognostic classification for AIDS patients in Brazil.: J Med Syst. 1993 Aug;17(3-4):163-72. Unique Identifier : AIDSLINE MED/94075907; Ohno-Machado L; Faculdade de Medicina, Universidade de Sao Paulo.; We studied the survival rates and the prognostic variables that corresponded to death during hospitalization in 312 AIDS CDC group IV patients in Sao Paulo. Discriminant analysis proved to be a good tool to perform the exploratory data analysis that guided the survival analysis groups. It selected nine variables that
An artificial intelligence system to predict progression of immune dysfunction in healthy older patients.: J Med Syst. 1993 Aug;17(3-4):173-81. Unique Identifier : AIDSLINE MED/94075908; Mahler EM; Schmidt RM; Kvitash VI; Center for Preventive Medicine and Health Research, California; Pacific Medical Center, San Francisco.; In 1983, forty nine participants returning for their annual HEALTH WATCH evaluation were assessed for immune function status and served as healthy controls in an early study of normal reference values for T4 and T8 lymphocyte counts and T4/T8 lymphocyte ratios, B lymphocyte counts, and other laboratory tests for immun
Evidence of in vitro development of drug resistance to azidothymidine in T-lymphocytic leukemia cell lines (Jurkat E6-1/AZT-100) and in pediatric patients with HIV-1 infection.: J Acquir Immune Defic Syndr. 1993 Dec;6(12):1287-96. Unique Identifier : AIDSLINE MED/94076122; Avramis VI; Kwock R; Solorzano MM; Gomperts E; Department of Pediatrics, University of Southern California; School of Medicine, Children's Hospital Los Angeles 90027.; Clinical reports indicate that the development of drug resistance to AZT after chronic administration is common. In order to study this phenomenon, the T-cell line Jurkat E6-1 was treated continuously in vitro with low, gradually increased, concentrat
Association of immune activation with intravenous heroin use and methadone treatment in HIV-1 seropositive and seronegative subjects.: J Acquir Immune Defic Syndr. 1993 Dec;6(12):1297-300. Unique Identifier : AIDSLINE MED/94076123; Di Franco MJ; Marlink R; Hunter DJ; Tosteson T; Mayer K; Essex M; Department of Epidemiology, Harvard School of Public Health,; Boston, Massachusetts 02115.; This study evaluated the effect of continued heroin use during methadone treatment on serum neopterin levels in 40 human immunodeficiency virus (HIV) type 1 seropositive (HIV+) and 70 seronegative (HIV-) intravenous drug users (IVDUs). Persistent drug use, determined by urinary evidence of opiates, was more common in
Fusion activity dissociated from replication ability in feline immunodeficiency virus (FIV) in human cells.: J Acquir Immune Defic Syndr. 1993 Dec;6(12):1301-10. Unique Identifier : AIDSLINE MED/94076124; Tochikura TS; Tanabe-Tochikura A; Hayes KA; Lazo A; Bailer RT; Blakeslee JR Jr; Lafrado LJ; Roy-Burman P; Pandey R; Olsen RG; et al; Department of Veterinary Pathobiology, Ohio State University,; Columbus 43210.; Multinucleated-giant-cell formation followed by cell killing was observed after cocultivation of the feline immunodeficiency virus (FIV)-producing feline T-cell line 3201/FIV with various human cells, including T-cell lines carrying human T-cell lymphotropic virus type I (HTLV-I). The susceptibility to giant cell form
Therapy for oropharyngeal candidiasis in HIV-infected patients: a randomized, prospective multicenter study of oral fluconazole versus clotrimazole troches. The Multicenter Study Group [see comments]: J Acquir Immune Defic Syndr. 1993 Dec;6(12):1311-6. Unique Identifier : AIDSLINE MED/94076125; Pons V; Greenspan D; Debruin M; University of California at San Francisco 94143-0654.; A total of 334 HIV-infected patients with oral candidiasis were randomly assigned to receive 14 days of treatment with either 100 mg of oral fluconazole once daily or 10 mg clotrimazole five times daily. Both treatments were clinically effective: 98% of evaluable fluconazole-treated patients and 94% of evaluable clotr
Therapy for oropharyngeal candidiasis in HIV-infected patients [editorial; comment]: J Acquir Immune Defic Syndr. 1993 Dec;6(12):1317-8. Unique Identifier : AIDSLINE MED/94076126; Glatt AE
Improved outcomes in intensive care units for AIDS-related Pneumocystis carinii pneumonia: 1987-1991.: J Acquir Immune Defic Syndr. 1993 Dec;6(12):1319-21. Unique Identifier : AIDSLINE MED/94076127; Bennett RL; Gilman SC; George L; Guze PA; Bennett CL; Veterans Affairs Western Region Special Studies Group, University; of California, School of Medicine, Irvine.; Respiratory failure due to Pneumocystis carinii pneumonia (PCP) is the most common complication requiring an intensive care unit (ICU) for persons with AIDS. In this study, we evaluated patterns of ICU use for ICU patients with first-episode PCP in 15 Veterans Administration Medical Centers from 1987 to 1991. Twelve p
Determinants of accrual of women to a large, multicenter clinical trials program of human immunodeficiency virus infection. The AIDS Clinical Trials Group.: J Acquir Immune Defic Syndr. 1993 Dec;6(12):1322-8. Unique Identifier : AIDSLINE MED/94076128; Cotton DJ; Finkelstein DM; He W; Feinberg J; Department of Medicine, Beth Israel Hospital, Boston,; Massachusetts.; To determine factors influencing the enrollment of women in a large multicenter human immunodeficiency virus (HIV) clinical trials program in the United States , we analyzed enrollment and demographic data of the AIDS Clinical Trials Group (ACTG) during the period 1987-90. Women compris
The use of fine needle aspiration cytology in the management of human immunodeficiency virus-related non-Hodgkin's lymphoma and Hodgkin's disease.: J Acquir Immune Defic Syndr. 1993 Dec;6(12):1329-34. Unique Identifier : AIDSLINE MED/94076129; Strigle SM; Martin SE; Levine AM; Rarick MU; Department of Pathology and Laboratory Medicine, Cedars-Sinai; Medical Center, Los Angeles, CA 90048.; We prospectively studied the utility of fine needle aspiration (FNA) to diagnose non-Hodgkin s lymphoma (NHL) and Hodgkin s disease (HD) in patients with human immunodeficiency virus (HIV) infection and lymphadenopathy. Twenty-one patients with a clinical evidence of lymphoma under
A distinctive cytologic pattern for diagnosing tuberculous lymphadenitis in AIDS.: J Acquir Immune Defic Syndr. 1993 Dec;6(12):1335-8. Unique Identifier : AIDSLINE MED/94076130; Llatjos M; Romeu J; Clotet B; Sirera G; Manterola JM; Pedro-Botet ML; Raventos A; Foz M; Infectious Diseases Unit, Universitat Autonoma de Barcelona,; Hospital de Badalona Germans Trias i Pujol, Catalonia, Spain.; Tuberculous lymphadenitis (TL) is a very common infection in human immunodeficiency virus (HIV)-infected patients. We performed fine-needle aspiration biopsy (FNAB) of enlarged lymph nodes in 57 HIV-infected patients to evaluate its usefulness in this population. We observed three cytologic patterns in 21 patients dia
HIV-1 PCR and isolation in seroconverting and seronegative homosexual men: absence of long-term immunosilent infection.: J Acquir Immune Defic Syndr. 1993 Dec;6(12):1339-46. Unique Identifier : AIDSLINE MED/94076131; Sheppard HW; Busch MP; Louie PH; Madej R; Rodgers GC; Viral and Rickettsial Disease Laboratory, California Department; of Health Services, Berkeley.; The presence of detectable HIV-1 prior to the appearance of HIV-1-specific antibody was assessed in 41 incident infections that occurred during a 6-year prospective cohort study. All available antibody-negative samples (n = 138) and the first antibody positive sample (n = 41) were tested, under code, by the polymerase
Sex acts, sex partners, and sex budgets: implications for risk factor analysis and estimation of HIV transmission probabilities [see comments]: J Acquir Immune Defic Syndr. 1993 Dec;6(12):1347-52. Unique Identifier : AIDSLINE MED/94076132; Blower SM; Boe C; Biomedical and Environmental Health Sciences, School of Public; Health, University of California, Berkeley 94720.; Many epidemiological studies have identified the number of sex partners as a risk factor for the acquisition of HIV, but few studies have identified the number of sex acts as a risk factor. The seeming lack of importance of the number of sex acts as a risk factor has yet to be explained. In this report we conduct an e
Demographic characteristics of retroviral infections (HIV-1, HIV-2, and HTLV-I) among female professional sex workers in Lagos, Nigeria.: J Acquir Immune Defic Syndr. 1993 Dec;6(12):1358-63. Unique Identifier : AIDSLINE MED/94076134; Dada AJ; Oyewole F; Onofowokan R; Nasidi A; Harris B; Levin A; Diamondstone L; Quinn TC; Blattner WA; Research Triangle Institute, Washington, DC.; In 1990/1991, 885 prostitutes residing in 11 of the 12 Local Government Areas (LGAs) of Lagos State, Nigeria , participated in a cross-sectional study to determine current seroprevalence of antibodies to human immunodeficiency virus type 1 (HIV-1) and type 2 (HIV-2), and human T-ce
Effect of differential mortality on risk behavior change in cohort studies.: J Acquir Immune Defic Syndr. 1993 Dec;6(12):1364-7. Unique Identifier : AIDSLINE MED/94076135; Blower SM; van Griensven GJ; Biomedical and Environmental Health Sciences, School of Public; Health, University of California, Berkeley 94720.; Recent theoretical work suggests that reductions in aggregate measures of risk behaviors are to be expected during a human immunodeficiency virus epidemic, because mortality is likely to be differential with respect to the level of the risk behavior. We present and apply a methodology for quantifying the effects of di
First description of endemic HTLV-II infection among Venezuelan Amerindians.: J Acquir Immune Defic Syndr. 1993 Dec;6(12):1368-72. Unique Identifier : AIDSLINE MED/94076136; Echeverria de Perez G; Leon-Ponte M; Noya O; Botto C; Gallo D; Bianco N; Institute of Immunology, Faculty of Medicine, Central University; of Venezuela, Caracas.; We describe for the first time the presence of human T lymphotropic virus type II (HTLV-II) infection in Venezuela , among the Pume Amerindians living in the southern plains of the country. Antibodies to HTLV-II antigens were assessed by enzyme immunoassays (Elisa), Western blot,
HTLV-1 but not HTLV-2 found in pygmies from Central African Republic [letter; comment]: J Acquir Immune Defic Syndr. 1993 Dec;6(12):1373-4. Unique Identifier : AIDSLINE MED/94076137; Gessain A; Herve V; Jeannel D; Garin B; Mathiot C; de-The G
Decreased insulin-like growth factor-I (IGF-I) receptor sites on circulating mononuclear cells from cows with persistent lymphocytosis.: J Recept Res. 1993;13(8):1161-72. Unique Identifier : AIDSLINE MED/94076250; Zhao X; McBride BW; Trouten-Radford L; Lissemore K; Department of Animal and Poultry Science, University of Guelph,; Ontario, Canada.; Plasma IGF-I concentrations and IGF-I receptor binding on mononuclear cells have been studied on bovine leukemia virus (BLV)-negative (CO), BLV-infected aleukemic (AL) cows or cows with persistent lymphocytosis (PL). No significant differences in plasma IGF-I concentrations were demonstrated among the three groups of
Normal fetal outcome in a pregnancy with central nervous system toxoplasmosis and human immunodeficiency virus infection. A case report.: J Reprod Med. 1993 Sep;38(9):747-50. Unique Identifier : AIDSLINE MED/94076272; Hedriana HL; Mitchell JL; Brown GM; Williams SB; Department of Obstetrics and Gynecology, College of Physicians; and Surgeons of Columbia University, Harlem Hospital Center, New; York, New York.; A pregnant woman was diagnosed with central nervous system toxoplasmosis and human immunodeficiency virus infection. Diagnosis was made by evaluating computed tomography scan results and toxoplasma antibody titers. The patient was treated with pyrimethamine and sulfadiazine, with an excellent fetal outcome. She respon
The NEWLEAD program: a new method for the design of candidate structures from pharmacophoric hypotheses.: J Med Chem. 1993 Nov 26;36(24):3863-70. Unique Identifier : AIDSLINE MED/94076288; Tschinke V; Cohen NC; Research Department, Pharmaceuticals Division, CIBA-GEIGY; Limited, Basel, Switzerland.; We have developed a computer program, called NEWLEAD, for the automatic generation of candidate structures conforming to the requirements of a given pharmacophore. The treatment consists in connecting the pharmacophoric pieces with spacers assembled from small chemical entities (atoms, chains, or ring moieties). We ha
Synergism between Tat and VP16 in trans-activation of HIV-1 LTR.: J Mol Biol. 1993 Dec 5;234(3):610-9. Unique Identifier : AIDSLINE MED/94076339; Ghosh S; Selby MJ; Peterlin BM; Howard Hughes Medical Institute, University of California, San; Francisco 94143-0724.; When tethered to heterologous DNA both Tat and VP16 can activate transcription from the HIV-1 LTR. To determine if they act by similar mechanisms, we constructed several hybrid effectors between Tat or VP16 and DNA-binding domains of GAL4 or LexA proteins. We tested these effectors on substituted reporter targets, whi
Human immunodeficiency virus (HIV) infection epidemic: medical and social issues and the unresolved dilemmas [editorial]: J Natl Med Assoc. 1993 Oct;85(10):741-3. Unique Identifier : AIDSLINE MED/94076367; Idemyor V
Activation of the human immunodeficiency virus type 1 long terminal repeat by transforming mutants of human p53.: J Virol. 1994 Jan;68(1):103-10. Unique Identifier : AIDSLINE MED/94076398; Subler MA; Martin DW; Deb S; Department of Microbiology, University of Texas Health Science; Center, San Antonio 78284.; We have studied the effects of human wild-type and mutant p53s on the long terminal repeat (LTR) promoter of human immunodeficiency virus type 1 (HIV). HeLa cells were cotransfected with a wild-type or mutant p53 expression plasmid and a plasmid containing a chloramphenicol acetyltransferase reporter gene under HIV LT
Phenotypic characterization of insertion mutants of the human immunodeficiency virus type 1 Gag precursor expressed in recombinant baculovirus-infected cells.: J Virol. 1994 Jan;68(1):111-22. Unique Identifier : AIDSLINE MED/94076399; Chazal N; Carriere C; Gay B; Boulanger P; Laboratoire de Virologie and Pathogenese Moleculaires (CNRS; URA 1487), Faculte de Medecine, Institut de Biologie,; Montpellier, France.; A panel of 28 insertion mutants of the human immunodeficiency virus type 1 (HIV-1) Gag precursor (Pr55Gag) was constructed by linker-insertion mutagenesis and expressed in recombinant baculovirus-infected insect cells. One set of 14 mutants carried the normal N-myristylation signal; the other set constituted their non
Regulation of JC virus expression in B lymphocytes.: J Virol. 1994 Jan;68(1):217-22. Unique Identifier : AIDSLINE MED/94076410; Rieckmann P; Michel U; Kehrl JH; Department of Psychiatry, University of Gottingen, Germany.; The etiologic agent of progressive multifocal leukoencephalopathy, a subacute demyelinating disease of the central nervous system, is the human polyomavirus JC virus (JCV), which causes a lytic infection of myelin-producing oligodendrocytes. In infected individuals the JCV genome can be detected in brain tissue and B
Electron microscopy of the nucleocapsid from disrupted Moloney murine leukemia virus and of associated type VI collagen-like filaments.: J Virol. 1994 Jan;68(1):223-32. Unique Identifier : AIDSLINE MED/94076411; Pager J; Coulaud D; Delain E; Laboratoire de Microscopie Cellulaire et Moleculaire, URA 147 du; Centre National de la Recherche Scientifique, Institut Gustave; Roussy, Villejuif, France.; To analyze the constituents of retroviruses, the Moloney murine leukemia virus was disrupted and observed by dark-field electron microscopy. Virus disruption was achieved by several methods: osmotic shock, freezing-thawing cycles, and exposure to urea up to 4 M, to NaCl up to 1 M, and to Triton X-100. Several componen
Generation and characterization of a human immunodeficiency virus type 1 (HIV-1) mutant resistant to an HIV-1 protease inhibitor.: J Virol. 1994 Jan;68(1):233-9. Unique Identifier : AIDSLINE MED/94076412; el-Farrash MA; Kuroda MJ; Kitazaki T; Masuda T; Kato K; Hatanaka M; Harada S; Department of Biodefence and Medical Virology, Kumamoto; University School of Medicine, Japan.; A synthetic peptide, RPI 312, that specifically inhibits the protease of the human immunodeficiency virus type 1 (HIV-1) showed a potent inhibition on virus production, maturation, and infectivity. Treatment with this agent prevented the cleavage of Gag protein at the site between p17 and p24 in HIV-1 chronically infe
Proteolytic activity of novel human immunodeficiency virus type 1 proteinase proteins from a precursor with a blocking mutation at the N terminus of the PR domain.: J Virol. 1994 Jan;68(1):240-50. Unique Identifier : AIDSLINE MED/94076413; Zybarth G; Krausslich HG; Partin K; Carter C; Department of Microbiology, State University of New York at Stony; Brook 11794.; The mature human immunodeficiency virus type 1 proteinase (PR; 11 kDa) can cleave all interdomain junctions in the Gag and Gag-Pol polyprotein precursors. To determine the activity of the enzyme in its precursor form, we blocked release of mature PR from a truncated Gag-Pol polyprotein by introducing mutations into th
Inhibition of human immunodeficiency virus type 1 Tat-dependent activation of translation in Xenopus oocytes by the benzodiazepine Ro24-7429 requires trans-activation response element loop sequences.: J Virol. 1994 Jan;68(1):25-33. Unique Identifier : AIDSLINE MED/94076414; Braddock M; Cannon P; Muckenthaler M; Kingsman AJ; Kingsman SM; Department of Biochemistry, University of Oxford, United Kingdom.; Two benzodiazepine compounds, [7-chloro-5-(2-pyrryl)-3H-1,4 benzodiazapin-2-(H)-one] (Ro5-3335) and [7-chloro-5-(1H-pyrrol-2-yl)-3H-benzo[e] [1,4] diazepin-2-yl]- methylamine (Ro24-7429), inhibit human immunodeficiency virus type 1 (HIV-1) replication via a specific effect on the function of the transactivator protein
Differential role of long terminal repeat control elements for the regulation of basal and Tat-mediated transcription of the human immunodeficiency virus in stimulated and unstimulated primary human macrophages.: J Virol. 1994 Jan;68(1):298-307. Unique Identifier : AIDSLINE MED/94076420; Moses AV; Ibanez C; Gaynor R; Ghazal P; Nelson JA; Department of Microbiology and Immunology, Oregon Health Sciences; University, Portland 97201.; Primary human macrophages induced to differentiate through contact with autologous activated nonadherent cells were used to investigate the transcriptional mechanisms involved in reactivation of human immunodeficiency virus (HIV) replication. Through transient transfection experiments with an HIV long terminal repeat
Persistence of four related human immunodeficiency virus subtypes during the course of zidovudine therapy: relationship between virion RNA and proviral DNA.: J Virol. 1994 Jan;68(1):425-32. Unique Identifier : AIDSLINE MED/94076434; Zhang YM; Dawson SC; Landsman D; Lane HC; Salzman NP; Laboratory of Molecular Retrovirology, Georgetown University; School of Medicine, Washington, D.C. 20007.; Human immunodeficiency virus (HIV) virion RNA and proviral DNA sequences have been examined over a 1-year period in an HIV-seropositive patient, commencing with the start of zidovudine treatment. By characterizing the variable V3 and V4 env domains, four related but structurally discrete genotypes could be identified
Human immunodeficiency virus type 1 envelope glycoprotein is modified by O-linked oligosaccharides.: J Virol. 1994 Jan;68(1):463-8. Unique Identifier : AIDSLINE MED/94076439; Bernstein HB; Tucker SP; Hunter E; Schutzbach JS; Compans RW; Department of Microbiology, University of Alabama at Birmingham; 35294.; The human immunodeficiency virus type 1 (HIV-1) envelope glycoprotein has been shown to be extensively modified by N-linked glycosylation; however, the presence of O-linked carbohydrates on the glycoprotein has not been firmly established. We have found that enzymatic deglycosylation of the HIV-1 envelope glycoprotein
Identification of an 80-kilodalton membrane glycoprotein important for human T-cell leukemia virus type I and type II syncytium formation and infection.: J Virol. 1994 Jan;68(1):485-93. Unique Identifier : AIDSLINE MED/94076442; Agadjanyan MG; Ugen KE; Wang B; Williams WV; Weiner DB; Department of Medicine, University of Pennsylvania, Philadelphia; 19104.; Human T-cell leukemia virus type I and type II (HTLV-I and HTLV-II, respectively) infect certain sublines of the BJAB human B-cell line. We observed that the WH subline, but not the CC/84 subline, of BJAB cells were infectible by cell-free HTLV-I or HTLV-II and formed syncytia with cells infected by these retroviruses
Passage through mitosis is required for oncoretroviruses but not for the human immunodeficiency virus.: J Virol. 1994 Jan;68(1):510-6. Unique Identifier : AIDSLINE MED/94076446; Lewis PF; Emerman M; Department of Pediatrics, University of Washington, Seattle.; The human immunodeficiency virus productively infects and integrates into cells that have been arrested in the cell cycle with either gamma irradiation or aphidicolin. Integration by oncoretroviruses such as the murine leukemia virus (MuLV), on the other hand, depends on cell proliferation. Although the entire cell cy
Restriction and enhancement of human immunodeficiency virus type 1 replication by modulation of intracellular deoxynucleoside triphosphate pools.: J Virol. 1994 Jan;68(1):535-40. Unique Identifier : AIDSLINE MED/94076451; Meyerhans A; Vartanian JP; Hultgren C; Plikat U; Karlsson A; Wang L; Eriksson S; Wain-Hobson S; Abteilung Virologie, Universitat Freiburg, Germany.; Human immunodeficiency virus type 1 (HIV-1) replication is shown to be sensitive to the intracellular concentration of deoxynucleoside triphosphate substrates. Addition of thymidine to established cell lines resulted in a dramatic reduction of virus production. The effect could be substantially alleviated by addition
Involvement of transcription factor YB-1 in human T-cell lymphotropic virus type I basal gene expression.: J Virol. 1994 Jan;68(1):561-5. Unique Identifier : AIDSLINE MED/94076456; Kashanchi F; Duvall JF; Dittmer J; Mireskandari A; Reid RL; Gitlin SD; Brady JN; Laboratory of Molecular Virology, National Institutes of Health,; Bethesda, Maryland 20892.; Sequences which control basal human T-cell lymphotropic virus type I (HTLV-I) transcription likely play an important role in initiation and maintenance of virus replication. We previously identified and analyzed a 45-nucleotide sequence (downstream regulatory element 1 [DRE 1]), +195 to +240, at the boundary of the R/
Mutations in the membrane-spanning domain of the human immunodeficiency virus envelope glycoprotein that affect fusion activity.: J Virol. 1994 Jan;68(1):570-4. Unique Identifier : AIDSLINE MED/94076458; Owens RJ; Burke C; Rose JK; Department of Pathology, Yale University School of Medicine, New; Haven, Connecticut 06510.; A chimeric protein consisting of the human immunodeficiency virus type 1 (HIV-1) envelope protein (Env) ectodomain joined to the transmembrane and cytoplasmic-tail domains of vesicular stomatitis virus G protein lost the ability to fuse CD4+ HeLa cells yet was transported to the cell surface and cleaved normally. Thes
Use of random systematic mutagenesis to generate viable human rhinovirus 14 chimeras displaying human immunodeficiency virus type 1 V3 loop sequences.: J Virol. 1994 Jan;68(1):575-9. Unique Identifier : AIDSLINE MED/94076459; Smith AD; Resnick DA; Zhang A; Geisler SC; Arnold E; Arnold GF; Center for Advanced Biotechnology, Rutgers University,; Piscataway, New Jersey 08854.; Random systematic mutagenesis was used to generate a library of human rhinovirus 14 chimeras that each display a segment from the V3 loop of human immunodeficiency virus type 1. The sequence XXIGPGRAXX, where X could be any of the 20 amino acids, was inserted at the neutralizing immunogenic site II of human rhinovirus
Temporal patterns of human immunodeficiency virus type 1 transcripts in human fetal astrocytes.: J Virol. 1994 Jan;68(1):93-102. Unique Identifier : AIDSLINE MED/94076466; Tornatore C; Meyers K; Atwood W; Conant K; Major E; Laboratory of Molecular Medicine and Neuroscience, National; Institute of Neurological Disorders and Stroke, Bethesda,; Maryland 20892.; Human immunodeficiency virus type 1 (HIV-1) infection of the developing central nervous system results in a dementing process in children, termed HIV-1-associated encephalopathy. Infection of astroglial elements of the pediatric nervous system has been demonstrated and suggests that direct infection of some astrocytes
A piece of my mind. Joshua knew.: JAMA. 1993 Dec 22-29;270(24):2902. Unique Identifier : AIDSLINE MED/94076533; Clark LR
Effect of recombinant human erythropoietin administration on immunological indices in patients undergoing chronic hemodialysis.: Nippon Jinzo Gakkai Shi. 1993 Aug;35(8):981-8. Unique Identifier : AIDSLINE MED/94076722; Yorioka N; Hamaguchi N; Takasugi N; Shigemoto K; Harada S; Fujiwara K; Ishida A; Maeda T; Kawai A; Yamakido M; Second Department of Internal Medicine, Hiroshima University; School of Medicine, Japan.; In patients undergoing chronic hemodialysis, marked anemia may cause decreased immunological function. To improve this anemia, we investigated the effect on immunological indices of recombinant human erythropoietin (rHuEPO) administration in 24 hemodialysis patients (13 males and 11 females) with renal anemia complica
Influence of bromocriptine administration to mothers on the development of pup thymocyte and splenocyte subsets and on mitogen-induced proliferation in the mouse.: Life Sci. 1993;53(26):1981-94. Unique Identifier : AIDSLINE MED/94077002; Gala RR; Shevach EM; Department of Physiology, Wayne State University School of; Medicine, Detroit, MI 48201.; The influence of prolactin (PRL) on the development of the immune system in the mouse was studied by injecting mothers with bromocriptine (CB-154) to produce hypoprolactinemic milk. Alterations in pup thymocyte and splenocyte cell subsets were observed to graded doses of CB-154 administered to mothers. There was an in
[The relationship between work and vision in a preventive medicine context: the initial guidelines for a correct ergonomic ophthalmological approach proposed by the Italian Group for the Study of the Relationships between Work and Vision (G.I.L.V.). I. The presentation (published erratum appears in Med Lav 1993 Nov-Dec;84(6):504)]: Med Lav. 1993 Jul-Aug;84(4):311-23. Unique Identifier : AIDSLINE MED/94077122; Modern technology poses numerous and complex problems concerning the implications for health in the work/vision relationship. While many of the hypotheses made in the past about the possibility of serious eye alterations in non-industrial workers have not been confirmed by recent investigations, considerable attention
[Reiter's syndrome. Apropos a pediatric case]: Minerva Pediatr. 1993 Jul-Aug;45(7-8):299-302. Unique Identifier : AIDSLINE MED/94077129; Ceccarelli M; Chiaravalloti G; Assanta N; Balsano L; Rossi A; Clinica Pediatrica, Universita degli Studi di Pisa.; The authors report the case of a 13-year-old girl affected with urethritis, conjunctivitis, and oligoarticular arthritis. These symptoms represent the classical triad of Fiessinger-Leroy-Reiter s syndrome. The research for HIV was negative and the antigen HLA B27 was absent. The young patients has been treated by FANS
New-style abuse of press freedom [editorial]: Nature. 1993 Dec 9;366(6455):493-4. Unique Identifier : AIDSLINE MED/94077158
Montagnier's AIDS report covers all angles [news]: Nature. 1993 Dec 9;366(6455):497. Unique Identifier : AIDSLINE MED/94077162; Butler D
A dose of molecular medicine [news]: Nature. 1993 Dec 9;366(6455):505. Unique Identifier : AIDSLINE MED/94077168; Short N
AIDS in rural North Carolina.: N C Med J. 1993 Oct;54(10):517-22. Unique Identifier : AIDSLINE MED/94077195; Rumley RL; Esinhart JD; Department of Medicine, East Carolina University School of; Medicine, Greenville, NC 27858.
Mitosis and apoptosis of microglia in vivo induced by an anti-CR3 antibody which crosses the blood-brain barrier.: Neuroscience. 1993 Oct;56(3):529-33. Unique Identifier : AIDSLINE MED/94077331; Reid DM; Perry VH; Andersson PB; Gordon S; Sir William Dunn School of Pathology, University of Oxford, U.K.; Microglia, the resident tissue macrophages of the central nervous system, have a highly differentiated morphology and do not express many of the antigens typically associated with other tissue macrophages. Activation of microglia is associated with a change in morphology and an increase in their repertoire of antigen
Expanded AIDS case definition increases Pennsylvania's reported AIDS cases.: Pa Med. 1993 Oct;96(10):36-8. Unique Identifier : AIDSLINE MED/94077540; Jones BR; Division of Epidemiology, Pennsylvania Department of Health,; Harrisburg.; At the beginning of 1993, the Centers for Disease Control and Prevention adopted an expanded case definition of AIDS and a revision of the classification system for HIV infection for persons ages 13 years or older. This article explains the changes and their effects, defines the new system categories, and offers resou
[Sideroses of alveolar macrophages. Analysis of a continuous series of 360 bronchoalveolar lavages]: Pathol Biol (Paris). 1993 Sep;41(7):604-9. Unique Identifier : AIDSLINE MED/94077551; Moumouni H; Lamotte F; Anthonioz P; Laboratoire de Pathologie Cellulaire, CHR Bretonneau, Tours,; France.; 360 consecutive bronchoalveolar lavage fluids (BAL) were studied using semi-quantitative method described by GOLDE (GOLDE score). 44 hemosiderosis were detected (12%). Most of them corresponded to massive alveolar hemorrhage (AH). Depending on pathological contexts, we distinguished three main groups of AH frequency:
Aspergillosis in children with acquired immune deficiency.: Pediatr Radiol. 1993;23(6):492-4. Unique Identifier : AIDSLINE MED/94077607; Wright M; Fikrig S; Haller JO; Department of Pediatrics, State University of New York, Health; Sciences Center at Brooklyn 11203.; Two children are presented with AIDS and aspergillosis. One child had pulmonary involvement while the other had invasion of the skull and brain. The rarity of aspergillosis in AIDS patients is discussed as well.
Decreased superoxide anion and hydrogen peroxide production by neutrophils and monocytes in human immunodeficiency virus-infected children and adults.: Pediatr Res. 1993 Oct;34(4):544-50. Unique Identifier : AIDSLINE MED/94077633; Chen TP; Roberts RL; Wu KG; Ank BJ; Stiehm ER; Department of Pediatrics, UCLA School of Medicine 90024.; The higher susceptibility to serious bacterial infections of patients, particularly children, infected with the human immunodeficiency virus (HIV) may be due in part to defective function of their phagocytic cells. We examined the ability of polymorphonuclear cells and monocytes of HIV-infected children and adults to
In vivo selection of randomly mutated retroviral genomes.: Nucleic Acids Res. 1993 Nov 11;21(22):5020-4. Unique Identifier : AIDSLINE MED/94077700; Berkhout B; Klaver B; Department of Virology, University of Amsterdam, The Netherlands.; Darwinian evolution, that is the outgrowth of the fittest variants in a population, usually applies to living organisms over long periods of time. Recently, in vitro selection/amplification techniques have been developed that allow for the rapid evolution of functionally active nucleic acids from a pool of randomized
Novel internal promoter/enhancer of HTLV-I for Tax expression.: Nucleic Acids Res. 1993 Nov 11;21(22):5124-9. Unique Identifier : AIDSLINE MED/94077714; Nosaka T; Ariumi Y; Sakurai M; Takeuchi R; Hatanaka M; Institute for Virus Research, Kyoto University, Japan.; The transcription initiation signals in retroviruses lie within the long terminal repeat (LTR) sequences. We have found a new transcriptional promoter in a central portion of the genome of human T-cell leukaemia virus type I (HTLV-I). The transcription start site is located just upstream to the ATG codon of the transc
Oncogene activation of HIV-LTR-driven expression via the NF-kappa B binding sites.: Nucleic Acids Res. 1993 Nov 11;21(22):5229-34. Unique Identifier : AIDSLINE MED/94077729; Bruder JT; Heidecker G; Tan TH; Weske JC; Derse D; Rapp UR; Viral Pathology Section, NCI-Frederick Cancer Research and; Development Center, MD 21702-1201.; The Raf-1 proto-oncogene product is a highly regulated serine/threonine kinase that functions in signal transduction downstream from growth factor receptors and upstream from nuclear proto-oncogene products. Using a transient cotransfection assay we have found that activated Raf-1 activates expression from the HIV-LTR
Inhibition of HIV-1 replication by ribozymes that show poor activity in vitro.: Nucleic Acids Res. 1993 Nov 11;21(22):5251-5. Unique Identifier : AIDSLINE MED/94077732; Crisell P; Thompson S; James W; Sir William Dunn School of Pathology, University of Oxford, UK.; Self-cleaving RNAs (ribozymes) can be engineered to cleave target RNAs of choice in a sequence-specific manner (1). Consequently, they could be used to inhibit virus replication or to analyse host gene function in vivo. However, ribozymes that are catalytic in vitro are generally disappointing when analysed in cells u
Role of the general pediatrician in the management of human immunodeficiency virus infection in children.: Pediatr Rev. 1993 Oct;14(10):371-9. Unique Identifier : AIDSLINE MED/94077783; Rand TH; Meyers A; Children's Hospital, Boston, MA.
Women and HIV infection.: Practitioner. 1993 Sep;237(1530):659-63. Unique Identifier : AIDSLINE MED/94077829; Bury J; Spittal Street Centre, Edinburgh.
Investigations of the cellular immunity during depression and the free interval: evidence for an immune activation in affective psychosis.: Prog Neuropsychopharmacol Biol Psychiatry. 1993 Sep;17(5):713-30. Unique Identifier : AIDSLINE MED/94077973; Muller N; Hofschuster E; Ackenheil M; Mempel W; Eckstein R; Psychiatric Hospital, University of Munich, Germany.; 1. Results of investigations of the immune function in affective disorders are conflicting. Some authors described an immune suppression, others an immune activation in major depression. The authors performed a study of cellular immunity in the MDD subtype endogenous depression. 23 patients suffering from endogenous d
[Tuberculosis in 1991. A hospital based study]: Rev Clin Esp. 1993 Oct;193(5):225-8. Unique Identifier : AIDSLINE MED/94078001; Garcia Paez JM; Daza R; Ramos A; Millan I; Unidad de Salud Laboral, Clinica Puerta de Hierro, Madrid.; A retrospective clinical, epidemiological study was carried out with the 53 cases of tuberculosis diagnosed in our center during 1991. The incidence rate was 4.4 per 1,000 clinical histories. Fifteen patients (28.3%) were HIV+, and five were marginalized illegal immigrants (9.4%). Seventy-three percent of the HIV+ pat
[Hypoglycemia secondary to intravenous pentamidine treatment without subsequent diabetes mellitus (letter)]: Rev Clin Esp. 1993 Oct;193(5):273-4. Unique Identifier : AIDSLINE MED/94078013; Moreno I; Gonzalo MA; Fernandez Guerrero M; Herrera-Pombo JL
[Mercury pulmonary embolism after voluntary injection]: Rev Mal Respir. 1993;10(5):477-9. Unique Identifier : AIDSLINE MED/94078050; Urban T; Chouaid C; Febvre M; Roussard P; Housset B; Lebeau B; Service de Pneumologie, Hopital Saint-Antoine, Paris.; We describe a case of pulmonary emboli due to mercury in a female drug addict who was HIV positive and had voluntarily injected herself with mercury. The diagnosis was guided by the history and by the characteristics of the chest radiograph and was confirmed by blood and urine levels of mercury and the radiograph take
[Psychiatry and drug addiction in Geneva]: Rev Med Suisse Romande. 1993 Oct;113(10):851-2. Unique Identifier : AIDSLINE MED/94078087; del Rio M; Division pour toxicodependants des IUPG, Geneve.
[Autoimmune and collagen disease manifestations in HIV infection or AIDS]: Ryumachi. 1993 Oct;33(5):437-44. Unique Identifier : AIDSLINE MED/94078200; Kimura M
Drug resistant tuberculosis: problems on the horizon [editorial]: Thorax. 1993 Oct;48(10):957-8. Unique Identifier : AIDSLINE MED/94078285; Ormerod LP
Correction of glutathione deficiency in the lower respiratory tract of HIV seropositive individuals by glutathione aerosol treatment.: Thorax. 1993 Oct;48(10):985-9. Unique Identifier : AIDSLINE MED/94078290; Holroyd KJ; Buhl R; Borok Z; Roum JH; Bokser AD; Grimes GJ; Czerski D; Cantin AM; Crystal RG; Pulmonary Branch, National Heart, Lung, and Blood Institute,; National Institutes of Health, Bethesda, Maryland 20892.; BACKGROUND--Concentrations of glutathione, a ubiquitous tripeptide with immune enhancing and antioxidant properties, are decreased in the blood and lung epithelial lining fluid of human immunodeficiency virus (HIV) seropositive individuals. Since the lung is the most common site of infection in those who progress to A
Isolation of mycobacteria from patients seropositive for the human immunodeficiency virus (HIV) in south east England: 1984-92.: Thorax. 1993 Oct;48(10):990-5. Unique Identifier : AIDSLINE MED/94078291; Yates MD; Pozniak A; Grange JM; Public Health Laboratory Service, South East Regional; Tuberculosis Centre, Dulwich Hospital, London.; BACKGROUND--Tuberculosis and other mycobacterial infections are well recognised complications of HIV infection and surveillance is thus required. METHODS--All mycobacteria isolated from HIV positive subjects and referred to the Public Health Laboratory Service South East Regional Tuberculosis Centre (SERTC) from the f
Histologically atypical Pneumocystis carinii pneumonia.: Thorax. 1993 Oct;48(10):996-1001. Unique Identifier : AIDSLINE MED/94078292; Foley NM; Griffiths MH; Miller RF; Department of Medicine, University College London Medical School,; Middlesex Hospital.; BACKGROUND--Infection with Pneumocystis carinii typically results in a pneumonia which histologically is seen to consist of an eosinophilic foamy alveolar exudate associated with a mild plasma cell interstitial infiltrate. Special stains show that cysts of P carinii lie within the alveolar exudate. Atypical histologic
Concentric membranous bodies and giant mitochondria in hepatocytes from a patient with AIDS.: Ultrastruct Pathol. 1993 Sep-Oct;17(5):557-63. Unique Identifier : AIDSLINE MED/94078346; Shapiro SH; Klavins JV; Queens Hospital Center, Department of Laboratories, Jamaica, New; York 11432.; The cytoplasm of hepatocytes in a liver biopsy from a patient with acquired immunodeficiency syndrome (AIDS) treated with sulfamethazole-trimethoprim contained concentric membranous bodies (CMB) and giant mitochondria. By light microscopy the general architecture of the liver was unaltered. By electron microscopy one
Delayed hypersensitivity testing as a clinical measure of cell-mediated immunity in the cat.: Vet Immunol Immunopathol. 1993 Sep;38(1-2):91-102. Unique Identifier : AIDSLINE MED/94078568; Otto CM; Brown CA; Lindl PA; Dawe DL; Department of Small Animal Medicine, College of Veterinary; Medicine, University of Georgia, Athens 30602.; The purposes of this study were to examine the cell-mediated immune response of the normal cat to the modified live feline viral rhinitis, calicivirus, and parvovirus (FVRCP) vaccine (Felocell CVR, Norden, Lincoln, NE), and to evaluate the intradermal skin test as a clinical measure of the immune response of cats. Vac
Expression and immunogenicity of the V3 loop from the envelope of human immunodeficiency virus type 1 in an attenuated aroA strain of Salmonella typhimurium upon genetic coupling to two Escherichia coli carrier proteins.: Vaccine. 1993 Sep;11(12):1221-8. Unique Identifier : AIDSLINE MED/94078652; Charbit A; Martineau P; Ronco J; Leclerc C; Lo-Man R; Michel V; O'Callaghan D; Hofnung M; Programmation Moleculaire et Toxicologie Genetique (CNRS URA; 1444), Institut Pasteur, Paris, France.; A peptide comprising residues glu293 to ser334 from the principal neutralization determinant (V3 loop) of the envelope of human immunodeficiency virus type 1 (HIV1 LAVBRU isolate) has been inserted within internal permissive sites of either LamB or MalE, two envelope proteins from Escherichia coli K12. The MalE hybrid
Expression of human immunodeficiency virus type 1 Nef antigen on the surface of acutely and persistently infected human T cells.: Vaccine. 1993 Sep;11(12):1240-6. Unique Identifier : AIDSLINE MED/94078655; Fujii Y; Nishino Y; Nakaya T; Tokunaga K; Ikuta K; Institute for Laboratory Animal Research, Nagoya University; School of Medicine, Japan.; The authors have previously shown the role of human immunodeficiency virus type 1 (HIV-1) Nef protein as a growth inhibitor to CD4+ T lymphocytes. We now report that the Nef antigen is partly expressed on both acutely and persistently infected human T cells. To investigate the cell surface expression of the Nef antige
Do endogenous retroviruses have etiological implications in inflammatory and degenerative nervous system diseases?: Acta Neurol Scand. 1993 Sep;88(3):190-8. Unique Identifier : AIDSLINE MED/94078708; Rasmussen HB; Perron H; Clausen J; Institute of Life Sciences and Chemistry, Roskilde University,; Denmark.; Vertebrates carry large numbers of endogenous retroviruses (ERVs) and related sequences in their genomes. These retroviral elements are inherited as Mendelian traits. Generally, ERVs are defective without the ability of being expressed as viral particles. However, ERV sequences often have a potential for expression of
Possible association of HTLV-I infection and dementia.: Acta Neurol Scand. 1993 Sep;88(3):199-203. Unique Identifier : AIDSLINE MED/94078709; Lycke J; Svennerholm B; Svenningsson A; Horal P; Nordqvist-Brandt E; Andersen O; Dept of Neurology, University of Gothenburg, Sahlgren's Hospital,; Sweden.; We report a Swedish patient with progressive dementia possibly associated with human T cell-lymphotropic virus type I (HTLV-I) infection. The clinical investigation revealed no typical sings of other neurological disorders. The patient was probably infected in East-Asia 35 years be
Rapid detection of cytomegalovirus structures in cerebrospinal fluid and brain biopsies by polymerase chain reaction.: Acta Neurol Scand. 1993 Sep;88(3):236-8. Unique Identifier : AIDSLINE MED/94078719; Rolfs A; Department of Neurology, Klinikum Steglitz, Free University of; Berlin, Germany.; The joint application of stereotactic brain biopsy and DNA amplification methods, like the polymerase chain reaction (PCR) are diagnostic purposes that allows in approximately 24 h to clarify the viral etiology of central nervous system infections. We demonstrate PCR results from the brain biopsy of an HIV-1 patient w
[Bronchoalveolar lavage (BAL) in the diagnosis of pulmonary infections in immunocompromised children]: Acta Otorhinolaryngol Ital. 1993 Mar-Apr;13(2):131-6. Unique Identifier : AIDSLINE MED/94078772; Bottero S; Pierro V; Tieri L; Marsella P; Bianchi PM; Partipilo P; Caniglia M; Divisione di ORL, Ospedale Pediatrico Bambino Gesu, Roma.; The authors report their personal case records of broncho-alveolar lavage in immuno-compromised children. 22 children were observed from 1991 to 1992 at the E.N.T. Department of the Bambino Gesu Hospital, National Research Institute, in Rome. Flexible bronchoscopy is used under both local and general anesthesia withou
Bacterial pneumonia in adult populations with human immunodeficiency virus (HIV) infection [see comments]: Am J Epidemiol. 1993 Dec 1;138(11):909-22. Unique Identifier : AIDSLINE MED/94078957; Caiaffa WT; Graham NM; Vlahov D; Department of Epidemiology, Johns Hopkins University School of; Hygiene and Public Health, Baltimore, MD 21205.; Recurrent bacterial pneumonia was recently added to the definition of the acquired immunodeficiency syndrome (AIDS), based on the observation that bacterial pneumonia rates have been increased in human immunodeficiency virus (HIV)-infected persons and are indicative of immunosuppression in this population. Nonetheless
President picks Kristine Gebbie as the nation's first AIDS czar [news]: Am J Nurs. 1993 Aug;93(8):69, 73. Unique Identifier : AIDSLINE MED/94079024
Looking for angels.: Am J Nurs. 1993 Aug;93(8):80. Unique Identifier : AIDSLINE MED/94079026; MacInnis K; W.A. Foote Memorial Hospital, Jackson, MI.
Psychological interventions to prevent HIV infection are urgently needed. New priorities for behavioral research in the second decade of AIDS.: Am Psychol. 1993 Oct;48(10):1023-34. Unique Identifier : AIDSLINE MED/94079068; Kelly JA; Murphy DA; Sikkema KJ; Kalichman SC; Department of Psychiatry and Mental Health Sciences, Medical; College of Wisconsin, Milwaukee 53226.; Behavior change remains the only means for primary prevention of HIV disease. Psychology should take a leading role in efforts to curtail the epidemic, but has not contributed to HIV prevention at a level proportionate to the urgency of the crisis. The authors propose an updated agenda for behavioral research on AIDS-
Substance use and risky sexual behavior for exposure to HIV. Issues in methodology, interpretation, and prevention.: Am Psychol. 1993 Oct;48(10):1035-45. Unique Identifier : AIDSLINE MED/94079069; Leigh BC; Stall R; Alcohol and Drug Abuse Institute, University of Washington,; Seattle 98105.; Recent reports have suggested that the use of alcohol or drugs is related to sexual behavior that is high risk for HIV infection. If substance use leads to unsafe sexual activity, understanding the dynamics of this relationship can contribute to research and preventive and educational efforts to contain the spread of
Respiratory illness in persons with human immunodeficiency virus infection. The Pulmonary Complications of HIV Infection Study Group.: Am Rev Respir Dis. 1993 Dec;148(6 Pt 1):1523-9. Unique Identifier : AIDSLINE MED/94079089; Wallace JM; Rao AV; Glassroth J; Hansen NI; Rosen MJ; Arakaki C; Kvale PA; Reichman LB; Hopewell PC; University of California, Los Angeles.; Although the pulmonary complications of advanced human immunodeficiency virus (HIV) infection have been well described, there is little information on respiratory manifestations of earlier disease. This report describes the respiratory disorders diagnosed over an 18-month period in a cohort of persons with or at risk
Tuberculosis control policies in major metropolitan health departments in the United States. V. Standard of practice in 1992.: Am Rev Respir Dis. 1993 Dec;148(6 Pt 1):1530-6. Unique Identifier : AIDSLINE MED/94079090; Leff DR; Leff AR; Center for Urban Affairs and Policy Research, Northwestern; University, Evanston, Illinois.; Since 1978, we have surveyed the 28 metropolitan health departments initially reporting > 250 cases of tuberculosis/yr to determine the standard of practice in the control of pulmonary tuberculosis and the factors affecting treatment policy. In this survey, results were compared with data obtained in 1978, 1980, 1984,
Early bactericidal and sterilizing activities of ciprofloxacin in pulmonary tuberculosis [see comments]: Am Rev Respir Dis. 1993 Dec;148(6 Pt 1):1547-51. Unique Identifier : AIDSLINE MED/94079093; Kennedy N; Fox R; Kisyombe GM; Saruni AO; Uiso LO; Ramsay AR; Ngowi FI; Gillespie SH; University Division of Communicable Diseases, Royal Free Hospital; School of Medicine, London, United Kingdom.; The early bactericidal and sterilizing activities of ciprofloxacin were evaluated in the treatment of adult patients with smear positive pulmonary tuberculosis. Two randomized prospective studies were performed in Northern Tanzania . In study 1, ten patients received either 750 mg
Serum type III procollagen peptide in patients with Pneumocystis carinii infection. The Copenhagen-Amsterdam PCP-Prednisolone Study Group.: Am Rev Respir Dis. 1993 Dec;148(6 Pt 1):1558-62. Unique Identifier : AIDSLINE MED/94079095; Bentsen KD; Nielsen TL; Eaftinck Schattenkerk JK; Jensen BN; Lundgren JD; Department of Infectious Diseases and of Rheumatology, Hvidovre; Hospital, The Netherlands.; Inflammation may play a central role in the pathogenesis of HIV-related Pneumocystis carinii pneumonia (PCP). Serum levels of the amino-terminal propeptide of Type III procollagen (PIIINP) reflect inflammatory activity in granulation tissue and in chronic rheumatic and liver disorders. To investigate changes in PIIINP
Upper and middle lobe bronchoalveolar lavage to diagnose Pneumocystis carinii pneumonia [see comments]: Am Rev Respir Dis. 1993 Dec;148(6 Pt 1):1563-6. Unique Identifier : AIDSLINE MED/94079096; Yung RC; Weinacker AB; Steiger DJ; Miller TR; Stern EJ; Salmon CJ; Chernoff DN; Luistro MG; Kuntz S; Golden JA; Department of Medicine, University of California at San Francisco; 94143-0854.; Pneumocystis carinii pneumonia (PCP) remains the most common lethal opportunistic pulmonary infection in patients infected with the human immunodeficiency virus (HIV). Although the use of prophylactic inhaled pentamidine has effectively reduced the frequency of primary and recurrent episodes of PCP, the aerosolization
[Chronic encephalopathy in patients with sex-linked agammaglobulinemia]: An Esp Pediatr. 1993 Oct;39(4):289-95. Unique Identifier : AIDSLINE MED/94079151; Macaya Ruiz A; Roig Quilis M; Rodriguez Galindo C; Olesti Marco M; Castellote Alonso A; Bertran Sanges JM; Espanol Boren T; Servicio de Pediatria, Hospital Materno-Infantil Vall d'Hebron,; Universidad Autonoma de Barcelona.; The clinical and neuroradiological findings of two patients with X-linked agammaglobulinemia, who developed a chronic encephalopathy, are presented. The main neurological manifestations in both patients were: progressive spastic tetraparesis, cortico-subcortical type of dementia an
[Tuberculosis: a present reality]: An Esp Pediatr. 1993 Oct;39(4):317-9. Unique Identifier : AIDSLINE MED/94079157; de la Vega Santamaria A; Rabadan Saiz B; Sanchez Palacin A; Garcia Guzman P; Candela Mas S; Garcia Garcia MC; Perez Rocha J; Rubio Villanueva JL; Servicio de Pediatria, Hospital Nino Jesus, Madrid.; Some of the causes which may account for the high incidence of tuberculosis in children in our environment have been analyzed. Twelve cases of tuberculosis have been included in the study (seven pulmonary cases, two cases of bone tuberculosis, one nodosum erythema and one miliary tuberculosis in an HIV positive patien
[Congenital toxoplasmosis in a newborn infant with AIDS]: An Esp Pediatr. 1993 Oct;39(4):349-50. Unique Identifier : AIDSLINE MED/94079165; Escribano Subias J; Bilbao Sustacha J; Balaguer Santamaria A; Bofarull Bosch JM; Servicio de Pediatria, Hospital de Sant Joan de Reus, Tarragona.
Clinical and epidemiologic characteristics of Mycobacterium haemophilum, an emerging pathogen in immunocompromised patients.: Ann Intern Med. 1994 Jan 15;120(2):118-25. Unique Identifier : AIDSLINE MED/94079175; Straus WL; Ostroff SM; Jernigan DB; Kiehn TE; Sordillo EM; Armstrong D; Boone N; Schneider N; Kilburn JO; Silcox VA; et al; Division of Bacterial and Mycotic Diseases, Centers for Disease; Control and Prevention, Atlanta, GA 30333.; OBJECTIVE: To describe 13 infections caused by Mycobacterium haemophilum. DESIGN: Identification of patients by microbiologic record review, followed by medical record review and a case-control study. SETTING: Seven metropolitan hospitals in New York. PATIENTS: All patients with M. haemophilum infections diagnosed bet
[High predictive value of straightened hair for HIV infection in the adult population of Central Africa]: Ann Dermatol Venereol. 1993;120(5):395-6. Unique Identifier : AIDSLINE MED/94079246; Saraux A; Taelman H; Batungwanayo J; Guillet G; Service de Medecine Interne, Centre Hospitalier de Kigali,; Rwanda.
CGP 53437, an orally bioavailable inhibitor of human immunodeficiency virus type 1 protease with potent antiviral activity.: Antimicrob Agents Chemother. 1993 Oct;37(10):2087-92. Unique Identifier : AIDSLINE MED/94079351; Alteri E; Bold G; Cozens R; Faessler A; Klimkait T; Lang M; Lazdins J; Poncioni B; Roesel JL; Schneider P; et al; Oncology and Virology Research Department, Ciba-Geigy Limited,; Basel, Switzerland.; CGP 53437 is a peptidomimetic inhibitor of human immunodeficiency virus type 1 (HIV-1) protease containing a hydroxyethylene isostere. The compound inhibited recombinant HIV-1 protease with a Ki of 0.2 nM. The inhibition constant versus human cathepsin D and human cathepsin E was 4 nM. Human pepsin and gastricsin were
Effects of standard breakfast on pharmacokinetics of oral zidovudine in patients with AIDS.: Antimicrob Agents Chemother. 1993 Oct;37(10):2153-8. Unique Identifier : AIDSLINE MED/94079361; Ruhnke M; Bauer FE; Seifert M; Trautmann M; Hille H; Koeppe P; Department of Medicine, Universitatsklinikum Rudolf; Virchow-Charlottenburg, Freir Universitat Berlin, Germany.; The influence of a standard breakfast on the single-dose pharmacokinetics of zidovudine ( AZT ) after oral administration of 100 and 250 mg of AZT was studied in 27 subjects with advanced human immunodeficiency virus infection (Centers for Disease Contr
Pharmacokinetics and bioavailability of fluconazole in patients with AIDS.: Antimicrob Agents Chemother. 1993 Oct;37(10):2187-92. Unique Identifier : AIDSLINE MED/94079366; DeMuria D; Forrest A; Rich J; Scavone JM; Cohen LG; Kazanjian PH; Clinical Pharmacokinetics Laboratory, Millard Fillmore Hospital,; Buffalo, New York 14209.; Fluconazole pharmacokinetics were evaluated for 10 volunteers with AIDS who had no clinical evidence of gastroenteritis. Single 100-mg intravenous (i.v.) and oral (p.o.) doses were administered in a randomized, crossover design. i.v. doses were delivered by a constant-rate infusion over 30 min. Serum fluconazole conce
Discrepancies in bioassay and chromatography determinations explained by metabolism of itraconazole to hydroxyitraconazole: studies of interpatient variations in concentrations.: Antimicrob Agents Chemother. 1993 Oct;37(10):2224-7. Unique Identifier : AIDSLINE MED/94079372; Hostetler JS; Heykants J; Clemons KV; Woestenborghs R; Hanson LH; Stevens DA; Department of Medicine, Santa Clara Valley Medical Center, San; Jose, California.; Pharmacologic studies of itraconazole (IZ), a triazole antifungal, indicated unexplained differences between bioassay and chromatographic determinations and large variations in steady-state blood concentrations. We show that concentrations of a hydroxylated metabolite, hydroxyitraconazole (HIZ), are approximately twof
Metabolism and in vitro antiretroviral activities of bis(pivaloyloxymethyl) prodrugs of acyclic nucleoside phosphonates.: Antimicrob Agents Chemother. 1993 Oct;37(10):2247-50. Unique Identifier : AIDSLINE MED/94079379; Srinivas RV; Robbins BL; Connelly MC; Gong YF; Bischofberger N; Fridland A; Department of Infectious Diseases, St. Jude Children's Research; Hospital, Memphis, Tennessee.; Bis(pivaloyloxymethyl) [bis(pom)] derivatives of various acyclic nucleoside phosphonates--9-(2-phosphonylmethoxyethyl)adenine (PMEA), 9-(2-phosphonylmethoxypropyl)adenine (PMPA), and 9-(2-phosphonylmethoxypropyl)diaminopurine (PMPDAP)--were found to exhibit 9- to 23-fold greater antiviral activity than their correspon
States continue to wrestle with HIV/AIDS issues.: AORN J. 1993 Nov;58(5):1033-6. Unique Identifier : AIDSLINE MED/94079383
Circulating T cell subtypes in polymyalgia rheumatica and giant cell arteritis: variation in the percentage of CD8+ cells with prednisolone treatment [see comments]: Ann Rheum Dis. 1993 Oct;52(10):730-3. Unique Identifier : AIDSLINE MED/94079438; Pountain GD; Keogan MT; Brown DL; Hazleman BL; Rheumatology Research Unit, Addenbrooke's Hospital, Cambridge,; United Kingdom.; OBJECTIVES--Some reports have described a decreased percentage of circulating CD8+ cells in patients with polymyalgia rheumatica and giant cell arteritis (PMR/GCA) before treatment and persisting for some months during treatment with corticosteroids. Other studies have found no such changes. There are overt methodolog
Predicting the outcomes of human immunodeficiency virus infection. How well are we doing [see comments]: Arch Intern Med. 1993 Dec 27;153(24):2749-55. Unique Identifier : AIDSLINE MED/94079489; Rabeneck L; Wray NP; Department of Medicine, Baylor College of Medicine, Veterans; Affairs Medical Center, Houston, TX.; An important determinant of patient outcomes is illness severity, which must be classified to guide clinical decision making and evaluate the effectiveness of diagnostic and therapeutic interventions. Currently, no widely accepted framework for grading illness severity in human immunodeficiency virus-infected patients
Human immunodeficiency virus-associated motor axonal polyradiculoneuropathy.: Arch Neurol. 1993 Dec;50(12):1316-9. Unique Identifier : AIDSLINE MED/94079556; Goldstein JM; Azizi SA; Booss J; Vollmer TL; Department of Neurology, Yale University School of Medicine, New; Haven, Conn.; OBJECTIVE: To report two cases of an axonal motor polyradiculoneuropathy associated with human immunodeficiency virus infection in otherwise asymptomatic subjects. DESIGN: Case series. SETTING: Tertiary care hospital neurology inpatient service. RESULTS: Electrophysiologic testing showed acute denervation with almost
Lower motor neuron dysfunction associated with human immunodeficiency virus infection.: Arch Neurol. 1993 Dec;50(12):1328-30. Unique Identifier : AIDSLINE MED/94079558; Huang PP; Chin R; Song S; Lasoff S; Department of Neurology, Bellevue Hospital, University Medical; Center, New York, NY.; OBJECTIVE: The association of human immunodeficiency virus with a clinical picture of motor neuron disease is uncommon, with three cases reported to date. This case represents an additional case of a human immunodeficiency virus-infected patient with apparent motor neuron disease. DESIGN: Single patient case report. S
Knowledge of AIDS transmission, risk behavior, and perceptions of risk among urban, low-income, African-American and Hispanic youth.: Am J Prev Med. 1993 Sep-Oct;9(5):297-306. Unique Identifier : AIDSLINE MED/94079788; Ford K; Norris AE; Department of Population Planning and International Health,; School of Public Health, University of Michigan, Ann Arbor; 48109-2029.; Low-income, urban, African-American and Hispanic youth have been identified as a group that may be at risk for the spread of human immunodeficiency virus (HIV). This article evaluates general knowledge of acquired immunodeficiency syndrome (AIDS), knowledge of routes of sexual transmission of HIV, risk behaviors relat
Preventing HIV transmission: behavior and attitudes of medical house staff in a high-prevalence area.: Am J Prev Med. 1993 Sep-Oct;9(5):307-16. Unique Identifier : AIDSLINE MED/94079789; Wheat ME; Hyman RB; Devons C; Solomon S; Department of Medicine, Montefiore Medical Center, Bronx, NY.; Our objective was to evaluate human immunodeficiency virus (HIV) risk-factor assessment and counseling behavior in 86 medical house staff and to ascertain the effect of question format (closed versus open) on reported physician behaviors. We designed a cross-sectional survey using a self-report questionnaire; we recei
Limitations of AIDS reporting under favorable circumstances.: Am J Prev Med. 1993 Sep-Oct;9(5):317-20. Unique Identifier : AIDSLINE MED/94079790; Fife D; MacGregor RR; McAnaney J; AIDS Epidemiology Unit, Philadelphia Department of Public Health,; PA.; To assess completeness of acquired immunodeficiency syndrome (AIDS) reporting by a consortium of Philadelphia physicians, we compared the consortium s patient data base to AIDS case reports received by the Philadelphia Department of Public Health (PDPH). Several circumstances favored better than ordinary reporting. Co
Activation of the human immunodeficiency virus type 1 long terminal repeat by BTEB, a GC box-binding transcription factor.: AIDS Res Hum Retroviruses. 1993 Sep;9(9):825-31. Unique Identifier : AIDSLINE MED/94079807; Imataka H; Mizuno A; Fujii-Kuriyama Y; Hayami M; Institute for Virus Research, Kyoto University, Japan.; BTEB, a GC box-binding transcription factor, was tested for its ability to activate the human immunodeficiency virus type 1 long terminal repeat (HIV-1 LTR). An electrophoretic mobility shift assay demonstrated specific binding of BTEB to GC boxes of the HIV-1 LTR. When a BTEB expression vector was cotransfected into
Human immunodeficiency virus type 2 (HIV-2) trans-activator (Tat): functional domains and the search for trans-dominant negative mutants.: AIDS Res Hum Retroviruses. 1993 Sep;9(9):839-48. Unique Identifier : AIDSLINE MED/94079809; Arya SK; Laboratory of Tumor Cell Biology, National Cancer Institute,; National Institutes of Health, Bethesda, Maryland 20892.; Human immunodeficiency virus type 2 (HIV-2) trans-activator (Tat) is an important trans-regulator of viral gene expression. It differs from the related HIV-1 Tat in certain aspects of its structure and function. HIV-2 Tat is composed of 130 amino acids versus 86 amino acids for HIV-1 Tat. Apart from certain conserved
Molecular cloning, expression, and biological characterization of an HTLV-II envelope glycoprotein: HIV-1 expression is permissive for HTLV-II-induced cell fusion.: AIDS Res Hum Retroviruses. 1993 Sep;9(9):849-60. Unique Identifier : AIDSLINE MED/94079810; Wang B; Agadjanyan MG; Srikantan V; Ugen KE; Hall W; Kaplan MH; Dang K; Williams WV; Weiner DB; Institute of Biotechnology and Advanced Molecular Medicine,; Philadelphia, Pennsylvania 19104.; The human T cell leukemia virus II (HTLV-II) is a type C retrovirus closely related to the human transforming retrovirus HTLV-I. In contrast to HTLV-I, the role of HTLV-II in human disease is controversial. However, HTLV-II infection has been documented in several cases of a clinically benign hairy cell leukemia and h
A quantitative assay for trans-activation by HIV-1 Tat, using liposome-mediated DNA uptake and a parallel ELISA system.: AIDS Res Hum Retroviruses. 1993 Sep;9(9):861-7. Unique Identifier : AIDSLINE MED/94079811; Watson ME; Moore M; Xenova Limited, Slough, Berkshire, England.; A cellular assay is described in which transient high-level expression of a heterologous reporter gene (chloramphenicol acetyltransferase, CAT) driven by the HIV LTR is used to determine trans-activation in a cell line constitutively expressing Tat. The use of a parallel ELISA system to determine effects on expression
Neutralization of HIV-1 and inhibition of HIV-1-induced syncytia by 1,8-naphthalimide photoactive compound.: AIDS Res Hum Retroviruses. 1993 Sep;9(9):891-6. Unique Identifier : AIDSLINE MED/94079815; Chanh TC; Lewis DE; Allan JS; Sogandares-Bernal F; Judy MM; Utecht RE; Matthews JL; Department of Virology and Immunology, Southwest Foundation for; Biomedical Research, San Antonio, Texas 78228.; The antiviral property of a newly designed class of 1,8-naphthalimide photochemical compounds was investigated. One such photoactive compound, 1,14-bis-(N-hexyl-3 -bromo-1,8 -naphthalimide-4 -yl)-1,4,11,14- tetraazatetradecane-5,10-dione (diED66Br), when activated to an excited state by visible light (420 nm), effecti
The effect of age on the course of experimental feline immunodeficiency virus infection in cats.: AIDS Res Hum Retroviruses. 1993 Sep;9(9):897-905. Unique Identifier : AIDSLINE MED/94079816; George JW; Pedersen NC; Higgins J; Department of Medicine, School of Veterinary Medicine, University; of California, Davis 95616.; Neonatal, young adult, and aged specific pathogen-free cats were experimentally infected with cat-passaged Petaluma strain of feline immunodeficiency virus. The primary stage of illness occurred 6-8 weeks following infection in cats of all ages, but it differed in severity and clinical signs. Generalized lymphadenopat
Dynamics of maternal IgG antibody decay and HIV-specific antibody synthesis in infants born to seropositive mothers. The NYC Perinatal HIV Transmission Study Group.: AIDS Res Hum Retroviruses. 1993 Sep;9(9):907-12. Unique Identifier : AIDSLINE MED/94079817; Parekh BS; Shaffer N; Coughlin R; Hung CH; Krasinski K; Abrams E; Bamji M; Thomas P; Hutson D; Schochetman G; et al; Division of HIV/AIDS, Centers for Disease Control and Prevention,; Atlanta, Georgia 30330.; We have used a human immunodeficiency virus type 1 (HIV-1)-specific IgG-Fc capture enzyme immunoassay (IgG-CEIA) to elucidate the dynamics of HIV-1 maternal antibody decay and de novo synthesis of HIV-1 antibodies in infants. Two hundred and thirty-nine serum specimens from 77 infants were analyzed by the IgG-CEIA and
A new subtype of HIV-1 gag sequence detected in Taiwan.: AIDS Res Hum Retroviruses. 1993 Sep;9(9):925-7. Unique Identifier : AIDSLINE GENBANK/L23104; Guo HG; Reitz MS; Gallo RC; Ko YC; Chang KS; Laboratory of Tumor Cell Biology, National Cancer Institute, NIH,; Bethesda, Maryland 20892.
Confidentiality--at any price? [see comments]: Br Dent J. 1993 Nov 20;175(10):350-1. Unique Identifier : AIDSLINE MED/94079820; Osborn BR; Confidentiality is a well respected and integral part of medical and dental practice and not without good reason. So fundamental is it to medicine in all its aspects, and so entrenched in the attitudes of those of us in the health care field, that it is never questioned. All patients are individuals in their own right
Multi-focal oral non-Hodgkin's lymphoma in an AIDS patient.: Br Dent J. 1993 Nov 20;175(10):373-7. Unique Identifier : AIDSLINE MED/94079828; Dodd CL; Greenspan D; Heinic GS; Rabanus JP; Greenspan JS; Department of Stomatology, University of California San Francisco; 94143-0512.; Cases of non-Hodgkin s lymphoma (NHL) occurring in immunosuppressed patients, including those who are infected with the human immunodeficiency virus, may develop in areas other than the lymph nodes. In AIDS-associated NHL, about 5% of cases of extranodal NHL are intra-oral. This ca
Can HIV be transmitted from dental personnel to patients by dentistry?: Br Dent J. 1993 Nov 20;175(10):381-2. Unique Identifier : AIDSLINE MED/94079830; Scully C; Porter SR; Centre for the Study of Oral Disease, University of Bristol; Dental School.; Over 19,000 patients treated by 57 HIV-infected health care workers (HCWs) have been tested for HIV. Apart from the notorious Florida dental case, no patient has been shown to be infected by treatment given by an HIV-infected HCW. Cases of 10 HIV-infected HCWs have been examined in some depth. The evidence indicates t
Transmission of HIV in a dental practice--the facts.: Br Dent J. 1993 Nov 20;175(10):383-4. Unique Identifier : AIDSLINE MED/94079831; Robinson P; Challacombe S; Department of Oral Medicine and Pathology, UMDS.; There is compelling evidence that six patients of a Florida dentist were infected with HIV at the dental practice. The strain of HIV in the dentist and patients was virtually identical. There is no evidence that either lapses in infection control or deliberate attempts to infect patients were responsible for this clus
Saliva and HIV.: Br Dent J. 1993 Nov 20;175(10):389. Unique Identifier : AIDSLINE MED/94079833
Solution structure of a conserved DNA sequence from the HIV-1 genome: restrained molecular dynamics simulation with distance and torsion angle restraints derived from two-dimensional NMR spectra.: Biochemistry. 1993 Dec 14;32(49):13419-31. Unique Identifier : AIDSLINE MED/94079873; Mujeeb A; Kerwin SM; Kenyon GL; James TL; Department of Pharmaceutical Chemistry, University of California,; San Francisco 94143-0446.; The three-dimensional solution structure of a trisdecamer DNA duplex sequence, d(AGCTTGCCTTGAG).d(CTCAAGGCAAGCT), from a conserved region of HIV-1 genome s long terminal repeat, has been investigated using NMR spectroscopy and restrained molecular dynamics calculations. Interproton distances derived from two-dimension
[Treatment of 60 cases of HIV-infected patients with glyke]: Chung Kuo Chung Hsi I Chieh Ho Tsa Chih. 1993 Jun;13(6):340-2, 324. Unique Identifier : AIDSLINE MED/94080085; Lu WB; China Academy of TCM, Beijing.; 60 HIV-infected patients were treated with Glyke, a Chinese materia medica, 40 mg, 3 times daily x 3-6 months were given. The total effective rate was 35%. The effective + unchanged rate of immune function was 68.3-90%. 18-64% of patients improved in clinical symptoms. PCR assay was checked in one of the two seronegat
Cost effectiveness analysis of early zidovudine treatment of HIV infected patients.: BMJ. 1993 Nov 20;307(6915):1322-5. Unique Identifier : AIDSLINE MED/94080137; Oddone EZ; Cowper P; Hamilton JD; Matchar DB; Hartigan P; Samsa G; Simberkoff M; Feussner JR; Center for Health Services Research in Primary Care, Veterans; Affairs Medical Center, Durham, NC 27705.; OBJECTIVE--To compare cost effectiveness of early and later treatment with zidovudine for patients infected with HIV. DESIGN--Markov chain analysis of cost effectiveness based on results of use of health care and efficacy from a trial of zidovudine treatment. SETTING--Seven Veterans Affairs medical centres in the
Simian viruses, organ xenotransplantation and a hypothesis about the origin of AIDS.: Braz J Med Biol Res. 1993 Mar;26(3):231-3. Unique Identifier : AIDSLINE MED/94080180; Mendes NF; Disciplina de Imunologia, Escola Paulista de Medicina, Sao; Paulo, Brasil.
Which patients should receive lung transplants?: Monaldi Arch Chest Dis. 1993 Aug;48(4):346-52. Unique Identifier : AIDSLINE MED/94080239; Madden BP; Geddes DM; Royal Brompton National Heart & Lung, Hospital, London, UK.; Lung transplantation is a therapeutic option for selected patients with end-stage respiratory failure from a variety of pulmonary vascular and parenchymal lung diseases. Early problems due to ischaemic dehiscence of the bronchial anastomosis were avoided with heart-lung transplantation where the coronary bronchial col
Evidence for human immunodeficiency virus infection of the lung.: Monaldi Arch Chest Dis. 1993 Aug;48(4):360-5. Unique Identifier : AIDSLINE MED/94080241; Clarke JR; Mitchell D; Dept of Medical Microbiology, St Mary's Hospital Medical School,; London, UK.; Pulmonary disease is a frequent manifestation in the terminal stages of acquired immune deficiency syndrome (AIDS), and is caused mainly by a number of opportunistic microorganisms, most commonly Pneumocystis carinii. Despite the extensive involvement of the lung in the pathogenesis of AIDS, until recently little was
Spontaneous pneumothorax in patients with the human immunodeficiency virus: study of eight cases.: Eur J Med. 1993 Jan;2(1):19-22. Unique Identifier : AIDSLINE MED/94080380; Valencia ME; Languna F; Moreno V; Martinez ML; Adrados M; Gonzalez Lahoz J; Service of Infectious Diseases, National Center of Clinical; Investigation and Preventive Medicine, Madrid, Spain.; OBJECTIVE: To evaluate the risk factors and the natural history of spontaneous pneumothorax in patients with human immunodeficiency virus infection (HIV). METHODS: We studied eight HIV infected patients with spontaneous pneumothorax. Variables assessed included sex, age, risk factor for HIV infection, use of Pneumocys
HIV-related demyelinating disease.: Eur J Med. 1993 Feb;2(2):89-96. Unique Identifier : AIDSLINE MED/94080406; Gray F; Lescs MC; Service d'Anatomie Pathologique et de Medecine Legale,; Neuropathologie, Hopital Raymond Poincare, Garches, France.; True demyelination, or at least a leukoencephalopathy with predominant involvement of myelin, may occur in many neurological complications of human immunodeficiency virus (HIV)-infection, resulting from various mechanisms which are not all well understood. These include lesions directly related to infection of the ner
HIV serosurvey in pregnant women in Uganda [letter]: Eur J Med. 1993 Aug-Sep;2(7):444-5. Unique Identifier : AIDSLINE MED/94080423; Reggiori A; Adreata M; Cocozza E; Ravera M; Ciantia F; Mukasa F
Free and decomplexed human immunodeficiency virus p24 antigenaemia in black patients with AIDS and AIDS-related disorders.: Eur J Med. 1993 Oct-Nov;2(8):478-83. Unique Identifier : AIDSLINE MED/94080433; Belec L; Matta M; Di Costanzo B; Dragon MA; Gresenguet G; Mbopi Keou FX; Payan C; Service de Microbiologie (Virologie), Hopital Broussais, Paris,; France.; OBJECTIVES: To determine the clinical signification of free and decomplexed p24 antigenaemia in HIV1-infected black individuals. PATIENTS AND METHODS: Sixty African patients with pre-AIDS (n = 12) and AIDS (n = 48), hospitalized in the Centre National Hospitalier Universitaire de Bangui,
Direct isotopic assessment of aerosolized pentamidine deposition: influence of nebuliser.: Eur J Med. 1993 Oct-Nov;2(8):484-8. Unique Identifier : AIDSLINE MED/94080434; Diot P; Le Pape A; Becquemin MH; Besnier JM; Boissinot E; Bastides F; Benjemaa M; Choutet P; Lemarie E; Departement des Maladies Respiratoires, CHU Bretonneau, Tours,; France.; OBJECTIVES: The aim of the present study was to compare the efficiency of pulmonary deposition of pentamidine using the Respirgard II jet nebuliser or the Fison ultrasonic nebuliser with 99m technetium (99m Tc) labelled pentamidine in the current conditions of recommended treatment. The study was designed in three sta
Pulmonary Mycobacterium avium intracellulare with transient CD4+ T-lymphocytopenia without HIV infection [letter]: Eur J Med. 1993 Oct-Nov;2(8):509-10. Unique Identifier : AIDSLINE MED/94080444; Cathebras PJ; Bouchou K; Rousset H
Reduction of HIV transmission during laparoscopic procedures [editorial; comment]: Surg Laparosc Endosc. 1993 Feb;3(1):1. Unique Identifier : AIDSLINE MED/94080575; Fry DE
Reduction of HIV transmission during laparoscopic procedures [see comments]: Surg Laparosc Endosc. 1993 Feb;3(1):2-5. Unique Identifier : AIDSLINE MED/94080578; Eubanks S; Newman L; Lucas G; Department of General Surgery, Georgia Baptist Medical Center,; Atlanta 30312.; Laparoscopic surgery has recently been encouraged as an alternative to open procedures in patients infected with the human immunodeficiency virus (HIV). The laparoscopic technique reduces exposure to blood products and sharp instruments; however, it exposes the surgical team to the HIV-infected patient in a manner not
IL2-R alpha chain inhibitory factor (p29) produced by HIV-infected macrophages: cell target and mode of action.: Cell Immunol. 1993 Dec;152(2):358-70. Unique Identifier : AIDSLINE MED/94080666; Ammar A; Bertoli AM; Chouaib S; Clemenceau C; Jasmin C; Georgoulias V; Oncogenese Appliquee, INSERM U268, Hopital Paul Brousse,; Villejuif, France.; We recently reported that HIV-infected adherent cells spontaneously produce a 29-kDa protein (p29), most probably of nonviral origin, which inhibits expression of the IL2R alpha chain on activated normal T cells. Studying the mode of action of this molecule, we observed that monocyte depletion of normal PBMC either by
Mannoprotein-induced anti-U937 cell cytotoxicity in peripheral blood mononuclear cells from uninfected or HIV-infected subjects: role of interferon-gamma and tumor necrosis factor-alpha.: Cell Immunol. 1993 Dec;152(2):530-43. Unique Identifier : AIDSLINE MED/94080679; Gomez MJ; Torosantucci A; Quinti I; Testa U; Peschle C; Cassone A; Laboratories of Bacteriology and Medical Mycology, Istituto; Superiore di Sanita, Rome, Italy.; A mannoprotein fraction (MP-F2: mannan, > 90%; protein, 4.5%) from the human commensal microorganism Candida albicans was as efficient as interleukin-2 ( IL-2 ) in generating cytotoxicity against the uninfected or human immunodeficiency virus type-1 (HIV-1) persistently
Radiological and pathological features of AIDS-related polypoid cholangitis [published erratum appears in Clin Radiol 1994 Feb;49(2):146]: Clin Radiol. 1993 Nov;48(5):307-10. Unique Identifier : AIDSLINE MED/94080752; Collins CD; Forbes A; Harcourt-Webster JN; Francis ND; Gleeson JA; Gazzard BG; Department of Radiology, Chelsea and Westminster Hospital,; London.; A review of the radiographs obtained at ERCP from 31 patients with AIDS-related sclerosing cholangitis (ARSC) demonstrated intraluminal polypoidal defects within the common bile duct and larger intrahepatic ducts in eight cases (26%). The radiological features from this subgroup are described and correlated with the m
Isolated sternoclavicular joint arthritis in heroin addicts and/or HIV positive patients: three cases.: Clin Rheumatol. 1993 Sep;12(3):422-5. Unique Identifier : AIDSLINE MED/94080784; Covelli M; Lapadula G; Pipitone N; Numo R; Pipitone V; Institute of Rheumatology, University of Bari, Italy.; The authors describe three patients in whom septic arthritis of the sternoclavicular joint (SCJ) occurred, drug addiction and human immunodeficiency virus (HIV) infection representing the predisposing conditions. Infectious arthritis is well known in intravenous drug users, but it is rare in HIV positive patients, who
Sepsis-bacteraemia and other infections due to non-opportunistic bacterial pathogens in a consecutive series of 788 patients hospitalized for HIV infection.: Clin Ter. 1993 Oct;143(4):279-90. Unique Identifier : AIDSLINE MED/94080798; Manfredi R; Costigliola P; Ricchi E; Chiodo F; Istituto di Malattie Infettive, Universita degli Studi di; Bologna.; A retrospective study was carried out to evaluate the incidence, etiology and role of non-opportunistic bacterial infections in a series of 788 consecutive HIV-infected patients hospitalized during the last 7 years; 71.9% of patients were i.v. drug addicts, 15.6% homo-bisexual men, 7.4% heterosexuals, 2.7% haemophilia
Antigen-independent adhesion of CD4 CD45RA T cells from cord blood.: Eur J Immunol. 1993 Dec;23(12):3136-40. Unique Identifier : AIDSLINE MED/94080874; Buzyn-Veil A; Hivroz C; Lecomte O; Barbat C; Mazerolles F; Fischer A; INSERM U 132, Hopital Necker-Enfants Malades, Paris, France.; Antigen-independent adhesion of resting adult CD4+ CD45RO+ T cells to B lymphocytes has been shown to be transient and can be down-regulated by CD4 major histocompatibility complex (MHC) class II molecule interactions. Conversely, adhesion of adult CD4+ CD45RA+ subpopulation to B cells is not regulated by ligands of C
Bacterial optic disk mass and toxoplasmic-like encephalitis in an HIV-seropositive subject.: Graefes Arch Clin Exp Ophthalmol. 1993 Nov;231(11):668-71. Unique Identifier : AIDSLINE MED/94080963; Mansour AM; Ansari NH; Egwuagu CE; Kaspar HG; Harmon MK; Department of Ophthalmology, University of Texas Medical Branch,; Galveston 77555-0787.
[Phylogenetically old HIV-1 from Cameroon discovered. HIV-2 related virus isolate]: Fortschr Med. 1993 Oct 20;111(29):18-20. Unique Identifier : AIDSLINE MED/94080978; Gurtler L; Max von Pettenkofer-Institut, Munchen.
[Status of therapy of HIV infections. A long way to standardized procedure]: Fortschr Med. 1993 Oct 30;111(30):25-6. Unique Identifier : AIDSLINE MED/94080985; Gurtler L; Max-v.-Pettenkofer-Institut f. Hygiene und Med. Mikrobiologie,; Universitat Munchen.
Transcriptional activation of the interleukin-6 gene by HTLV-1 p40tax through an NF-kappa B-like binding site.: Immunol Lett. 1993 Aug;37(2-3):159-65. Unique Identifier : AIDSLINE MED/94081029; Muraoka O; Kaisho T; Tanabe M; Hirano T; Division of Molecular Oncology, Osaka University Medical School,; Japan.; The interleukin-6 (IL-6) gene is expressed by various stimuli including cytokines or viral infections, such as human T-cell leukemia virus type I (HTLV-1). However, it has not been well established how HTLV-1 induces the expression of the IL-6 gene. In the present study, we demonstrated that HTLV-1-derived transactiva
Perturbation of in vitro HIV pathogenic effects by peptides showing sequence similarities with the C2 conserved domain of gp120 [letter]: Immunol Lett. 1993 Aug;37(2-3):249-50. Unique Identifier : AIDSLINE MED/94081041; Lafont V; Nicolas M; Dornand J; Liautard JP; Favero J
A feline model of ocular toxoplasmosis.: Invest Ophthalmol Vis Sci. 1993 Dec;34(13):3653-60. Unique Identifier : AIDSLINE MED/94081106; Davidson MG; Lappin MR; English RV; Tompkins MB; Department of Companion Animal and Special Species Medicine,; College of Veterinary Medicine, North Carolina State University,; Raleigh 27606.; PURPOSE. This study was performed to characterize the clinical, serologic, histopathologic, and immunohistochemical features of an experimental model of ocular toxoplasmosis in cats. METHODS: Seven specific pathogen-free cats were inoculated in the right carotid artery with 5 x 10(3) tachyzoites of the ME49 strain of
Making risk meaningful: developing caring relationships with AIDS patients.: J Adv Nurs. 1993 Sep;18(9):1377-85. Unique Identifier : AIDSLINE MED/94081209; Reutter LI; Northcott HC; Faculty of Nursing, University of Alberta, Edmonton, Canada.; A qualitative study was conducted in order to understand how nurses cope with the risk of contagion while providing care to persons with AIDS (PWAs). Data were collected through in-depth interviews with 13 nurses who had cared for PWAs in an acute-care hospital in a western Canadian city. The data were analysed using
Rapid, sensitive and efficient HPLC assays for HIV-1 proteinase.: J Biochem Biophys Methods. 1993 Oct;27(3):191-7. Unique Identifier : AIDSLINE MED/94081256; Betageri R; Hopkins JL; Thibeault D; Emmanuel MJ; Chow GC; Skoog MT; de Dreu P; Cohen KA; Boehringer Ingelheim Pharmaceuticals Inc., Ridgefield, CT; 06877-0368.; The proteinase encoded by human immunodeficiency virus type 1 (HIV-1) cleaves peptide substrates of sequences derived from processing sites in HIV-1 gag-pol polypeptide. Based on this cleavage, assays that utilize HPLC to measure activity of HIV-1 proteinase are reported herein. In the assay first described, a baselin
Unexpected expansions of CD8-bearing cells in old mice.: J Immunol. 1993 Dec 15;151(12):6657-69. Unique Identifier : AIDSLINE MED/94081316; Callahan JE; Kappler JW; Marrack P; Department of Biochemistry, University of Colorado, Denver 80262.; As mice age, spontaneous changes occur in the receptor repertoire of their T cells. The receptor repertoire of CD4+ T cells does not change with age. By contrast, however, the percentage of alpha beta+, CD8+ T cells bearing particular V elements varies considerably between individual aged mice, although it is remarkab
Polymorphism in BoLA-DRB3 exon 2 correlates with resistance to persistent lymphocytosis caused by bovine leukemia virus.: J Immunol. 1993 Dec 15;151(12):6977-85. Unique Identifier : AIDSLINE GENBANK/M94928; Xu A; van Eijk MJ; Park C; Lewin HA; Department of Animal Sciences, University of Illinois at; Urbana-Champaign 61801.; The relationship between polymorphism of the bovine lymphocyte Ag (BoLA)-DRB3 gene and resistance and susceptibility to persistent lymphocytosis (PL) caused by bovine leukemia virus (BLV) was investigated. Exon 2 of the BoLA-DRB3 gene was cloned from animals with BoLA haplotypes previously found to be associated with
Entangled epidemics: cocaine use and HIV disease.: J Psychoactive Drugs. 1993 Jul-Sep;25(3):207-21. Unique Identifier : AIDSLINE MED/94081424; Larrat EP; Zierler S; Department of Community Health, Brown University, School of; Medicine, Kingston, Rhode Island.; Over the past decade, two epidemics have had a severe impact on public health in this country. These health problems involve cocaine abuse and AIDS (or HIV disease). The processes of these two conditions are clearly not independent of each other and may be quite complex. Understanding of this relationship has been ham
Decline in HIV-1 seroprevalence and low seroconversion rate among injecting drug users at a methadone maintenance program in New York City.: J Psychoactive Drugs. 1993 Jul-Sep;25(3):245-50. Unique Identifier : AIDSLINE MED/94081427; Siddiqui NS; Brown LS Jr; Meyer TJ; Gonzalez V; Division of Medical Services, Evaluation and Research, Addiction; Research and Treatment Corporation, Brooklyn, New York 11201.; To monitor the trend of HIV-1 seroprevalence, 2,194 newly admitted injecting drug users (IDUs) in a methadone maintenance program in New York City were tested from June 1988 through June 1992. This was a blinded study and unlabeled blood specimens were collected during the required physical examination. There was a si
Delivery of oral health care through the Ryan White CARE Act to people infected with HIV.: J Public Health Dent. 1993 Fall;53(4):258-64. Unique Identifier : AIDSLINE MED/94081455; Schneider DA; Hardwick KS; Marconi KM; Niemcryk SJ; Bowen GS; Agency for Health Care Policy and Research, Executive Office; Center, Rockville, MD 20852-4908.; The Ryan White Comprehensive AIDS Resources Emergency (CARE) Act of 1990 was passed by Congress to improve the quality and availability of care for individuals and families with HIV disease. The act targets those individuals infected with HIV who lack financial resources to pay for care. While provision of oral health
Glucosidase inhibitors: structures of deoxynojirimycin and castanospermine.: J Med Chem. 1993 Dec 10;36(25):4082-6. Unique Identifier : AIDSLINE MED/94081498; Hempel A; Camerman N; Mastropaolo D; Camerman A; Biochemistry Department, University of Toronto, Canada.; High-resolution structures of the glucosidase inhibitors deoxynojirimycin (dNM) and castanospermine (CAST) have been determined by X-ray diffraction. The crystal parameters are a = 10.751(3) and 8.788(3) A, b = 9.263(3) and 8.172(3) A, c = 7.719(2) and 6.507(2) A, and space group P2(1)2(1)2(1) and P2(1) for dNM and CA
HIV-specific T-helper activity in seronegative health care workers exposed to contaminated blood.: JAMA. 1994 Jan 5;271(1):42-6. Unique Identifier : AIDSLINE MED/94081557; Clerici M; Levin JM; Kessler HA; Harris A; Berzofsky JA; Landay AL; Shearer GM; National Cancer Institute, National Institutes of Health,; Experimental Immunology Branch, Bethesda, MD 20892.; OBJECTIVE--To evaluate human immunodeficiency virus (HIV) type 1-specific cellular immune responses in HIV-seronegative health care workers with occupational high-risk exposures to HIV-infected (HIV-positive) patients. DESIGN--Peripheral blood mononuclear cells (PBMCs) were obtained after occupational exposures to HIV
Isolated homonymous lateral hemianopsia revealing central nervous system toxoplasmosis as the initial manifestation of AIDS.: Metab Pediatr Syst Ophthalmol. 1993;16(1-2):15-8. Unique Identifier : AIDSLINE MED/94081766; Orefice G; Creti A; Bonadies G; Tullio-Cataldo P; Rubino S; Institute of Neurology, Second Medical School, Federico II; University, Naples, Italy.; A 25-year-old-healthy man, with previous history of parenteral drug abuse, developed a left homonymous hemianopsia. Computed tomographic scanning showed a single ring enhancing lesion in the right parieto-occipital area. After the demonstration of seropositivity for human immunodeficiency virus and high serum immunogl
HIV glycoprotein as a superantigen. A mechanism of autoimmunity and implications for a vaccination strategy.: Med Hypotheses. 1993 Sep;41(3):247-50. Unique Identifier : AIDSLINE MED/94081787; Weber GF; Cantor H; Department of Pathology, Harvard Medical School, Dana-Farber; Cancer Institute, Boston, MA 02115.; The pathogenic effects of HIV may reflect mimicry of several key immunological molecules. The surface glycoprotein of HIV has superantigenic properties responsible for the sequential deletion of T-cell clones. In addition, the glycoprotein has several regions sharing homology with class II MHC products. It can elicit
Improper infection-control practices during employee vaccination programs--District of Columbia and Pennsylvania, 1993.: MMWR Morb Mortal Wkly Rep. 1993 Dec 24;42(50):969-71. Unique Identifier : AIDSLINE MED/94081815; The improper use of needles and syringes and contamination of multidose medication vials can result in transmission of bloodborne pathogens (e.g., hepatitis B virus [HBV] and human immunodeficiency virus [HIV]) and other infectious agents from patient to patient. Since September 1993, CDC has received reports from hea
Newspaper ducks criticism of AIDS coverage [news]: Nature. 1993 Dec 16;366(6456):599-600. Unique Identifier : AIDSLINE MED/94081935; Clarke M
Ocular manifestations of adult T-cell leukemia/lymphoma. A clinicopathologic study.: Ophthalmology. 1993 Dec;100(12):1794-9. Unique Identifier : AIDSLINE MED/94082022; Kohno T; Uchida H; Inomata H; Fukushima S; Takeshita M; Kikuchi M; Department of Ophthalmology, Faculty of Medicine, Kyushu; University, Fukuoka, Japan.; BACKGROUND: Adult T-cell leukemia/lymphoma (ATLL) is a recently described distinct clinicopathologic entity characterized by an extremely aggressive clinical course, a leukemic or lymphomatous proliferation of hyperlobulated peripheral T cells, and an association with infection by a retrovirus, human T-lymphotropic vi
Accidental skin punctures during ophthalmic surgery.: Ophthalmology. 1993 Dec;100(12):1846-50. Unique Identifier : AIDSLINE MED/94082031; Callanan DG; Borup MD; Newton J; Smiddy WE; Bascom Palmer Eye Institute, Department of Ophthalmology,; University of Miami School of Medicine.; PURPOSE: Accidental skin puncture carries the risk of both hepatitis B and human immunodeficiency virus transmission. There have been studies of the incidence of these skin punctures in general surgery, but no study has focused on ophthalmic surgery. METHOD: All incident reports of skin punctures in the Bascom Palmer
[Diagnosis of diffuse encephalopathies in adults with HIV infection. 2]: Presse Med. 1993 Sep 18;22(27):1270-7. Unique Identifier : AIDSLINE MED/94082116; Gray F; Belec L; Geny C; Schouman-Claeys E; Laboratoire d'Anatomie pathologique (Neuropathologie), Hopital; Raymond Poincare et Faculte de Medecine Paris-Ouest, Garches.; A variety of the central nervous system lesions may cause a diffuse encephalopathy in AIDS patients. Apart from viral encephalitides already described in part one, metabolic encephalopathies are a classical cause of diffuse brain dysfunction and are frequent at the terminal stage of the disease. Atypical forms of some
[Generalized lymphadenopathy with morphologic findings of multicentric angiofollicular ganglionic hyperplasia in a patient with AIDS]: Rev Clin Esp. 1993 Oct;193(6):299-302. Unique Identifier : AIDSLINE MED/94082225; Dominguez F; Riera JR; Junco P; Sampedro A; Carcaba V; Junquera MR; Servicio de Anatomia Patologica, Hospital Valle del Nalon,; Universidad de Oviedo, Austrias.; We report a case of a 33-year-old man, intravenous drugs abuser, HIV-positive, with peripheral lymphadenopathy, hepato-splenomegaly and fever, in which a ganglionic biopsy showed a histology with morphologic features of multicentric Castleman s-like disease, and minute foci of Kaposi s sarcoma ganglion, without cutane
[Therapeutic approaches to cryptosporidiosis. A review of the literature]: Rev Clin Esp. 1993 Oct;193(6):322-8. Unique Identifier : AIDSLINE MED/94082229; de Gorgolas Hernandez-Mora M; Verdejo Morcillo C; Fernandez Guerrero ML; Division de Enfermedades Infecciosas, Fundacion Jimenez Diaz,; Universidad Autonoma de Madrid.; Cryptosporidiosis is a coccidian infection that usually occurs in children an immunocompromised patients. With the AIDS (Acquired Immunodeficiency Syndrome) epidemic there have been an increased number of clinical cases and still we don t have an optimal therapeutic regimen to eradicate the infection. Since 1907 when
[The HIV test in the hospital and general practice--discussion of expanded use of the voluntary HIV test. Symposium 17 June 1993 in the Luzern canton hospital]: Schweiz Rundsch Med Prax. 1993 Oct 26;82(43):1210-3. Unique Identifier : AIDSLINE MED/94082244; Schaffner R
[Trichomegaly in HIV infection]: Schweiz Med Wochenschr. 1993 Oct 16;123(41):1941-4. Unique Identifier : AIDSLINE MED/94082247; Daneschfar A; Davis CP; Trueb RM; Dermatologische Klinik, Universitat Zurich.; Hypertrichosis of the eyelashes was first described as trichomegaly in the setting of rare congenital syndromes. Recently numerous cases of acquired trichomegaly of the eyelashes have been described, especially in patients with advanced human immunodeficiency virus type I infection. The pathomechanisms leading to acqu
Endgame for MicroGeneSys vaccine trial? [news]: Science. 1993 Dec 10;262(5140):1635. Unique Identifier : AIDSLINE MED/94082274
AIDS in Europe. German blood contamination found low [news]: Science. 1993 Dec 10;262(5140):1640. Unique Identifier : AIDSLINE MED/94082276; Aldhous P
AIDS drug development. Task force to speed drug pipeline [news]: Science. 1993 Dec 10;262(5140):1641. Unique Identifier : AIDSLINE MED/94082277; Cohen J
Away from the madding crowds [editorial; comment]: Transfusion. 1993 Nov-Dec;33(11):888-9. Unique Identifier : AIDSLINE MED/94082376; Zuck TF
Trends in transfusion-associated acquired immune deficiency syndrome in the United States, 1982 through 1991 [see comments]: Transfusion. 1993 Nov-Dec;33(11):890-3. Unique Identifier : AIDSLINE MED/94082377; Selik RM; Ward JW; Buehler JW; Division of HIV/AIDS, National Center for Infectious Diseases,; Centers for Disease Control and Prevention, Atlanta, Georgia.; To evaluate the efficacy of measures for preventing the transmission of human immunodeficiency virus (HIV) by blood transfusion, trends in transfusion-associated cases of acquired immune deficiency syndrome (AIDS) reported through June 1992 were analyzed. By year of transfusion, cases rose from 56 in 1978 to 714 in 19
[Risk of HIV infection in health care (editorial)]: Ugeskr Laeger. 1993 Oct 18;155(42):3357-8. Unique Identifier : AIDSLINE MED/94082413; Smith E
[Exposure to blood and risk of infection among health personnel (see comments)]: Ugeskr Laeger. 1993 Oct 18;155(42):3359-63. Unique Identifier : AIDSLINE MED/94082414; Nelsing S; Nielsen TL; Nielsen JO; Infektionsmedicinsk afdeling, Hvidovre Hospital, Kobenhavn.; Health care workers, especially surgeons, are frequently exposed to blood. Most blood exposures are not reported. Blood exposures involve risk of contracting serious infectious diseases like HIV, hepatitis B and hepatitis C. Fifty-four cases of occupational transmission of HIV-virus have been reported world wide. Occu
[Occupational blood exposure among personnel employed in a department of infectious diseases. 1. Frequency and reporting]: Ugeskr Laeger. 1993 Oct 18;155(42):3364-6. Unique Identifier : AIDSLINE MED/94082415; Nelsing S; Nielsen TL; Nielsen JO; Hvidovre Hospital, infektionsmedicinsk afdeling, Kobenhavn.; We investigated the frequency and reporting rate of occupational blood exposure among formerly and presently employed medical staff in a Department of Infectious Diseases (DID) from 1987-1991, the department has a high prevalence of HIV-positive patients. Subjects were asked to complete an anonymous questionnaire desc
[Facial mask--effective protection against blood spattering]: Ugeskr Laeger. 1993 Oct 18;155(42):3371-2. Unique Identifier : AIDSLINE MED/94082417; Lassen KK; Andreasen EE; Sorensen T; Gynaekologisk-obstetrisk afdeling, Kolding Sygehus.; The protective effect of a see-through face visor was evaluated in four different types of operation. In a clinical trial, the visor was used 150 times by eight different surgeons, and the number of blood spatters, type of operation and blood loss was registered. There was no correlation between the size of the blood
Mother-to-baby transfer of humoral immunity against retrovirus-induced neurologic disorders and immunodeficiency.: Virology. 1994 Jan;198(1):129-37. Unique Identifier : AIDSLINE MED/94082442; Saha K; Hollowell D; Wong PK; University of Texas, M. D. Anderson Cancer Center, Science; Park-Research Division, Smithville 78957.; Neonatal FVB/N mice inoculated with ts1, a temperature-sensitive mutant of Moloney murine leukemia virus TB, developed fatal immunodeficiencies and neurologic disorders. In this study, we tested the role of transfer of maternal humoral immunity in preventing ts1-induced disease syndrome in the neonatal mice. We compar
HIV-1 induces down-regulation of bcl-2 expression and death by apoptosis of EBV-immortalized B cells: a model for a persistent self-limiting HIV-1 infection.: Virology. 1994 Jan;198(1):234-44. Unique Identifier : AIDSLINE MED/94082454; De Rossi A; Ometto L; Roncella S; D'Andrea E; Menin C; Calderazzo F; Rowe M; Ferrarini M; Chieco-Bianchi L; Institute of Oncology, University of Padova, Padua, Italy.; Interactions between HIV-1 and EBV were studied in HIV-1-infected EBV-positive lymphoblastoid B cells. Following in vitro exposure of B cells to HIV-1, the number of infected cells reached a plateau (25-35%) in approximately 20 days and remained fairly stable thereafter, despite the presence of infectious virus in cul
Antibody response in cats to the envelope proteins of feline immunodeficiency virus: identification of an immunodominant neutralization domain.: Virology. 1994 Jan;198(1):257-64. Unique Identifier : AIDSLINE GENBANK/X60725; de Ronde A; Stam JG; Boers P; Langedijk H; Meloen R; Hesselink W; Keldermans LC; van Vliet A; Verschoor EJ; Horzinek MC; et al; Institute of Virology, Faculty of Veterinary Medicine, University; Utrecht, The Netherlands.; Overlapping fragments of the envelope protein of feline immunodeficiency virus (FIV) have been expressed in Escherichia coli. Screening of cat sera for antibodies to these fragments revealed that the immunodominant domain of the FIV envelope is localized within the transmembrane protein (amino acids 687-741) and that
Fullerene-like organization of HIV gag-protein shell in virus-like particles produced by recombinant baculovirus.: Virology. 1994 Jan;198(1):288-96. Unique Identifier : AIDSLINE MED/94082461; Nermut MV; Hockley DJ; Jowett JB; Jones IM; Garreau M; Thomas D; National Institute for Biological Standards and Control, Potters; Bar, Herts, United Kingdom.; Virus-like particles produced by a recombinant baculovirus containing the HIV gag gene were examined by negative staining after delipidization. This technique demonstrated that the gag-protein shell consisted of radially arranged short rods which formed a network of ring-like structures. Similar structures were observ
Seroepidemiologic, molecular, and phylogenetic analyses of simian T-cell leukemia viruses (STLV-I) from various naturally infected monkey species from central and western Africa.: Virology. 1994 Jan;198(1):297-310. Unique Identifier : AIDSLINE GENBANK/L20361; Saksena NK; Herve V; Durand JP; Leguenno B; Diop OM; Digouette JP; Mathiot C; Muller MC; Love JL; Dube S; et al; Department of Medicine, SUNY Health Science Center, Syracuse; 13210.; A study of simian T-cell lymphoma/leukemia virus infection, conducted on 747 nonhuman primates belonging to 14 different species in Central and Western Africa, indicated that 4 species (Cercopithecus aethiops, Erythrocebus patas, Papio doguera, and Cercopithecus mona pogonias) had a high prevalence of seropositivity t
Beet yellows closterovirus: complete genome structure and identification of a leader papain-like thiol protease.: Virology. 1994 Jan;198(1):311-24. Unique Identifier : AIDSLINE GENBANK/X73476; Agranovsky AA; Koonin EV; Boyko VP; Maiss E; Frotschl R; Lunina NA; Atabekov JG; A. N. Belozersky Institute of Physico-Chemical Biology, Moscow; State University, Russia.; The sequence of 8734 nucleotides (nt) from the 5 -end of the beet yellows closterovirus (BYV) RNA was determined to complete the 15,480-nt sequence of the virus genome. The 5 -terminal two-thirds of the sequence are occupied by two overlapping open reading frames (ORFs) 1a and 1b, encoding products with calculated M(r
A short sequence upstream of the 5' major splice site is important for encapsidation of HIV-1 genomic RNA.: Virology. 1994 Jan;198(1):336-40. Unique Identifier : AIDSLINE MED/94082467; Kim HJ; Lee K; O'Rear JJ; Department of Molecular Genetics and Microbiology, UMDNJ-Robert; Wood Johnson Medical School, Piscataway 08854.; A series of linker scanning and deletion mutations has been constructed in the 5 leader sequence of HIV-1. One virus with a 13-base-linker substitution upstream of the 5 major splice site was as impaired in its ability to replicate as a virus with a large deletion, which included these 13 bases, and was less efficie
Infection with the human immunodeficiency virus in prisoners: meeting the health care challenge.: Am J Med. 1993 Dec;95(6):629-35. Unique Identifier : AIDSLINE MED/94082607; Dixon PS; Flanigan TP; DeBuono BA; Laurie JJ; De Ciantis ML; Hoy J; Stein M; Scott HD; Carpenter CC; Brown University, Providence, RI.; The magnitude and the scope of health care problems posed by human prison inmates seropositive for the human immunodeficiency virus (HIV) are enormous. Prisoners represent a substantial proportion of HIV-infected individuals in North America. A high proportion of prisoners are intravenous drug users who often have not
Neurosyphilis in HIV-infected patients [letter; comment]: Am J Med. 1993 Dec;95(6):664. Unique Identifier : AIDSLINE MED/94082613; Berger JR
Patient-to-patient transmission of hepatitis B in a dermatology practice [see comments]: Am J Public Health. 1993 Dec;83(12):1689-93. Unique Identifier : AIDSLINE MED/94082623; Hlady WG; Hopkins RS; Ogilby TE; Allen ST; Epidemiology Program, Florida Department of Health and; Rehabilitative Services, Tallahassee 32399-0700.; OBJECTIVE. The purpose of the study was to investigate infection with hepatitis B virus (HBV) and human immunodeficiency virus (HIV) among patients in a dermatology practice. METHODS. Historical cohort, matched case-control, and cross-sectional survey methods were used. RESULTS. The age-specific incidence of reported
HIV transmission: Women's risk from bisexual men.: Am J Public Health. 1993 Dec;83(12):1757-9. Unique Identifier : AIDSLINE MED/94082639; Wood RW; Krueger LE; Pearlman TC; Goldbaum G; AIDS Prevention Project, Seattle-King County Department of Public; Health, WA 98121.; The purpose of this study was to characterize the risk of human immunodeficiency virus (HIV) infection for men who have sex with men and to identify the risk such men pose to their female sex partners. The subjects were 5480 men who were tested for HIV between January 1987 and December 1991 and who reported having had
Acculturation and gender differences in sexual attitudes and behaviors:Hispanic vs non-Hispanic white unmarried adults.: Am J Public Health. 1993 Dec;83(12):1759-61. Unique Identifier : AIDSLINE MED/94082640; Marin BV; Tschann JM; Gomez CA; Kegeles SM; Department of Epidemiology and Biostatistics, University of; California, San Francisco 94105.; Understanding how acculturation and gender affect Hispanics sexual behavior is needed to prevent infection with the human immunodeficiency virus. We examined differences in and correlates of condom use among 398 Hispanics and 540 non-Hispanic Whites in San Francisco who were part of a random probability sample of unm
Changing HIV risk behaviors: the case against pessimism [letter; comment]: Am J Public Health. 1993 Dec;83(12):1791-2. Unique Identifier : AIDSLINE MED/94082649; Galavotti C; Beeker C
Measuring HIV-1 seroprevalence among English newborns: blood spot size [letter; comment]: Am J Public Health. 1993 Dec;83(12):1792. Unique Identifier : AIDSLINE MED/94082650; McGarrigle C; Parry J; Nicoll A
HIV and trends in cervical cancer death rates among young women [letter; comment]: Am J Public Health. 1993 Dec;83(12):1792-3. Unique Identifier : AIDSLINE MED/94082651; McKenna MT; Buehler JW; Qualters JR; Chu SY
Bovine colostrum immunoglobulin concentrate for cryptosporidiosis in AIDS [see comments]: Arch Dis Child. 1993 Oct;69(4):451-3. Unique Identifier : AIDSLINE MED/94082709; Shield J; Melville C; Novelli V; Anderson G; Scheimberg I; Gibb D; Milla P; Department of Infectious Diseases, Hospital for Sick Children,; London.; Lactobin-R is a commercial hyperimmune bovine colostrum with potent anticryptosporidial activity. It was administered to a 4 year old child with AIDS and severe diarrhoea associated with cryptosporidiosis. There was significant clinical improvement in the diarrhoea and permanent elimination of the parasite from the gu
[HIV infection among type A and B hemophiliacs]: Rev Fr Transfus Hemobiol. 1993 Oct;36(5):417-26. Unique Identifier : AIDSLINE MED/94082786; Vicariot M; Fressinaud E; Fiks M; Fonlupt J; Berthier AM; Guerois C; Fimbel B; Centre de Traitement de l'hemophilie, CHR de Brest.; Evolution of HIV infection was studied in 480 hemophiliacs A and 78 hemophiliacs B treated in the Centre-West Region. 23.3% hemophiliacs A and 46.1% hemophiliacs B were contaminated by HIV. In this region, HIV seroprevalence in hemophiliacs A was lower than the prevalence noted at the national level (51.2%); this is c
Effect of the HIV epidemic on incoming emergency medicine residents' choices of specialty and residency location.: Acad Med. 1993 Dec;68(12):931. Unique Identifier : AIDSLINE MED/94082806; Restifo KM; Tullius C; Section of Emergency Medicine, Yale University School of; Medicine, New Haven, Connecticut.
GnRH agonist induces suppression of lymphocyte subpopulations in secondary lymphoid tissues of prepubertal female mice.: Am J Reprod Immunol. 1993 Aug;30(1):15-25. Unique Identifier : AIDSLINE MED/94082861; Rao LV; Cleveland RP; Ataya KM; Department of Obstetrics and Gynecology, MetroHealth Medical; Center, Case Western Reserve University, Cleveland, Ohio 44109.; PROBLEM: Gonadotropin-releasing hormone (GnRH) agonists are playing an increasing role in the medical management of a variety of diseases. Recent evidence also indicates GnRH immune system interactions. METHOD: The present study investigated the sequential changes in lymphocyte subpopulations in secondary lymphoid tis
Adverse effects of intravenous immunoglobulin.: Drug Saf. 1993 Oct;9(4):254-62. Unique Identifier : AIDSLINE MED/94082969; Misbah SA; Chapel HM; Department of Immunology, John Radcliffe Hospital, Oxford,; England.; The range of diseases in which intravenous immunoglobulin (IVIG) is effective has expanded significantly since its initial use in primary antibody deficiency. There are at present at least 17 preparations of IVIG in use worldwide with similar profiles of adverse effects. Infusion-related effects range in severity. Mil
Identification of cytomegalovirus in vitreous using the polymerase chain reaction.: Aust N Z J Ophthalmol. 1993 Aug;21(3):165-9. Unique Identifier : AIDSLINE MED/94083020; Stewart JF; Croxson MC; Powell KF; Polkinghorne PJ; Auckland Public Hospital, New Zealand.; A presumptive clinical diagnosis of cytomegalovirus ( CMV ) retinitis was made in two patients presenting with atypical ophthalmologic findings. The diagnosis was confirmed by finding specific CMV DNA sequences in sampled vitre
Increased nail and hair growth in a patient with AIDS.: Br J Clin Pract. 1993 Jul-Aug;47(4):215-6. Unique Identifier : AIDSLINE MED/94083248; Harindra V; Sivapalan S; Roy RB; Department of Genito-Urinary Medicine, Royal Victoria Hospital,; Bournemouth.; A variety of nail and hair changes have been described in AIDS patients, but rapid nail growth has not previously been reported. A slowing of nail growth would be expected in these patients due to immunosuppression and possible malnutrition. We report a case of increased nail and hair growth in a man with AIDS.
HIV/AIDS: consulting outpatients to improve services.: Nurs Stand. 1993 Nov 3-9;8(7):29-31. Unique Identifier : AIDSLINE MED/94083308; McDermott S; Lempp H; The authors discuss how a simple survey was used to elicit patients views of an HIV/AIDS outpatient clinic, and how their results have relevance for all nurses interested in developing care and services, irrespective of the clinical setting in which they work. The main findings were that patients liked the clinic s i
Isolation of HIV/mental health nurses [news]: Nurs Stand. 1993 Nov 3-9;8(7):8. Unique Identifier : AIDSLINE MED/94083317
Pride and prejudice [editorial]: Nurs Stand. 1993 Nov 10-16;8(8):3. Unique Identifier : AIDSLINE MED/94083322; Casey N
Nurses call for review of HIV education [news]: Nurs Stand. 1993 Nov 10-16;8(8):5. Unique Identifier : AIDSLINE MED/94083328; Martell R
Cytotoxic T cells from a human chimera induce regression of Epstein-Barr virus-infected allogeneic host cells.: Int Immunol. 1993 Nov;5(11):1413-20. Unique Identifier : AIDSLINE MED/94083368; Plotnicky H; Touraine JL; Unite INSERM U80, Hopital Edouard Herriot, Lyon, France.; The anti-Epstein-Barr virus (EBV) T cell response was studied in a severe combined immunodeficiency patient (PS) in whom stable peripheral blood chimerism was induced by transplantation of fetal liver stem cells from two donors. PS is characterized by a complete mismatch between the T lymphocytes, derived from the tra
[Incidence of tuberculostatic-resistant Mycobacterium tuberculosis. Clinical aspects and impact on therapy and clinical course]: Enferm Infecc Microbiol Clin. 1993 Oct;11(8):415-9. Unique Identifier : AIDSLINE MED/94083434; Esteban J; Gegundez MI; Garcia-Corbeira P; Soriano F; Servicio de Microbiologia, Fundacion Jimenez Diaz, Madrid.; BACKGROUND: To know the incidence of Mycobacterium tuberculosis resistant to anti-tuberculin drugs in addition to the clinical features, treatment and evolution of the patients. METHODS: This was a retrospective study of the clinical histories of patients with isolation of Mycobacterium tuberculosis with some type of
[Adverse reactions to trimethoprim-sulfamethoxazole in AIDS patients]: Enferm Infecc Microbiol Clin. 1993 Oct;11(8):429-32. Unique Identifier : AIDSLINE MED/94083437; Irazabal B; Camino E; Cid de Rivera C; Aguirrebengoa K; Urkijo JC; Servicio de Alergia, Hospital de Cruces, Bilboa, Vizcaya.; BACKGROUND: The aim of the present was to evaluate the incidence of side effects to Trimethoprim-sulphamethoxazole (TMP-SMX) in 32 patients with AIDS and pneumonia by Pneumocystis carinii. METHODS: A retrospective study was carried out following a protocol which included all items related with the drug used. RESULTS:
[Tuberculosis, an old disease on the up-swing (letter)]: Enferm Infecc Microbiol Clin. 1993 Oct;11(8):461-2. Unique Identifier : AIDSLINE MED/94083446; Dominguez A; Cerro R; Royo JL
[Resistance of Candida sp. to fluconazole in AIDS patients (letter; comment)]: Enferm Infecc Microbiol Clin. 1993 Oct;11(8):462-4. Unique Identifier : AIDSLINE MED/94083447; Polanco AM; Martinez-Suarez JV; Rodriguez-Tudela JL
Detection and localization of HIV RNA and TNF mRNA in rectal biopsies from patients with AIDS.: Cytokine. 1993 Jul;5(4):305-8. Unique Identifier : AIDSLINE MED/94083521; Reka S; Kotler DP; Department of Medicine, St. Luke's-Roosevelt Hospital Center,; College of Physicians and Surgeons, Columbia University, New York; 10025.; The objective of this study was to compare the localization of cells containing human immunodeficiency virus (HIV) RNA and tumor necrosis factor (TNF)-alpha mRNA in rectal mucosa by RNA in-situ hybridization in a retrospective analysis of archived rectal biopsy specimens. RNA in-situ hybridization studies were perform
Superoxide dismutase activity of Mycobacterium avium complex (MAC) strains isolated from AIDS patients.: Tuber Lung Dis. 1993 Oct;74(5):305-9. Unique Identifier : AIDSLINE MED/94083596; Deshpande RG; Khan MB; Savariar LS; Windham YZ; Navalkar RG; Department of Microbiology and Immunology, Morehouse School of; Medicine, Atlanta, Georgia 30310.; OBJECTIVE: To explore whether Mycobacterium avium complex (MAC) strains isolated from AIDS patients produce and secrete superoxide dismutase (SOD). DESIGN: SOD was assayed in the crude extracts and in cell-free medium of 18 MAC strains (MAC 101, LR and SK strains) isolated from AIDS patients to determine intracellular
Treatment of tuberculosis in HIV infection [letter; comment]: Tuber Lung Dis. 1993 Oct;74(5):347-9. Unique Identifier : AIDSLINE MED/94083604; Kennedy N; Gillespie SH
Prophylaxis against a Melanesian variant of human T-lymphotropic virus type I (HTLV-I) in rabbits using HTLV-I immune globulin from asymptomatically infected Japanese carriers.: Blood. 1993 Dec 15;82(12):3664-7. Unique Identifier : AIDSLINE MED/94083645; Tanaka Y; Ishii K; Sawada T; Ohtsuki Y; Hoshino H; Yanagihara R; Miyoshi I; Department of Medicine, Kochi Medical School, Japan.; Molecular variants of human T-lymphotropic virus type I (HTLV-I), which diverge significantly from the so-called cosmopolitan prototypes, have been discovered in Melanesia. In this study, HTLV-I IgG (I-IgG) prepared from seropositive healthy Japanese carriers was evaluated for its protective effect against a Melanesia
[Prediction of future trends of HIV infection and AIDS in Japan]: Nippon Koshu Eisei Zasshi. 1993 Oct;40(10):926-33. Unique Identifier : AIDSLINE MED/94083697; Hashimoto S; Fukutomi K; Morio S; Ichikawa S; Soda K; Yamamoto N; Naemura M; Department of Hygiene, Tottori University School of Medicine.; Current status and future trends of HIV infection and AIDS in Japan were estimated based on AIDS surveillance data up until 1992, excluding HIV infection from blood products and blood-borne transmission. The coverage rate of reports of HIV infection was estimated as the proportion o
Theatre footwear: a health hazard?: Br J Theatre Nurs. 1993 Oct;3(7):5-6, 9. Unique Identifier : AIDSLINE MED/94083729; Thomas JA; Fligelstone LJ; Jerwood TE; Rees RW; Theatre footwear frequently appears to be contaminated with blood. We assessed objectively the nature and degree of contamination of theatre shoes after cleaning. Two hundred pairs of theatre shoes were randomly selected from three hospitals in South East Wales. Hospital 1 (H1), 100 pairs of shoes, Hospital 2 (H2), 40
Smoothed nonparametric back-projection of AIDS incidence data with adjustment for therapy.: Math Biosci. 1993 Nov;118(1):1-23. Unique Identifier : AIDSLINE MED/94083730; Becker NG; Motika M; Department of Statistics, La Trobe University, Bundoora Vic.,; Australia.; Back-projection is a major tool for assessing the extent of the HIV epidemic. Its application relies on a model for the incubation period of AIDS into which the administration and effect of therapy has been incorporated. We propose a compartmental model with proportional transition rates to describe variation and chan
Human T-cell leukaemia virus type I and neurological disease.: Curr Opin Neurobiol. 1993 Oct;3(5):773-8. Unique Identifier : AIDSLINE MED/94083814; Bangham CR; Department of Virology, John Radcliffe Hospital, University of; Oxford, Headington, UK.; Tropical spastic paraparesis is thought to be caused either directly by human T-cell leukaemia virus type I (HTLV-1), or by the immune response to the virus. Recent work has identified differences between tropical spastic paraparesis patients and healthy carriers of HTLV-I, both in the virus and in the host s T-cell r
Is HCV transmitted by the vertical/perinatal route?: Arch Virol Suppl. 1993;8:229-34. Unique Identifier : AIDSLINE MED/94083858; Tanzi E; Stringhi C; Paccagnini S; Profeta ML; Zanetti AR; Institute of Virology, University of Milan, Italy.; Hepatitis type C is the major aetiological cause of both parenterally transmitted and cryptogenic, sporadic or community acquired nonAnonB hepatitis. The lack of known parenteral risk factors in a consistent number of cases with nonAnonB hepatitis has stimulated the search of other possible modes of viral transmission
Multiple viral infections in HIV-infected children with chronically-evolving hepatitis.: Arch Virol Suppl. 1993;8:237-48. Unique Identifier : AIDSLINE MED/94083860; Nigro G; Taliani G; Krzysztofiak A; Mattia S; Bartmann U; Petruccelli A; Falconieri P; Fridell E; Cinque P; Linde A; et al; Pediatric Institute, La Sapienza University, Rome, Italy.; Hepatic involvement was investigated in 31 children with perinatal HIV-1 infection, who were followed for 2-82 months (mean 30.5). Liver disease, as revealed by increased aminotransferase levels, liver biopsy or necroscopy, was diagnosed in 18 children (58%), of which 7 (22.5%) had acute hepatitis and 11 (35.5%) showe
The hepatitis B virus X gene product transactivates the HIV-LTR in vivo.: Arch Virol Suppl. 1993;8:63-71. Unique Identifier : AIDSLINE MED/94083871; Balsano C; Billet O; Bennoun M; Cavard C; Zider A; Grimber G; Natoli G; Briand P; Levrero M; Laboratoire de Genetique et Patologie Experimentale, INSERM; Institut Cochin de Genetique Moleculaire, Paris, France.; It has previously been shown that the hepatitis B virus (HBV) X gene product, HBx, transactivates homologous and heterologous transcriptional regulatory sequences of viruses, including the human immunodeficiency virus type 1 (HIV1) long terminal repeat (LTR), and various cellular genes in vitro. To evaluate the transa
Autopsy findings in 47 cases of adult T-cell leukemia/lymphoma in Miyazaki prefecture, Japan.: Leuk Lymphoma. 1993 Oct;11(3-4):281-6. Unique Identifier : AIDSLINE MED/94083897; Suzumiya J; Marutsuka K; Nabeshima K; Nawa Y; Koono M; Tamura K; Kimura N; Hisano S; Tachibana N; Inoue S; et al; First Department of Pathology, Miyazaki Medical College, Japan.; To identify factors that might improve the prognosis of adult T-cell leukemia/lymphoma (ATL), we reviewed data on 47 autopsied cases of ATL with reference to the complications and cause of death. The primary cause of death was respiratory insufficiency due to pulmonary infection. Respiratory insufficiency was also att
Diagnosis of cytomegalovirus infections of the nervous system by immunocytochemical demonstration of infected cells in cerebrospinal fluid.: Eur J Med. 1993 Apr;2(4):223-6. Unique Identifier : AIDSLINE MED/94084214; Stark E; Haas J; Schedel I; Neurological Clinic, Hannover Medical School, Germany.; OBJECTIVES: Infections caused by the cytomegalovirus ( CMV ) are frequent complications in patients with the acquired immunodeficiency syndrome. Diagnosis of CMV infections of the nervous system is still difficult. METHODS: We
Tricuspid endocarditis and Ebstein's anomaly in an intravenous drug abuser.: Eur J Med. 1993 Apr;2(4):247-8. Unique Identifier : AIDSLINE MED/94084220; Vazquez R; Gomez J; Jimenez P; Sainz I; Manzaneque L; Division of Cardiology, Valme University Hospital, Sevilla,; Spain.
Multiple pulmonary infections in a patient with acquired immunodeficiency syndrome.: Eur J Med. 1993 Apr;2(4):250-1. Unique Identifier : AIDSLINE MED/94084222; Hennequin C; Dupouy-Camet J; Giraud T; Bougnoux ME; Dhainaut JF; Tourte-Schaefer C; Service de Microbiology, Hopital Necker-Enfants Malades, Paris,; France.
Disseminated Rhodotorula rubra infection in an HIV-infected drug abuser [letter]: Eur J Med. 1993 Apr;2(4):252-3. Unique Identifier : AIDSLINE MED/94084223; Polo R
Tricuspid valve replacement using a mitral homograft. Surgical technique and initial results [see comments]: J Heart Valve Dis. 1993 Mar;2(2):125-8. Unique Identifier : AIDSLINE MED/94084324; Pomar JL; Mestres CA; Department of Cardiovascular Surgery, Hospital Clinico y; Provincial, University of Barcelona, Spain.; Tricuspid valve replacement using a cryopreserved mitral valve homograft was carried out with success in three HIV positive drug addicts suffering from fungal or bacterial endocarditis. All three patients are alive and symptomless up to 16 months after surgery. This procedure is considered to be an alternative to othe
Endocarditis in intravenous drug addicts and HIV infected patients: possibilities and limitations of surgical treatment.: J Heart Valve Dis. 1993 Mar;2(2):140-7. Unique Identifier : AIDSLINE MED/94084326; Carrel T; Schaffner A; Vogt P; Laske A; Niederhauser U; Schneider J; Turina M; Department of Medicine, University Hospital, Zurich,; Switzerland.; The incidence of infective endocarditis in drug addicts is increasing with the spread of intravenous drug abuse. The tricuspid valve is involved most commonly, followed by the mitral. We evaluated 22 patients prospectively with a mean age of 23 years, presenting with addiction-associated endocarditis and referred to o
A clinical overview of opportunistic infections in patients with AIDS.: Mol Cell Biol Hum Dis Ser. 1993;2:1-22. Unique Identifier : AIDSLINE MED/94084358; Wiselka MJ; Department of Infectious Diseases, Groby Road Hospital,; Leicester, UK.
Molecular and cell biology of opportunistic infections in AIDS. Cryptosporidium and Isospora.: Mol Cell Biol Hum Dis Ser. 1993;2:139-61. Unique Identifier : AIDSLINE MED/94084359; Bonnin A; Dei-Cas E; Camerlynck P; Hopital du Bocage, Dijon, France.
Molecular and cell biology of opportunistic infections in AIDS. Toxoplasma.: Mol Cell Biol Hum Dis Ser. 1993;2:163-85. Unique Identifier : AIDSLINE MED/94084360; Savva D; Department of Biochemistry and Physiology, University of Reading,; Whiteknights, UK.
Molecular and cell biology of opportunistic infections in AIDS. Pneumocystis carinii.: Mol Cell Biol Hum Dis Ser. 1993;2:187-203. Unique Identifier : AIDSLINE MED/94084361; Hopkin JM; Wakefield AE; Institute of Molecular Medicine, John Radcliffe Hospital, Oxford,; UK.
Molecular and cell biology of opportunistic infections in AIDS. Candida.: Mol Cell Biol Hum Dis Ser. 1993;2:205-28. Unique Identifier : AIDSLINE MED/94084362; Matthews R; Department of Medical Microbiology, University of Manchester, UK.
Molecular and cell biology of opportunistic infections in AIDS. Mycoplasmas and AIDS.: Mol Cell Biol Hum Dis Ser. 1993;2:229-56. Unique Identifier : AIDSLINE MED/94084363; Lo S; Kotani H; Hu WS; Department of Infectious and Parasitic Disease Pathology,; American Registry of Pathology, Armed Forces Institute of; Pathology, Washington, DC 20306-6000.
Molecular and cell biology of opportunistic infections in AIDS. Herpesviruses.: Mol Cell Biol Hum Dis Ser. 1993;2:257-77. Unique Identifier : AIDSLINE MED/94084365; Emery VC; Webster A; Griffiths PD; University Division of Communicable Diseases, Royal Free Hospital; and School of Medicine, London, UK.
Molecular and cell biology of opportunistic infections in AIDS. Future prospects.: Mol Cell Biol Hum Dis Ser. 1993;2:279-80. Unique Identifier : AIDSLINE MED/94084366; Myint SH; Cann AJ; Tyrrell DA; Department of Microbiology, University of Leicester, UK.
Molecular and cell biology of opportunistic infections in AIDS. Salmonella, Shigella and Campylobacter.: Mol Cell Biol Hum Dis Ser. 1993;2:41-69. Unique Identifier : AIDSLINE MED/94084367; Rubin FA; Rhoads JL; Warren RL; Department of Bacterial Immunology, Walter Reed Army Institute of; Research, Washington, DC 20307-5100.
Molecular and cell biology of opportunistic infections in AIDS. Mycobacteria.: Mol Cell Biol Hum Dis Ser. 1993;2:71-93. Unique Identifier : AIDSLINE MED/94084368; Ralphs NT; Boulnois GJ; Andrew PW; Department of Biological Sciences, Manchester Polytechnic, UK.
Molecular and cell biology of opportunistic infections in AIDS. Entamoeba histolytica.: Mol Cell Biol Hum Dis Ser. 1993;2:95-137. Unique Identifier : AIDSLINE MED/94084369; Spice WM; Cruz-Reyes JA; Ackers JP; Department of Medical Parasitology, London School of Hygiene and; Tropical Medicine, UK.
Communicating with people who request euthanasia.: Palliat Med. 1993;7(2):139-43. Unique Identifier : AIDSLINE MED/94084375; Cole RM; Illawarra Cancer Care Centre, Wollongong, Australia.; The subject of euthanasia is widely debated in the medical literature and lay press in terms of morals, anecdotes and medical or legal ethics. This paper approaches the issue from a patient-centred perspectives, giving four case histories to demonstrate widely varied motives or hidden agendas for requesting euthanasia
The estimation of the basic reproduction number for infectious diseases.: Stat Methods Med Res. 1993;2(1):23-41. Unique Identifier : AIDSLINE MED/94084471; Dietz K; Department of Medical Biometry, University of Tubingen, Germany.; The basic reproduction number R0 is the number of secondary cases which one case would produce in a completely susceptible population. It depends on the duration of the infectious period, the probability of infecting a susceptible individual during one contact, and the number of new susceptible individuals contacted p
AIDS: the statistical basis for public health.: Stat Methods Med Res. 1993;2(1):75-91. Unique Identifier : AIDSLINE MED/94084474; De Angelis D; Day NE; Gore SM; Gilks WR; McGee MA; Medical Research Council Biostatistics Unit, Cambridge, UK.; The backcalculation method has been extensively used in AIDS modelling and forecasting. Knowledge of reported AIDS cases, information on the time between HIV infection and onset of AIDS, and assumptions on the rate at which infections occurs, can be used to reconstruct the past history of the HIV epidemic, as well as
Do you have a latex protocol?: Can Oper Room Nurs J. 1993 Sep-Oct;11(3):26-34. Unique Identifier : AIDSLINE MED/94084568; Smith S; Tyndall J; Young A
Sentence: education in ethics [letter; comment] [published erratum appears in Can Med Assoc 1994 Feb 15;150(4):465] [see comments]: Can Med Assoc J. 1993 Dec 15;149(12):1772. Unique Identifier : AIDSLINE MED/94084576; McWhinney IR
Needlestick injuries: the shock and reality.: Can Nurse. 1993 Nov;89(10):29-33. Unique Identifier : AIDSLINE MED/94084613; Moorhouse A; Bolen R; Evans J; Gilchrist J; Hart M; McKinlay K; Midgely L; Montada M; Munro A; Smith R; et al; It has been a typically busy Saturday night in the emergency department. Then, near midnight, a trauma casualty was admitted and an incident occurred that would occupy Suzanne Smith s thoughts for months to come. When starting an intravenous line on this patient, Suzanne spiked herself with a needle. Later the patient
Sequence analysis of an immunogenic and neutralizing domain of the human T-cell lymphoma/leukemia virus type I gp46 surface membrane protein among various primate T-cell lymphoma/leukemia virus isolates including those from a patient with both HTLV-I-associated myelopathy and adult T-cell leukemia.: Cancer Res. 1993 Dec 15;53(24):6067-73. Unique Identifier : AIDSLINE GENBANK/L33709; Sherman MP; Dube S; Spicer TP; Kane TD; Love JL; Saksena NK; Iannone R; Gibbs CJ Jr; Yanagihara R; Dube DK; et al; Department of Medicine and Microbiology/Immunology, State; University of New York, Syracuse 13210.; Human T-cell lymphoma/leukemia virus type I (HTLV-I) causes adult T-cell leukemia/lymphoma and HTLV-I-associated myelopathy. Specific regions within the outer envelope proteins of other retroviruses, e.g., human immunodeficiency virus type 1, are highly immunogenic and, because of the selective pressure of the host im
Directory of socio-behavioural research on HIV infection and AIDS in Zimbabwe.: Cent Afr J Med. 1993 Feb;39(2):37-9. Unique Identifier : AIDSLINE MED/94084775; Bijlmakers LA; In July-August 1992, a directory was made of research projects on socio-behavioural aspects of HIV infection and AIDS in Zimbabwe . A total of 92 research projects were identified, most of which were already completed. Whilst there was a wide variety of topics, populations and geo
The costs of HIV prevention strategies in developing countries.: Bull World Health Organ. 1993;71(5):595-604. Unique Identifier : AIDSLINE MED/94084848; Soderlund N; Lavis J; Broomberg J; Mills A; Department of Public Health and Primary Care, University of; Oxford, England.; Since many evaluations of HIV (human immunodeficiency virus) prevention programmes do not include data on costs, a preliminary analysis of the costs and outputs of a sample of HIV prevention projects was attempted. Case studies, representing six broad HIV prevention strategies in developing countries with differing le
HIV antibody detection in oral fluids [news]: Bull World Health Organ. 1993;71(5):641, 645. Unique Identifier : AIDSLINE MED/94084853
Serial brainstem auditory evoked responses in infants and children with AIDS.: Clin Electroencephalogr. 1993 Oct;24(4):160-5. Unique Identifier : AIDSLINE MED/94084931; Frank Y; Pahwa S; Department of Neurology, North Shore University Hospital, Cornell; University Medical College, Manhasset, New York 11030.; Fourteen infants and children with AIDS had serial BAER studies, with stimuli delivered at a frequency of 10 and 50 per second. The latencies of waves I, III, V and interpeak latencies I-III, III-V and I-V were measured, and their changes over time were calculated. A significant correlation was found between wave V la
Inhibition of HIV-1 replication by daunorubicin.: Clin Invest Med. 1993 Oct;16(5):339-47. Unique Identifier : AIDSLINE MED/94084989; Filion LG; Logan D; Gaudreault R; Izaguirre CA; Department of Microbiology and Immunology, University of Ottawa,; Ontario.; Members of the anthracycline family of drugs such as daunorubicin (DNR) are currently being employed in cancer therapy, treatment of Kaposi s sarcoma and lymphomas in HIV-1 infected patients. These drugs may have an anti-viral activity against HIV-1. Experiments conducted on U937 (a promonocytic cell line), peripheral
[Bilateral internal carotid artery stenoses in a patient with meningovascular neurosyphilis]: Rinsho Shinkeigaku. 1993 Aug;33(8):875-9. Unique Identifier : AIDSLINE MED/94085002; Ohya Y; Matsumura T; Kojima S; Kuroiwa Y; Shiozawa R; Department of Neurology, Toranmon Hospital.; We report a 37-year-old man with cerebral infarction due to meningovascular neurosyphilis. He developed right hemiplegia and motor aphasia preceded by left retroorbital pain lasting a month. Bilateral tonic pupils were also observed. Magnetic resonance imaging (MRI) disclosed cerebral infarction in the distribution of
[A case of cryptococcal meningitis in an HTLV-1 carrier]: Rinsho Shinkeigaku. 1993 Aug;33(8):895-900. Unique Identifier : AIDSLINE MED/94085006; Funakawa I; Shibata A; Mukai K; Terao A; Niki Y; Department of Internal Medicine, Kawasaki Medical School.; We report a case of 73-year-old male HTLV-I carrier with cryptococcal meningitis. The patient, who was born in Taiwan , has raised golden pheasants for ten years and bantams for five years. Antibody to HIV was negative. Flow cytometr
[Myelopathy with uveitis in association with HTLV-I mimicking neuro-Behcet's disease]: Rinsho Shinkeigaku. 1993 Aug;33(8):912-4. Unique Identifier : AIDSLINE MED/94085010; Saito Y; Ando T; Kameyama T; Takahashi A; Horiguchi M; Department of Neurology, Nagoya University School of Medicine.; A 31-year-old woman was referred to our hospital because of recurrent uveitis with oral aphthae for four years, and subacute double incontinence with spastic paraparesis under a clinical diagnosis of neuro-Behcet s disease. She was found to have high titers of anti-HTLV-I antibody in the serum, the cerebrospinal fluid
Pharmacokinetic optimisation of oral antifungal therapy.: Clin Pharmacokinet. 1993 Oct;25(4):329-41. Unique Identifier : AIDSLINE MED/94085017; Schafer-Korting M; Institut fur Pharmazie, Freien Universitat Berlin, Federal; Republic of Germany.; The range of oral antifungal therapy has been expanded recently by the introduction of itraconazole, and terbinafine. These agents have a broader spectrum of activity than griseofulvin and flucytosine, and induce less liver toxicity than ketoconazole. Treatment with these agents may be optimised by application of phar
Prevention of occupational exposure to human immunodeficiency virus 1.: Compr Ther. 1993;19(4):145-50. Unique Identifier : AIDSLINE MED/94085073; Breeling JL; Medical Service, West Roxbury Veterans Administration Medical; Center, Boston, MA 02132.
Prevalence of hepatitis C virus infection in asymptomatic anti-HIV1 negative pregnant women and their children.: Dig Dis Sci. 1993 Dec;38(12):2151-5. Unique Identifier : AIDSLINE MED/94085124; Marcellin P; Bernuau J; Martinot-Peignoux M; Larzul D; Xu LZ; Tran S; Bezeaud A; Guimont MC; Levardon M; Aumont P; et al; Service d'Hepatologie, Hopital Beaujon, Clichy, France.; The prevalence of hepatitis C virus (HCV) infection was studied prospectively in pregnant women in France and their children by detection of anti-HCV with second-generation ELISA (ELISA2). In ELISA2-positive women, anti-HCV was detected with second- and third-generation RIBA (RIBA2
Toxoplasmosis appearing as an anterior neck mass [letter; comment]: Ear Nose Throat J. 1993 Nov;72(11):722. Unique Identifier : AIDSLINE MED/94085236; Kmucha ST
The status of epidemic diseases--1923 and 1993.: East Afr Med J. 1993 Jun;70(6):375-9. Unique Identifier : AIDSLINE MED/94085274; Waiyaki PG; Centre for Microbiology Research, Kenya Medical Research; Institute, Nairobi.
HIV infection among patients with acute pelvic inflammatory disease at the Kenyatta National Hospital, Nairobi, Kenya.: East Afr Med J. 1993 Aug;70(8):506-11. Unique Identifier : AIDSLINE MED/94085287; Ojwang AW; Lema VM; Wanjala SH; Homa-Bay District Hospital, Kenya.; AIDS continues to exert considerable strain on the economy, as well as social aspects of our lives. Previous studies have identified the categories of people most at risk of contracting and developing HIV infection and AIDS. In this study, 20.9% of women with acute pelvic infection at the Kenyatta National Hospital, w
Analyses of cognitive processes in train traffic control.: Ergonomics. 1993 Nov;36(11):1361-8. Unique Identifier : AIDSLINE MED/94085358; Lenior TM; ErgoS, Ergonomical Systems Engineering, Enschede, The; Netherlands.; The study of complex information processing and problem-solving situations in practice is discussed, in particular the methods of analysing the cognitive aspects in train dispatcher s work. Some parallels are drawn with related work in processing industries. A prerequisite for the approach to the issue was that the re
CD4 cell surface downregulation in HIV-1 Nef transgenic mice is a consequence of intracellular sequestration.: EMBO J. 1993 Dec 15;12(13):4923-32. Unique Identifier : AIDSLINE MED/94085366; Brady HJ; Pennington DJ; Miles CG; Dzierzak EA; Laboratory of Gene Structure and Expression, National Institute; for Medical Research, Mill Hill, London, UK.; The Nef gene product is a regulatory protein of HIV whose biological function is poorly understood. Nef has been thought to have a negative effect on viral replication in vitro but has been shown in studies with SIV to be necessary in the establishment of viraemia in vivo. In vitro studies in various human cell lines
The (YXXL/I)2 signalling motif found in the cytoplasmic segments of the bovine leukaemia virus envelope protein and Epstein-Barr virus latent membrane protein 2A can elicit early and late lymphocyte activation events.: EMBO J. 1993 Dec 15;12(13):5105-12. Unique Identifier : AIDSLINE MED/94085385; Beaufils P; Choquet D; Mamoun RZ; Malissen B; Centre d'Immunologie INSERM-CNRS de Marseille-Luminy, France.; The cytoplasmic domains of the transducing subunits associated with B and T cell antigen receptors contain a common amino acid motif consisting of two precisely spaced Tyr-X-X-Leu/Ile sequences (where X corresponds to a variable residue). Expression of a single copy of this motif suffices to initiate B or T cell activ
Demographic characteristics of heterosexuals with multiple partners: the National AIDS Behavioral Surveys.: Fam Plann Perspect. 1993 Sep-Oct;25(5):208-14. Unique Identifier : AIDSLINE MED/94085534; Dolcini MM; Catania JA; Coates TJ; Stall R; Hudes ES; Gagnon JH; Pollack LM; Center for AIDS Prevention Studies, University of California at; San Francisco.; In a study of risk behavior among heterosexuals, 9% of a national sample and 12% of a sample drawn from high-risk cities report having two or more sexual partners in the year before the survey. In both samples, sex with multiple partners is most common among men, younger people and the unmarried. Multivariate analyses
Contraceptive and sexual practices among single women with an unplanned pregnancy: partner influences.: Fam Plann Perspect. 1993 Sep-Oct;25(5):215-9. Unique Identifier : AIDSLINE MED/94085535; O'Campo P; Faden RR; Gielen AC; Kass N; Anderson J; Department of Maternal and Child Health, Johns Hopkins School of; Hygiene and Public Health, Baltimore, Md.; Data from an urban obstetrics clinic on 291 unmarried women with a current unplanned pregnancy show that women with only one partner in the past year are older and are more likely to use the most effective contraceptive methods than are women who have more than one partner. Women with only one partner are also more li
Acceptability of dual method use [letter; comment]: Fam Plann Perspect. 1993 Sep-Oct;25(5):234. Unique Identifier : AIDSLINE MED/94085539; Steiner M; Joanis C
Down-modulation of CD4 antigen during programmed cell death in U937 cells.: FEBS Lett. 1993 Dec 27;336(2):335-9. Unique Identifier : AIDSLINE MED/94085634; Malorni W; Rivabene R; Santini MT; Paradisi S; Iosi F; Donelli G; Department of Ultrastructures, Istituto Superiore di Sanita,; Roma, Italy.; It has been hypothesized that programmed cell death (PCD), an active cell suicide process occurring in place of necrosis, can be associated with the pathogenesis of acquired immunodeficiency syndrome (AIDS). The entry of human immunodeficiency virus (HIV) into competent cells is mediated by the CD4 molecule present on
Growth hormone induces resistance to the mitogenic action of insulin through local IGF-I. Studies in normal and Pygmy T-cell lines.: Diabetes. 1994 Jan;43(1):68-72. Unique Identifier : AIDSLINE MED/94085708; Geffner ME; Bersch N; Bailey RC; Golde DW; Department of Pediatrics, University of California, Los Angeles.; Growth hormone (GH) and insulin have both mitogenic and metabolic actions. The growth-promoting effects of GH in vivo are thought to be mediated by insulin-like growth factor-I (IGF-I), whereas the metabolic effects of GH are thought to be either direct or mediated by factors other than IGF-I. In previous studies usin
Economic impact of applications of monoclonal antibodies to medicine and biology.: FASEB J. 1993 Dec;7(15):1426-31. Unique Identifier : AIDSLINE MED/94085715; Chien S; Silverstein SC; Institute for Biomedical Engineering, University of California,; San Diego, La Jolla 92093-0412.
Patient perceptions of the risk of contracting HIV in the dental office.: Gen Dent. 1993 Jul-Aug;41(4):332-4. Unique Identifier : AIDSLINE MED/94085746; Cohen LA; Grace EG; Ward MA; Department of Oral Health Care Delivery, Baltimore College of; Dental Surgery, Dental School, University of Maryland.
High expression of NK-1.1 antigen is induced by infection with murine AIDS virus.: Immunology. 1993 Oct;80(2):319-25. Unique Identifier : AIDSLINE MED/94086029; Makino M; Winkler DF; Wunderlich J; Hartley JW; Morse HC; Holmes KL; Department of Bacterial and Blood Products, National Institutes; of Health, Tokyo, Japan.; Spleen cells from mice infected with LP-BM5 MuLV, a causative agent of murine acquired immunodeficiency syndrome (MAIDS), were tested for frequency of NK-1.1+ cells and natural killer (NK) activity. During the first 3 weeks following infection, NK activity was well conserved, but by 9-12 weeks post-infection (p.i.), k
Inhibition of adsorption of human T-cell-leukemia virus type 1 by a plant lectin, wheat-germ agglutinin.: Int J Cancer. 1994 Jan 2;56(1):100-5. Unique Identifier : AIDSLINE MED/94086144; Yang D; Haraguchi Y; Iwai H; Handa A; Shimizu N; Hoshino H; Department of Hygiene and Virology, Gunma University School of; Medicine, Japan.; Thirty-six lectins that recognize various sugar chains were examined for inhibitory activities against infection with human T-cell leukemia virus type I (HTLV-I). Wheat-germ agglutinin (WGA) was the most inhibitory among them: plating of the pseudotype of vesicular-stomatitis virus (VSV) bearing envelope antigens of H
Inhaled isobutyl nitrite compromises T-dependent, but not T-independent, antibody induction.: Int J Immunopharmacol. 1993 Oct;15(7):821-7. Unique Identifier : AIDSLINE MED/94086181; Soderberg LS; Barnett JB; Department of Microbiology and Immunology, University of Arkansas; for Medical Sciences, Little Rock 72205.; Habitual abuse of nitrite inhalants has been linked in epidemiological studies with seropositivity to human immunodeficiency virus and, separately, with Kaposi s sarcoma among AIDS patients. Mice exposed to isobutyl nitrite in an inhalation chamber for 45 min/day for 14 days had depressed IgM and IgG antibody response
A randomized prospective trial of radiation therapy for AIDS-associated Kaposi's sarcoma [see comments]: Int J Radiat Oncol Biol Phys. 1993 Dec 1;27(5):1057-61. Unique Identifier : AIDSLINE MED/94086384; Stelzer KJ; Griffin TW; Department of Radiation Oncology, University of Washington; Medical Center, Seattle 98195.; PURPOSE: The optimal dose of radiation in the treatment of AIDS-associated Kaposi s sarcoma has been controversial based on previous nonrandomized retrospective studies. METHODS AND MATERIALS: Seventy-one cutaneous AIDS-associated Kaposi s sarcoma lesions were randomly assigned to 1 of 3 radiation dose regimens--8 Gy
Radiation therapy in endemic (African) Kaposi's sarcoma.: Int J Radiat Oncol Biol Phys. 1993 Dec 1;27(5):1181-4. Unique Identifier : AIDSLINE MED/94086402; Stein ME; Lakier R; Kuten A; Spencer D; Ruff P; Bezwoda WR; Department of Medical Oncology and Haematology, Faculty of; Medicine, University of the Witwatersrand, Johannesburg General; Hospital, Republic of South Africa.; PURPOSE: Evaluating the role of radiation therapy in the treatment of the endemic, African variant of Kaposi s sarcoma. A retrospective analysis. METHODS AND MATERIALS: Between 1978 and 1990, 28 symptomatic African patients with the African Human Immunodeficiency Virus negative type of Kaposi s sarcoma were referred t
But I know my man! HIV/AIDS risk appraisals and heuristical reasoning patterns among childbearing women.: Holist Nurs Pract. 1994 Jan;8(2):79-88. Unique Identifier : AIDSLINE MED/94086680; Kinsey KK; This exploratory study examined HIV/AIDS risk appraisals, life-style choices, and heuristical reasoning patterns reported by 105 urban childbearing women. The availability heuristic was the strategy most frequently described by participants to distance themselves from the risks of having or getting HIV/AIDS within the
Evaluation of the automated 'Enzymen-Test Anti HIV-1 + 2' and 'Enzymen-Test Anti HIV-1/2 selective' for the combined detection and differentiation of anti-HIV-1 and anti-HIV-2 antibodies.: J Virol Methods. 1993 Oct;44(2-3):251-60. Unique Identifier : AIDSLINE MED/94086717; Weber B; Hess G; Koberstein R; Doerr HW; Institut fur Medizinische Virologie, Universitatskliniken; Frankfurt a. M., Germany.; A new, modular automated ELISA (test 1) for HIV-1 and HIV-2 antibody detection and differentiation (Enzymun-Test Anti HIV-1 + 2; anti HIV 1/2 selective, Boehringer Mannheim) was compared with 3 alternative enzyme immunoassays (Abbott recombinant HIV-1/HIV-2 3rd generation EIA, Abbott (test 2); Enzygnost HIV 1 + 2, Beh
Microtiter enzyme-linked immunosorbent assay using recombinant derived antigens versus western blot in the confirmation of presence of antibodies against the human immunodeficiency virus type 1.: J Virol Methods. 1993 Oct;44(2-3):271-80. Unique Identifier : AIDSLINE MED/94086719; Roosendaal R; van Kamp GJ; Mulder C; Calliauw J; Kempers J; Dirks M; Wolters EC; ten Kate RW; Department of Clinical Microbiology, Free University Hospital,; Amsterdam, The Netherlands.; A microtiter enzyme-linked immunosorbent assay using recombinant derived antigens was compared with the Western blot (Dupont) in the confirmation of the presence of antibodies against the human immunodeficiency virus type 1 (HIV-1). Of 104 sera (104 individuals) that were negative by a screening ELISA, 91 were also ne
HIV-1 pseudotype virus containing a Cocal virus genome and an HIV envelope: construction, assay and use.: J Virol Methods. 1993 Oct;44(2-3):287-304. Unique Identifier : AIDSLINE MED/94086721; Gregory S; Collman R; James W; Gordon S; Gonzalez-Scarano F; Nathanson N; Department of Medicine, University of Pennsylvania School of; Medicine, Philadelphia 19104-6076.; A method is described for the production and assay of pseudotype viruses between human immunodeficiency virus type 1 (HIV-1) and Cocal virus (COV), containing an HIV-1 envelope and a COV genome (COV(HIV)). COV(HIV) pseudotype virus is a useful tool for the investigation of a variety of questions regarding HIV entry in
Comparison of quantitative cytomegalovirus antigenemia assay with culture methods and correlation with clinical disease.: J Clin Microbiol. 1993 Nov;31(11):2851-6. Unique Identifier : AIDSLINE MED/94086777; Landry ML; Ferguson D; Clinical Virology Laboratory, Yale-New Haven Hospital, New Haven,; Connecticut.; Blood samples, obtained predominantly from human immunodeficiency virus-infected patients and solid-organ and bone marrow transplant recipients, were submitted to the clinical laboratory for detection of cytomegalovirus ( CMV )
Adult T-cell leukaemia-lymphoma in Waldeyer's ring: a report of three cases.: J Laryngol Otol. 1993 Oct;107(10):960-2. Unique Identifier : AIDSLINE MED/94087063; Ohguro S; Himi T; Harabuchi Y; Suzuki T; Asakura K; Kataura A; Department of Otolaryngology, Sapporo Medical College, Japan.; Adult T-cell leukaemia-lymphoma (ATLL) is a new type of T-cell malignancy which has an adult onset, a rapidly progressive terminal course and a clustering at patients birthplaces in southeast Japan and the Caribbean. We report the clinical features of three cases of ATLL in Waldeye
Cervical HPV infection among HIV-infected prostitutes addicted to hard drugs.: J Med Virol. 1993 Nov;41(3):185-90. Unique Identifier : AIDSLINE MED/94087171; Van Doornum GJ; Van den Hoek JA; Van Ameijden EJ; Van Haastrecht HJ; Roos MT; Henquet CJ; Quint WG; Coutinho RA; Department of Public Health, Municipal Health Service of; Amsterdam, The Netherlands.; An investigation into the prevalence of human papilloma virus (HPV) infection, abnormal cervical cytology and the relationship between HIV- and HPV infection was done in a group of intravenously (IV) and non-IV drug-using prostitutes. From July 1991 through May 1992, hard drug-addicted prostitutes attending a sexually
Serologic markers of viral hepatitis A, B, C, and D in patients with hemophilia.: J Med Virol. 1993 Nov;41(3):205-9. Unique Identifier : AIDSLINE MED/94087175; Kumar A; Kulkarni R; Murray DL; Gera R; Scott-Emuakpor AB; Bosma K; Penner JA; Department of Pediatrics & Human Development, Michigan State; University, East Lansing 48824-1317.; Forty-one patients with hemophilia A were studied for the prevalence of serological markers for hepatitis A, hepatitis B, hepatitis C (non-A and non-B hepatitis), and delta hepatitis (hepatitis D). Ten of 41 (24.4%) patients demonstrated hepatitis A antibody and 31 of 41 (75.6%) patients had a serologic marker for pre
Efficacy of (S)-1-(3-hydroxy-2-phosphonylmethoxypropyl)cytosine for the treatment of lethal vaccinia virus infections in severe combined immune deficiency (SCID) mice.: J Med Virol. 1993 Nov;41(3):242-6. Unique Identifier : AIDSLINE MED/94087180; Neyts J; De Clercq E; Rega Institute for Medical Research, Katholieke Universiteit; Leuven, Belgium.; Severe combined immune deficient (SCID) mice inoculated intravenously with vaccinia virus (VV) became sick within 6-8 days and died 10-12 days after infection. Tail lesions developed and the number depended on the virus inoculum. Age-matched immunocompetent NMRI mice similarly infected also developed tail lesions but
Muscle disease, HIV and zidovudine: the spectrum of muscle disease in HIV-infected individuals treated with zidovudine.: J Neurol. 1993 Sep;240(8):479-88. Unique Identifier : AIDSLINE MED/94087245; Manji H; Harrison MJ; Round JM; Jones DA; Connolly S; Fowler CJ; Williams I; Weller IV; Department of Neurological Studies, University College and; Middlesex Hospital School of Medicine, London, UK.; Eleven patients with AIDS or AIDS-related complex who developed muscle-related symptoms whilst taking zidovudine were investigated. The clinical details of a further ten patients who did not undergo muscle biopsy are also outlined. The clinical features, quantitative muscle strength testing, electromyographic findings
Isolated postural tremor revealing HIV-1 infection [letter]: J Neurol. 1993 Sep;240(8):507-8. Unique Identifier : AIDSLINE MED/94087250; Petiot P; Vighetto A; Charles N; Derex L; Trillet M; Aimard G
Drug-related HIV risk behaviors and cocaine preference among injection drug users in Los Angeles.: J Drug Educ. 1993;23(3):259-72. Unique Identifier : AIDSLINE MED/94087421; Longshore D; Anglin MD; Hsieh SC; Annon K; University of California, Los Angeles.; Based on a 1988-91 sample of 422 drug-using arrestees in Los Angeles, this study compares the drug-related risk behavior of users whose preferred injection drug is cocaine and users with a preference for heroin or no preference between the two drugs. Cocaine preference is unrelated to the likelihood of needle sharing
Relationship between race and lymphocyte function during acute gingival inflammation.: J Periodontal Res. 1993 Nov;28(6 Pt 2):514-6. Unique Identifier : AIDSLINE MED/94087480; Rowland RW; Department of Periodontics, Medical College of Virginia, Virginia; Commonwealth University, Richmond 23298-0566.
Alteration of in vivo cytokine gene expression in mice infected with a molecular clone of the defective MAIDS virus.: J Acquir Immune Defic Syndr. 1994 Jan;7(1):1-9. Unique Identifier : AIDSLINE MED/94087524; Bradley WG; Ogata N; Good RA; Day NK; All Children's Hospital, Laboratory of Immunosuppressive; Retrovirology, St. Petersburg, FL 33701.; The discovery of T helper type 1 (Th1) and T helper type 2 (Th2) phenotypes within the CD4+ T-lymphocyte population has allowed for further elucidation of the roles the T cells play in regulation of humoral and cellular immunity. It is suggested that differential activation of the CD4+ subsets, particularly up-regulat
High rate of HIV isolation from plasma of asymptomatic patients through polyethylene glycol (PEG) treatment.: J Acquir Immune Defic Syndr. 1994 Jan;7(1):10-4. Unique Identifier : AIDSLINE MED/94087525; Sarmati L; Ercoli L; Parisi SG; Rocchi G; Giannini G; Galluzzo C; Vella S; Andreoni M; Department of Public Health and Cellular Biology, University of; Rome Tor Vergata, Italy.; The usefulness of traditional methods of HIV plasma titration has been limited by poor detection capacity in the asymptomatic phase of HIV disease. We analyzed plasma samples from asymptomatic seropositive or early symptomatic patients, comparing the classic plasma culture method with the following techniques: phorbol
HIV-1 strain dependence of complement-mediated virolysis induced by recombinant CD4-IgG [letter]: J Acquir Immune Defic Syndr. 1994 Jan;7(1):100-1. Unique Identifier : AIDSLINE MED/94087526; Spear GT; Ghassemi M; Takefman DM
Selective inhibition of human immunodeficiency virus type 1 replication by novel fluoroalkylated oligomers in vitro.: J Acquir Immune Defic Syndr. 1994 Jan;7(1):24-30. Unique Identifier : AIDSLINE MED/94087528; Baba M; Kira T; Shigeta S; Matsumoto T; Sawada H; Department of Microbiology, Fukushima Medical College, Japan.; Several fluoroalkylated oligomers were found to be potent and selective inhibitors of human immunodeficiency virus type 1 (HIV-1) in vitro. Among the test compounds, bis(perfluoro-1,4,7,10-tetramethyl-2,5,8,11-tetraoxatetradecyl+ ++)methacrylic acid oligomer (MAA-HFPO5) emerged as the most potent inhibitor of HIV-1 re
Shortcomings of chest radiography in detecting Pneumocystis carinii pneumonia.: J Acquir Immune Defic Syndr. 1994 Jan;7(1):39-45. Unique Identifier : AIDSLINE MED/94087530; Opravil M; Marincek B; Fuchs WA; Weber R; Speich R; Battegay M; Russi EW; Luthy R; Department of Medicine, University Hospital, Zurich, Switzerland.; The radiographic presentation of Pneumocystis carinii pneumonia (PCP) was studied in 93 consecutive patients to determine the frequency of normal findings on chest roentgenograms and possible correlations with clinical or laboratory findings. The roentgenograms were reviewed by two radiologists in an independent, blin
Endocrine function in the HIV wasting syndrome [see comments]: J Acquir Immune Defic Syndr. 1994 Jan;7(1):46-51. Unique Identifier : AIDSLINE MED/94087531; Coodley GO; Loveless MO; Nelson HD; Coodley MK; Oregon Health Sciences University, Portland 97201-3098.; We compared endocrine function in patients with the HIV wasting syndrome with other HIV-positive patients without wasting to determine associations between endocrine dysfunction and wasting. Sixty-six HIV-seropositive patients were evaluated by thyroid, gonadal, and adrenal function tests. Fourteen of these patients m
Evaluation of recalcitrant pain in HIV-infected hospitalized patients.: J Acquir Immune Defic Syndr. 1994 Jan;7(1):52-6. Unique Identifier : AIDSLINE MED/94087532; Anand A; Carmosino L; Glatt AE; Department of Medicine, Nassau County Medical Center, East; Meadow, New York.; Chronic refractory severe pain in HIV-infected patients is a common and often neglected problem. Little data exist evaluating its epidemiology, clinical features, and treatment. Our study assessed all HIV-infected inpatients referred to the pain control service over a 2-year span. All (24) inpatients with HIV infectio
Altered cortisol response and hippocampal atrophy in pediatric HIV disease.: J Acquir Immune Defic Syndr. 1994 Jan;7(1):57-62. Unique Identifier : AIDSLINE MED/94087533; Oberfield SE; Cowan L; Levine LS; George A; David R; Litt A; Rojas V; Kairam R; Department of Pediatrics, New York University Medical Center, New; York 10016.; The hippocampus is a major center for the regulation of the hypothalamic-pituitary-adrenal axis. There is experimental evidence that chronic exposure to high levels of glucocorticoids may be toxic to the hippocampus. We observed elevated mean basal and 60-min cortisol (F) levels in response to adrenocorticotropin stim
Lack of association between anti-V3 loop antibody and perinatal HIV-1 transmission in Kinshasa, Zaire, despite use of assays based on local HIV-1 strains.: J Acquir Immune Defic Syndr. 1994 Jan;7(1):63-7. Unique Identifier : AIDSLINE MED/94087534; St Louis ME; Pau CP; Nsuami M; Ou CY; Matela B; Kashamuka M; Brown C; George JR; Heyward WL; Projet SIDA, Kinshasa, Zaire.; Maternal antibodies against the V3 loop principal neutralizing domain (PND) have been reported to protect against perinatal HIV-1 transmission. To study this association in an African city with a long-standing HIV epidemic and no established consensus sequence for the V3 loop region of gp120, we determined the DNA seq
Backcalculation of the number infected with human immunodeficiency virus in Germany.: J Acquir Immune Defic Syndr. 1994 Jan;7(1):74-8. Unique Identifier : AIDSLINE MED/94087536; Seydel J; Kramer A; Rosenberg PS; Wittkowski KM; Gail MH; Department of Medical Biometry, University of Tubingen, Germany.; The method of backcalculation was used to estimate the cumulative number of human immunodeficiency virus type 1 (HIV-1)-infected adults in Germany from reporting delay-corrected surveillance data on acquired immunodeficiency syndrome (AIDS) in the pretreatment era. Using different
Changes in employment, insurance, and income in relation to HIV status and disease progression. The Multicenter AIDS Cohort Study.: J Acquir Immune Defic Syndr. 1994 Jan;7(1):86-91. Unique Identifier : AIDSLINE MED/94087538; Kass NE; Munoz A; Chen B; Zucconi SL; Bing EG; Department of Health Policy and Management, Johns Hopkins School; of Public Health, Baltimore, Maryland.; While patterns of health care financing for HIV have received considerable attention in the literature, the financial impact of disease on individuals living with HIV infection has been underexplored, particularly in relation to disease progression. Therefore, we sought to document changes in employment, income, and i
Changes in hematologic parameters among Japanese HTLV-I carriers.: J Acquir Immune Defic Syndr. 1994 Jan;7(1):92-7. Unique Identifier : AIDSLINE MED/94087539; Welles SL; Tachibana N; Orav EJ; Okayama A; Ishizaki J; Mueller NE; Department of Epidemiology, Harvard School of Public Health,; Boston, MA 02115.; Hematologic data from 1,039 persons who participated in the Miyazaki Cohort study on human T-cell lymphotropic virus type-I (HTLV-I) infection were analyzed. Individuals were classified by HTLV-I antibody status and the presence of abnormal lymphocytes (Ably). We identified several differences in selected leukocyte po
The use of the term thrush [letter; comment]: J Acquir Immune Defic Syndr. 1994 Jan;7(1):98. Unique Identifier : AIDSLINE MED/94087540; Pindborg JJ
HIV-1 and HBV infection in street youth lodged in security institutes of Buenos Aires [letter]: J Acquir Immune Defic Syndr. 1994 Jan;7(1):98-100. Unique Identifier : AIDSLINE MED/94087541; Libonatti O; Casanueva E; Avila MM; Gomez Carrillo M; Piccardo C; Cammarieri G; Weissenbacher M
Pneumocystis carinii pneumonia in children with perinatally acquired HIV infection [letter; comment]: JAMA. 1994 Jan 12;271(2):102; discussion 103. Unique Identifier : AIDSLINE MED/94087882; Eppes SC; Turner BJ; Markson LE
Pneumocystis carinii pneumonia in children with perinatally acquired HIV infection [letter; comment]: JAMA. 1994 Jan 12;271(2):102-3. Unique Identifier : AIDSLINE MED/94087883; Chavkin W
Pneumocystis carinii pneumonia in children with perinatally acquired HIV infection [letter; comment]: JAMA. 1994 Jan 12;271(2):103. Unique Identifier : AIDSLINE MED/94087884; Meyers A
Syringe and needle exchange as HIV/AIDS prevention for injection drug users [see comments]: JAMA. 1994 Jan 12;271(2):115-20. Unique Identifier : AIDSLINE MED/94087889; Watters JK; Estilo MJ; Clark GL; Lorvick J; Urban Health Study, Institute for Health Policy Studies, School; of Medicine, University of California, San Francisco 94143-1304.; OBJECTIVE--To evaluate an all-volunteer syringe exchange program in San Francisco, Calif. DATA SOURCES--Syringe exchange program records and 11 semiannual surveys administered during a 5.5-year period, using standard questionnaires. Interviews (N = 5644) were conducted with injection drug users recruited in two 21-day
Continuity and change within an HIV epidemic. Injecting drug users in New York City, 1984 through 1992 [see comments]: JAMA. 1994 Jan 12;271(2):121-7. Unique Identifier : AIDSLINE MED/94087890; Des Jarlais DC; Friedman SR; Sotheran JL; Wenston J; Marmor M; Yancovitz SR; Frank B; Beatrice S; Mildvan D; Beth Israel Medical Center, National Development and Research; Institutes Inc, New York, NY 10013.; OBJECTIVES--To examine trends in acquired immunodeficiency syndrome (AIDS) risk behavior and human immunodeficiency virus (HIV) seroprevalence among injecting drug users (IDUs) in New York City from 1984 through 1992. DESIGN AND SETTING--Comparisons were made between two surveys of IDUs at the same hospital-based New
'Into whatever houses I enter'. HIV and injecting drug use [editorial; comment]: JAMA. 1994 Jan 12;271(2):151-2. Unique Identifier : AIDSLINE MED/94087896; Wartenberg AA
[The immunology of mycobacterial diseases]: Kekkaku. 1993 Nov;68(11):715-21. Unique Identifier : AIDSLINE MED/94087958; Ando M; First Department of Internal Medicine, Kumamoto University School; of Medicine, Japan.; Protection and pathogenesis of tuberculosis greatly depend on specific T lymphocytes. Recent evidence suggests the existence of at least two pathways of acquired specific resistance to M. tuberculosis infection: The first consists of cytokine-mediated activation of infected host cells by protective CD4+ T cells, which
[Expectation of new antituberculous drugs and targeting therapy for treatment of mycobacterial infections]: Kekkaku. 1993 Nov;68(11):723-30. Unique Identifier : AIDSLINE MED/94087959; Tomioka H; Department of Microbiology and Immunology, Shimane Medical; University, Japan.; Recent AIDS endemic causes the worldwide increase in intractable mycobacterial infections including extrapulmonary tuberculosis due to drug resistant organisms and disseminated Mycobacterium avium complex infections. Therefore, new antituberculous (antimycobacterial) drugs and development of regimens and protocols for
Transforming growth factor beta increases the expression of HIV-1 gene in transfected human mesangial cells.: Kidney Int. 1993 Nov;44(5):1022-9. Unique Identifier : AIDSLINE MED/94087962; Shukla RR; Kumar A; Kimmel PL; Department of Molecular Biology, George Washington University; Medical Center, Washington, D.C.; Human immunodeficiency virus type 1 (HIV) infection is often complicated by focal glomerulosclerosis (FGS) and other renal lesions collectively termed HIV associated nephropathy (HIVAN). FGS is characterized by glomerular mesangial expansion and increased synthesis of matrix components. The molecular pathogenic mechan
[Treatment of hematogenic osteomyelitis in newborns]: Khirurgiia (Mosk). 1993 Aug;(8):62-6. Unique Identifier : AIDSLINE MED/94088004; Kononov VS; Sultanalieva AS; The authors studied the immunobiological condition of the newborn s organism and the process of bone structure reparation before and after direct immune hemotransfusions and transplantation of bone marrow with the stroma in a mixture with antibiotics into the focus of osteomyelitis in the bone of newborn infants with
Expression of Lyn protein on human malignant lymphomas.: Lab Invest. 1993 Dec;69(6):736-42. Unique Identifier : AIDSLINE MED/94088069; Choi SH; Yamanashi Y; Shiota M; Takanashi M; Hojo I; Itoh T; Watanabe T; Yamamoto T; Mori S; Department of Pathology and Oncology, University of Tokyo.; BACKGROUND: lyn is one of the src family genes encoding protein-tyrosine kinases, expressed preferentially in B lymphocytes and monocytes/macrophages. Its gene product, Lyn protein, is thought to participate in cell membrane-associated signal transduction on B lymphocytes by associating physically and functionally wit
Vitamin E and alpha-lipoate: role in antioxidant recycling and activation of the NF-kappa B transcription factor.: Mol Aspects Med. 1993;14(3):229-39. Unique Identifier : AIDSLINE MED/94088209; Packer L; Suzuki YJ; Department of Molecular and Cell Biology, University of; California, Berkeley 94720.; Nuclear factor kappa B (NF-kappa B) is believed to play an important role in the activation of human immunodeficiency virus (HIV) which causes acquired immunodeficiency syndrome (AIDS). Recent findings suggesting an involvement of reactive oxygen species in signal transduction pathways leading to NF-kappa B activation
Detection of variability in natural populations of viruses by polymerase chain reaction.: Methods Enzymol. 1993;224:428-38. Unique Identifier : AIDSLINE MED/94088285; Chang SY; Shih A; Kwok S; Roche Molecular Systems, Inc., Alameda, California 94501.
Prevention of HIV and HBV transmission in general practice [letter; comment]: Med J Aust. 1993 Dec 6-20;159(11-12):836. Unique Identifier : AIDSLINE MED/94088384; Bajada S
In vitro selection of DNA elements highly responsive to the human T-cell lymphotropic virus type I transcriptional activator, Tax.: Mol Cell Biol. 1994 Jan;14(1):456-62. Unique Identifier : AIDSLINE MED/94088544; Paca-Uccaralertkun S; Zhao LJ; Adya N; Cross JV; Cullen BR; Boros IM; Giam CZ; Department of Medicine, Case Western Reserve University,; Cleveland, Ohio 44106.; The human T-cell lymphotropic virus type I (HTLV-I) transactivator, Tax, the ubiquitous transcriptional factor cyclic AMP (cAMP) response element-binding protein (CREB protein), and the 21-bp repeats in the HTLV-I transcriptional enhancer form a ternary nucleoprotein complex (L. J. Zhao and C. Z. Giam, Proc. Natl. Aca
Sensitive and quantitative detection of PCR-amplified HIV-1 DNA products by an enzyme linked immunoassay following solution hybridization with two differently labelled oligonucleotide probes.: Mol Cell Probes. 1993 Oct;7(5):361-71. Unique Identifier : AIDSLINE MED/94088608; Boni J; Schupbach J; Swiss National Center for Retroviruses, Institute for Medical; Virology, University of Zurich.; We have developed and evaluated an ELISA-based detection method for PCR-amplified HIV-1 DNA. The assay uses two oligonucleotide probes which are end-labelled at the 5 -end with biotin or digoxigenin, respectively. Upon solution hybridization of these probes which react with the same strand of amplified DNA product, th
AAEM minimonograph #41: neuromuscular diseases associated with HIV-1 infection.: Muscle Nerve. 1994 Jan;17(1):16-30. Unique Identifier : AIDSLINE MED/94088641; Lange DJ; Department of Neurology, Columbian-Presbyterian Medical Center,; New York, New York.; Neuromuscular diseases occur in as many as 50% of patients infected with human immunodeficiency virus type 1 (HIV-1). All forms of neuromuscular disease have been reported, including axonal neuropathy, demyelinating neuropathy, mononeuropathy multiplex, polyradiculitis, ALS-like syndromes, disorders of neuromuscular t
Brief report: infection of a laboratory worker with simian immunodeficiency virus [see comments]: N Engl J Med. 1994 Jan 20;330(3):172-7. Unique Identifier : AIDSLINE GENBANK/S67406; Khabbaz RF; Heneine W; George JR; Parekh B; Rowe T; Woods T; Switzer WM; McClure HM; Murphey-Corb M; Folks TM; Division of Viral and Rickettsial Diseases, National Center for; Infectious Diseases, Centers for Disease Control and Prevention,; Atlanta, GA 30333.
Simian immunodeficiency virus in people [editorial; comment]: N Engl J Med. 1994 Jan 20;330(3):209-10. Unique Identifier : AIDSLINE MED/94088694; Essex M
Identification of the perfect state of Cryptococcus neoformans from 195 clinical isolates including 84 from AIDS patients.: Mycopathologia. 1993 Aug;123(2):65-8. Unique Identifier : AIDSLINE MED/94088717; Madrenys N; De Vroey C; Raes-Wuytack C; Torres-Rodriguez JM; Department of Microbiology, Autonomous University of Barcelona,; Spain.; Filobasidiella neoformans is the teleomorphic state of Cryptococcus neoformans and it is a heterothalic. The purpose of this study was to establish the proportions of each mating types (a, alpha) from among 195 strains of C. neoformans isolated from clinical material. The culture medium used was sunflower agar. Cultur
AIDS update: the HIV epidemic: what lies ahead?: Nurs RSA. 1993 Oct;8(10):14-5. Unique Identifier : AIDSLINE MED/94088724; Esterhuyse T; Doyle P
Should AIDS be notifiable? [letter; comment]: Nurs RSA. 1993 Oct;8(10):2. Unique Identifier : AIDSLINE MED/94088727; Daniels NL
Old AIDS news dressed up as new [news]: Nature. 1993 Dec 23-30;366(6457):714. Unique Identifier : AIDSLINE MED/94088738; Clarke M
AIDS, HIV and the Sunday Times [letter] [see comments]: Nature. 1993 Dec 23-30;366(6457):716. Unique Identifier : AIDSLINE MED/94088740; Garnett G; Anderson R
AIDS-related stigma and homophobia: implications for nursing education.: Nurse Educ. 1993 Nov-Dec;18(6):27-30. Unique Identifier : AIDSLINE MED/94088982; Eliason MJ; Healthcare workers attitudes about acquired immune deficiency syndrome (AIDS) are influenced by two major types of fears: AIDS-related stigma refers to irrational fears about contracting the virus and about death and dying issues, whereas homophobia refers to irrational fears or negative attitudes about same-sex sexu
Educating about S.T.D.s [letter]: Nursing. 1993 Apr;23(4):6. Unique Identifier : AIDSLINE MED/94089023; Clarke P
Endemic African Kaposi's sarcoma: clinical and therapeutic implications. 10-year experience in the Johannesburg Hospital (1980-1990).: Oncology. 1994 Jan-Feb;51(1):63-9. Unique Identifier : AIDSLINE MED/94089092; Stein ME; Spencer D; Ruff P; Lakier R; MacPhail P; Bezwoda WR; Department of Medical Oncology and Clinical Hematology,; Johannesburg General Hospital, Republic of South Africa.; Endemic African Kaposi s sarcoma is a common neoplastic disorder in the sub-Saharan region of Africa. We present a retrospective analysis of 47 black patients with the endemic African (HIV-negative) variant of Kaposi s sarcoma treated and followed up in the Johannesburg General Hospital between 1980 and 1990. Four pat
Test and teach. Number seventy-two. Diagnosis: Bacillary angiomatosis.: Pathology. 1993 Jul;25(3):253, 319-20. Unique Identifier : AIDSLINE MED/94089272; Bogle MS; Matich MD; French MA; Matz LR; Department of Histopathology and Clinical Immunology, Royal Perth; Hospital, Western Australia.
Osteomyelitis due to Mycobacterium haemophilum in a patient with AIDS.: Pathology. 1993 Jul;25(3):308-9. Unique Identifier : AIDSLINE MED/94089283; Sowden D; Kemp R; Dawson D; Department of Microbiology, Royal Brisbane Hospital.; A case of osteomyelitis resulting from infection with Mycobacterium haemophilum in a patient with the Acquired Immunodeficiency Syndrome (AIDS) and Hodgkin s disease is described. The clinical features and response to therapy are examined and compared to previous reported cases. Mycobacterium haemophilum infection in
Tuberculosis: shades of AIDS [editorial]: Pediatr Ann. 1993 Oct;22(10):595-7. Unique Identifier : AIDSLINE MED/94089292; Hoekelman RA
Current epidemiology of tuberculosis.: Pediatr Ann. 1993 Oct;22(10):600-4. Unique Identifier : AIDSLINE MED/94089293; McSherry G; Connor E; Department of Pediatrics, Children's Hospital of New Jersey.; After years of decline, tuberculosis has become an increasing cause of morbidity and mortality in the United States . Chronic problems of poverty, homelessness, substandard housing, and poor access to health care have combined to help maintain a reservoir of infected persons. The additi
Human immunodeficiency virus 1-specific IgA capture enzyme immunoassay for early diagnosis of human immunodeficiency virus 1 infection in infants. NYC Perinatal HIV Transmission Study Group.: Pediatr Infect Dis J. 1993 Nov;12(11):908-13. Unique Identifier : AIDSLINE MED/94089309; Parekh BS; Shaffer N; Coughlin R; Hung CH; Krasinski K; Abrams E; Bamji M; Thomas P; Hutson D; Lambert G; et al; Division of HIV/AIDS, National Center for Infectious Diseases,; Centers for Disease Control and Prevention, Atlanta, GA.; A simplified human immunodeficiency virus 1 (HIV-1)-specific IgA capture enzyme immunoassay (IgA-CEIA) was evaluated and compared with IgA-Western blot assay for early diagnosis of HIV-1 infection in infants born to seropositive women. A total of 232 coded sera collected prospectively from 70 infants were tested. All
Plasma immunotherapy in a child with acquired immunodeficiency syndrome.: Pediatr Infect Dis J. 1993 Nov;12(11):947-51. Unique Identifier : AIDSLINE MED/94089317; Wong VK; Gillette SG; Roth MJ; Miles S; Stiehm ER; Department of Pediatrics, Kaiser Permanente Medical Group,; Bellflower, CA.
Midwifery pays tribute to HIV specialist [news]: Nurs Times. 1993 Nov 24-30;89(47):7. Unique Identifier : AIDSLINE MED/94089433
Students' views on caring for people with AIDS [news]: Nurs Times. 1993 Dec 1-7;89(48):12. Unique Identifier : AIDSLINE MED/94089436; Pederson C
World AIDS Day. Professional help [interview by Daloni Carlisle]: Nurs Times. 1993 Dec 1-7;89(48):24-6. Unique Identifier : AIDSLINE MED/94089439; Mayho P
World AIDS Day. Positive thinking.: Nurs Times. 1993 Dec 1-7;89(48):26-8. Unique Identifier : AIDSLINE MED/94089440; Reid T
World AIDS Day. Men at work [interview by Paul Mangan]: Nurs Times. 1993 Dec 1-7;89(48):29-30. Unique Identifier : AIDSLINE MED/94089441; Bryan G
World AIDS Day. Useful organizations.: Nurs Times. 1993 Dec 1-7;89(48):31. Unique Identifier : AIDSLINE MED/94089443
Computing. Point of contact.: Nurs Times. 1993 Dec 1-7;89(48):66-7. Unique Identifier : AIDSLINE MED/94089453; Mitchell D
AIDS services to enter mainstream [news]: Nurs Times. 1993 Dec 1-7;89(48):9. Unique Identifier : AIDSLINE MED/94089454; Carlisle D
HIV infections of the central nervous system. What are the nursing implications?: Nurs Clin North Am. 1993 Dec;28(4):839-47. Unique Identifier : AIDSLINE MED/94089464; Loder PA; University of Dentistry and Medicine of New Jersey, Robert Wood; Johnson Medical School, New Brunswick 08901.; HIV disease attacks people without regard to age, race, gender or socioeconomic status, and the number of people affected continues to increase. The increased incidence of disease and increased length of survival will lead to a rise in HIV-related CNS syndromes. CNS involvement adds to the complexity of the disease an
The lived experience of self-transcendence in gay men with AIDS.: Oncol Nurs Forum. 1993 Oct;20(9):1363-8. Unique Identifier : AIDSLINE MED/94089481; Coward DD; Lewis FM; School of Nursing, University of Texas at Austin.; This phenomenologic study described the structure of self-transcendence in eight gay men with AIDS. The men provided oral or written descriptions of experiences associated with feelings of increased interconnectedness with others, sense of well-being, and meaning and purpose in life. The data were analyzed using Colai
[Anti-Rh(D): an efficacious therapeutic alternative in autoimmune hemocytopenias]: Pediatr Med Chir. 1993 Jul-Aug;15(4):349-52. Unique Identifier : AIDSLINE MED/94089497; Mascarin M; Trovo MG; Ventura A; Divisione di Oncologia Radioterapica, Centro di Riferimento; Oncologico di Aviano, PN.; In the last years high dose intravenous immunoglobulin (i.v.IG) has clearly modified the therapeutic approach toward autoimmune hemocytopenia. Their introduction has promoted the studies on the i.v.IG mechanisms of action: the hypothesis most widely accepted is the blockade of Fc-receptors in the reticuloendothelial s
[Lactate dehydrogenase isoenzymes in HIV-positive children]: Pediatr Med Chir. 1993 Jul-Aug;15(4):381-6. Unique Identifier : AIDSLINE MED/94089503; Pifferi M; Baldini M; Cappuccio A; Consolini R; Innocenti B; Baldini G; Istituto di Clinica Pediatrica, Universita degli Studi di Pisa.; Considering that in the HIV infection there is a precocious deterioration of humoral immunity with rapid turn-over of cellular B clones, we have evaluated the conduct of serum lactate-dehydrogenase activity (LD, EC 1.1.1.27) and its isoenzymes in 21 children born from HIV-positive mother respect to a control group (30
[Anonymous and free-of-charge centers for screening for HIV infection. Results of 30 months of activity in Public Assistance in Paris hospitals]: Presse Med. 1993 Oct 16;22(31):1444-8. Unique Identifier : AIDSLINE MED/94089600; Coutellier A; Levy A; Chassany O; Herson S; Caulin C; Delfraissy JF; Service de Medecine interne, Hopital de la Salpetriere,; Paris.; The results of 30 months of activity of anonymous and free-of-charge HIV detection centres in Paris hospitals are presented. During this period (April 1988 to December 1990), 15805 subjects were seen. This population accounts for about 11 percent of all French anonymous and free detection centres in 1990, and for 26
[Disorders of the bladder sphincter. Etiopathogenic approach]: Presse Med. 1993 Oct 16;22(31):1455-9. Unique Identifier : AIDSLINE MED/94089602; Amarenco G; Kerdraon J; Denys P; Laboratoire d'Urodynamique et de Neurophysiologie, Centre; hospitalier Robert Ballanger, Aulnay-sous-Bois.; Disorders of the vesico-sphincteral system are due to multiple causes (urological, gynaecological, neurological, psycho-behavioural, iatrogenic) which may be associated. By providing information on the type and evolution of these disorders and on the circumstances in which they developed, questioning is fundamental fo
[The century of microbiology]: Presse Med. 1993 Oct 23;22(32):1543-52. Unique Identifier : AIDSLINE MED/94089616; Bergogne-Berezin E; Service de Microbiologie, CHU Bichat-Claude Bernard, Paris.
Catalytic contribution of flap-substrate hydrogen bonds in HIV-1 protease explored by chemical synthesis.: Proc Natl Acad Sci U S A. 1993 Dec 15;90(24):11638-42. Unique Identifier : AIDSLINE MED/94089688; Baca M; Kent SB; Scripps Research Institute, La Jolla, CA 92037.; An analogue of HIV-1 protease was designed in which the ability to donate important water-mediated hydrogen bonds to substrate was precisely and directly deleted. Chemical ligation of unprotected peptide segments was used to synthesize this backbone-engineered enzyme. The functionally relevant amide CONH- linkage betw
Active immunity against the CD4 receptor by using an antibody antigenized with residues 41-55 of the first extracellular domain.: Proc Natl Acad Sci U S A. 1993 Dec 15;90(24):11683-7. Unique Identifier : AIDSLINE MED/94089697; Lanza P; Billetta R; Antonenko S; Zanetti M; Department of Medicine, University of California, San Diego, La; Jolla 92093-0961.; Using the process of antibody antigenization, we engineered two antibody molecules carrying in the third complementarity-determining region of the heavy chain variable domain a 7-mer or a 15-mer peptide epitope of the first extracellular domain (D1) of human CD4 receptor--namely, Ser-Phe-Leu-Thr-Lys-Gly-Pro-Ser (SFLTK
Acyclovir diphosphate dimyristoylglycerol: a phospholipid prodrug with activity against acyclovir-resistant herpes simplex virus.: Proc Natl Acad Sci U S A. 1993 Dec 15;90(24):11835-9. Unique Identifier : AIDSLINE MED/94089726; Hostetler KY; Parker S; Sridhar CN; Martin MJ; Li JL; Stuhmiller LM; van Wijk GM; van den Bosch H; Gardner MF; Aldern KA; et al; Department of Medicine, University of California, San Diego.; Infection with herpes simplex viruses (HSVs) resistant to treatment with acyclovir (9-[(2-hydroxyethoxy)-methyl]guanine, Zovirax ) is a growing clinical problem in patients with AIDS and other immunosuppressed states. Most virus isolates resistant to acyclovir are deficient or de
Highly localized tracks of human immunodeficiency virus type 1 Nef in the nucleus of cells of a human CD4+ T-cell line.: Proc Natl Acad Sci U S A. 1993 Dec 15;90(24):11895-9. Unique Identifier : AIDSLINE MED/94089738; Murti KG; Brown PS; Ratner L; Garcia JV; Department of Virology and Molecular Biology, St. Jude Children's; Research Hospital, Memphis, TN 38101-0318.; A human T-cell line constitutively expressing the nef gene from the human immunodeficiency virus type 1 SF2 isolate was used to examine the distribution of the Nef protein in the nucleus. High-resolution immunogold labeling/electron microscopic studies with polyclonal anti-Nef antibodies on nef+ and nef- cells reveale
Soluble interleukin-6 receptor triggers osteoclast formation by interleukin 6.: Proc Natl Acad Sci U S A. 1993 Dec 15;90(24):11924-8. Unique Identifier : AIDSLINE MED/94089743; Tamura T; Udagawa N; Takahashi N; Miyaura C; Tanaka S; Yamada Y; Koishihara Y; Ohsugi Y; Kumaki K; Taga T; et al; Department of Biochemistry, School of Dentistry, Showa; University, Tokyo, Japan.; It has been reported that soluble interleukin (IL)-6 receptor (sIL-6R) is detected in the serum of healthy individuals and its level is increased in patients with multiple myeloma and human immunodeficiency virus infection. Although several reports have suggested that sIL-6R potentiates IL-6 action, its physiological
Sexually transmitted diseases among young heterosexual urban adults.: Public Health Rep. 1993 Nov-Dec;108(6):673-9. Unique Identifier : AIDSLINE MED/94089864; Melnick SL; Burke GL; Perkins LL; McCreath H; Gilbertson DT; Sidney S; Hulley SB; School of Public Health, Division of Epidemiology, University of; Minnesota.; A self-administered, confidential survey of respondents history of selected sexually transmitted disease (STD) was conducted in 1987-88 among adults enrolled in a multicenter study of cardiovascular disease. Respondents (and response rates) included 535 white men (78 percent), 694 white women (89 percent), 262 black
The impact of critical events of the 1980s on core functions for a selected group of local health departments.: Public Health Rep. 1993 Nov-Dec;108(6):695-700. Unique Identifier : AIDSLINE MED/94089866; Miller CA; Moore KS; Richards TB; Department of Maternal and Child Health, School of Public Health,; University of North Carolina, Chapel Hill 27599.; Directors of 14 public health departments were surveyed for their perceptions on the impact of 20 critical events of the 1980s on public health performance. The departments were selected in 1979 from among those that were highly regarded by public health experts for exemplary performance, especially with regard to per
Health status indicators for the year 2000: projections for Allegheny County, Pennsylvania.: Public Health Rep. 1993 Nov-Dec;108(6):711-5. Unique Identifier : AIDSLINE MED/94089868; Carson CA; Zucconi SL; Department of Ophthalmology, University of Melbourne, Australia.; A consensus set of health status indicators was released in July 1991 by the Centers for Disease Control and Prevention for use by public health officials at the Federal, State, and local levels in identifying and monitoring issues of public health importance. These health status indicators have been projected for the
Condom use among Hispanic men with secondary female sexual partners.: Public Health Rep. 1993 Nov-Dec;108(6):742-50. Unique Identifier : AIDSLINE MED/94089872; Marin BV; Gomez CA; Tschann JM; School of Medicine, University of California, San Francisco.; Greater understanding of psychosocial predictors of the use of condoms among Hispanics is needed in prevention efforts related to the human immunodeficiency virus and sexually transmitted disease epidemics among Hispanics in the United States . A telephone survey was carried out in nine
DNA amplification by the polymerase chain reaction to detect sub-clinical Pneumocystis carinii colonization in HIV-positive and HIV-negative male homosexuals with and without respiratory symptoms.: Respir Med. 1993 Oct;87(7):525-9. Unique Identifier : AIDSLINE MED/94089989; Leigh TR; Kangro HO; Gazzard BG; Jeffries DJ; Collins JV; Department of Respiratory Medicine, Westminster Hospital, London,; U.K.; Pneumocystis carinii colonization was studied in 90 men using the polymerase chain reaction. These comprised ten heterosexual controls; ten HIV-seronegative homosexual controls; 20 HIV-seropositive homosexuals with blood CD4 count > 400 x 10(6) l-1; 20 HIV-seropositive homosexuals with CD4
Lung limited lymphocytic proliferation in human immunodeficiency virus (HIV) infection [letter]: Respir Med. 1993 Oct;87(7):559. Unique Identifier : AIDSLINE MED/94089996; Couderc LJ; Clauvel JP; Caubarrere I
New pathogens in the immunocompromised host.: Recent Results Cancer Res. 1993;132:231-40. Unique Identifier : AIDSLINE MED/94090014; Zinner SH; Brown University Division of Infectious Diseases, Roger Williams; Medical Center, Rhode Island Hospital Providence 02129.
[Elements of nursing care within the framework of home hospice care for patients with HIV infections]: Soins Chir. 1993 Jun-Jul;(148-149):60. Unique Identifier : AIDSLINE MED/94090147; Bonifassi L; Demeleumeester R; Bez G
HIV mistreatment: policy, resources and practice.: Sr Nurse. 1993 Nov-Dec;13(6):19-22. Unique Identifier : AIDSLINE MED/94090175; Jones HM
Is there a link between smoking and HIV?: RN. 1993 Dec;56(12):64. Unique Identifier : AIDSLINE MED/94090222
Drugs by design.: Sci Am. 1993 Dec;269(6):92-8. Unique Identifier : AIDSLINE MED/94090300; Bugg CE; Carson WM; Montgomery JA; Center for Macromolecular Crystallography, University of Alabama; at Birmingham.
AIDS vaccine research. A new goal: preventing disease, not infection [news]: Science. 1993 Dec 17;262(5141):1820-1. Unique Identifier : AIDSLINE MED/94090308; Cohen J
Getting organized to fight AIDS [news]: Science. 1993 Dec 24;262(5142):1963. Unique Identifier : AIDSLINE MED/94090328
East Europe: a chance to stop HIV [news]: Science. 1993 Dec 24;262(5142):1964-5. Unique Identifier : AIDSLINE MED/94090329; Balter M
Prevalence of human herpesvirus 6 in Thai people and its correlation with human immunodeficiency virus type 1 infection.: Southeast Asian J Trop Med Public Health. 1993 Jun;24(2):260-4. Unique Identifier : AIDSLINE MED/94090489; Sutthent R; Puthavathana P; Louisirirotchanakul S; Tunsupasawasdikul S; Wasi C; Thongcharoen P; Department of Microbiology, Faculty of Medicine, Siriraj; Hospital, Mahidol University, Bangkok, Thailand.; Human herpesvirus 6 (HHV-6) is a human herpesvirus isolated from patients with various lymphoproliferative disorders and acquired immunodeficiency syndrome (AIDS). The prevalence of HHV-6 infection and its correlation as a cofactor in pathogenicity of HIV infection was investigated in serum samples from 365 healthy vo
Role of retrovirus HTLV-1 in African spastic paraplegia.: Southeast Asian J Trop Med Public Health. 1993 Jun;24(2):394-5. Unique Identifier : AIDSLINE MED/94090514; Dumas M; Grunitzky EK; Giordano C; N'Diaye IP; Kabore J; Verdier M; Diop AG; Yapi P; Ramiandrisoa H; Preux PM; et al; Institute of Tropical Neurology, Faculty of Medicine Limoges,; France.
Leprosy, Kaposi's sarcoma and the acquired immunodeficiency syndrome in two African patients.: Trans R Soc Trop Med Hyg. 1993 Sep-Oct;87(5):559. Unique Identifier : AIDSLINE MED/94090710; Bwire R; Kawuma HJ; St Francis Leprosy Centre, Buluba, Jinja, Uganda.
Frequent achievement of a drug-free state after orthotopic liver transplantation.: Transplant Proc. 1993 Dec;25(6):3315-9. Unique Identifier : AIDSLINE MED/94090866; Reyes J; Zeevi A; Ramos H; Tzakis A; Todo S; Demetris AJ; Nour B; Nalesnik M; Trucco M; Abu-Elmagd K; et al; Pittsburgh Transplant Institute, Pennsylvania.
Manic episode secondary to cryptococcal meningitis in a previously healthy adult.: P N G Med J. 1993 Mar;36(1):59-62. Unique Identifier : AIDSLINE MED/94091072; Johnson FY; Naraqi S; Department of Clinical Sciences, Faculty of Medicine, University; of Papua New Guinea, Boroko.; A case of a manic episode secondary to cryptococcal meningitis is reported. Cryptococcal meningitis is the most common cause of chronic meningitis in adults in Papua New Guinea and
Insight into the infection dynamics of the AIDS epidemic: a birth cohort analysis of New York City AIDS mortality.: Am J Epidemiol. 1993 Dec 15;138(12):1093-104. Unique Identifier : AIDSLINE MED/94091275; Stoneburner RL; Lessner L; Fordyce EJ; Bevier P; Chiasson MA; New York City Department of Health, NY 10113.; The authors analyzed the secular trends of New York City acquired immunodeficiency syndrome (AIDS) mortality from 1980 through the first quarter of 1991 using birth cohort techniques to provide insight into reasons for temporal changes in growth of the epidemic. By disaggregating AIDS mortality data into composite bir
Effect of intravenous immunoglobulin on inhibition of fibrinogen binding to platelets by sera from patients with immune thrombocytopenia.: Am J Hematol. 1993 Oct;44(2):77-84. Unique Identifier : AIDSLINE MED/94091288; Kamiyama M; Yoshimura Y; Chen K; Arkel YS; Saint Michael's Medical Center, Newark, New Jersey.; We previously described an ELISA to measure the inhibition of platelet glycoprotein IIb/IIIa (GPIIb/IIIa) binding to fibrinogen due to immune complexes and/or anti-platelet antibodies from patients with immune thrombocytopenia (ITP) or HIV-related ITP. Circulating immune complexes (CIC) were the main factor in the inh
Immunologic benefits of breast milk in relation to human milk banking.: Am J Infect Control. 1993 Oct;21(5):235-42. Unique Identifier : AIDSLINE MED/94091622; Arnold LD; Larson E; Human Milk Banking Association of North America, Inc., West; Hartford, CT 06137-0464.; A review of the immunologic benefits of human milk is presented, with emphasis on the antiviral properties of human milk. These properties are so important to infant health that the World Health Organization has restated its recommendation. In all populations, irrespective of HIV infec
Role of infection control practitioners in human immunodeficiency virus testing. APIC Bloodborne Pathogens Committee.: Am J Infect Control. 1993 Oct;21(5):257-62. Unique Identifier : AIDSLINE MED/94091625; Williams CO; Palmer B; Larson E; Pitt H; Weinstein S; Bolyard E; Horan E; Russell B; Minnesota Department of Health, Minneapolis 55440.; BACKGROUND: As a result of the HIV epidemic, the role of the ICP has changed; acute care settings have developed a variety of policies regarding patient and health care worker (HCW) HIV testing and issues related to the HIV-infected HCW. APIC conducted a survey to determine the extent to which ICPs were involved in HC
AIDS: problem solving in infection control. Response to the human immunodeficiency virus epidemic: solutions from the Centers for Disease Control and Prevention and the infection control community.: Am J Infect Control. 1993 Oct;21(5):274-6. Unique Identifier : AIDSLINE MED/94091628; Valenti WM; Community Health Network, Inc., Rochester, NY.
Pneumocystis carinii pneumonia in an HIV-negative, 8-month-old infant [clinical conference]: Ann Allergy. 1993 Dec;71(6):507-13. Unique Identifier : AIDSLINE MED/94091631; Osleeb CS; Slater JE; Children's National Medical Center, Washington, DC.
Pediatric AIDS: clinical, pathologic, and basic science perspective. Introductory remarks.: Ann N Y Acad Sci. 1993 Oct 29;693:1-3. Unique Identifier : AIDSLINE MED/94091647; Rubinstein A; Department of Pediatrics, Albert Einstein College of Medicine,; Bronx, New York 10461.
Neurologic syndromes.: Ann N Y Acad Sci. 1993 Oct 29;693:107-22. Unique Identifier : AIDSLINE MED/94091649; Belman AL; Department of Neurology, School of Medicine, State University of; New York at Stony Brook 11794.; It is now well recognized that HIV-1 associated CNS disease may complicate the course of HIV-1 infection and AIDS in infants and children. It is also well recognized that the neurologic dysfunction in these young patients adds significantly to the morbidity of the disease and is often a devastating complication. It is
Reliability of neurologic assessment in a collaborative study of HIV infection in children.: Ann N Y Acad Sci. 1993 Oct 29;693:123-40. Unique Identifier : AIDSLINE MED/94091650; Kairam R; Kline J; Levin B; Brambilla D; Coulter D; Kuban K; Lansky L; Marshall P; Velez-Borras J; Rodriguez E; St. Luke's/Roosevelt Hospital Center, New York, New York.
Maternal transmission and diagnosis of human immunodeficiency virus during infancy.: Ann N Y Acad Sci. 1993 Oct 29;693:14-9. Unique Identifier : AIDSLINE MED/94091651; Wara DW; Luzuriaga K; Martin NL; Sullivan JL; Bryson YJ; Department of Pediatrics, UCSF, School of Medicine 95143.
Assessing neurobehavioral changes in HIV+ infants and children. A methodological approach.: Ann N Y Acad Sci. 1993 Oct 29;693:141-50. Unique Identifier : AIDSLINE MED/94091652; Fennell EB; Department of Clinical and Health Psychology, University of; Florida, Gainesville 32610.; The rationale and development of a developmental approach to assessing neurobehavioral changes in infants and children exposed to or infected with the HIV-1 virus is presented. Methodological problems in earlier approaches to assessment are reviewed. Among these are measures employed, impact of different treatments on
Opportunistic infections in pediatric HIV disease.: Ann N Y Acad Sci. 1993 Oct 29;693:158-65. Unique Identifier : AIDSLINE MED/94091654; Van Dyke RB; Section of Pediatric Infectious Diseases, Tulane School of; Medicine, New Orleans, Louisiana 70112.
Antiviral therapy for HIV infection in infants and children.: Ann N Y Acad Sci. 1993 Oct 29;693:166-77. Unique Identifier : AIDSLINE MED/94091655; Gershon AA; Department of Pediatrics, Columbia University College of; Physicians and Surgeons, New York, New York 10032.
The clinical evaluation of cytokines and immunomodulators in HIV infection.: Ann N Y Acad Sci. 1993 Oct 29;693:178-85. Unique Identifier : AIDSLINE MED/94091656; Ammann AJ; Ariel Project for Prevention of HIV Transmission from Mother to; Infant Pediatric AIDS Foundation, Novato, California 94949.
Prospects for prevention of vertical transmission of human immunodeficiency virus by immunization.: Ann N Y Acad Sci. 1993 Oct 29;693:194-201. Unique Identifier : AIDSLINE MED/94091658; Cryz SJ Jr; Goldstein H; Furer E; Que JU; Hasler T; Althaus B; Rubinstein A; Swiss Serum and Vaccine Institute, Berne.
Human immune development: implications for congenital HIV infection.: Ann N Y Acad Sci. 1993 Oct 29;693:20-34. Unique Identifier : AIDSLINE MED/94091659; Cunningham-Rundles S; Chen C; Bussel JB; Blankenship C; Veber MB; Sanders-Laufer D; Hinds T; Cervia JS; Edelson P; Department of Pediatrics, New York Hospital, Cornell University; Medical Center, New York 10021.
Tissue culture models of HIV-1 infection.: Ann N Y Acad Sci. 1993 Oct 29;693:202-12. Unique Identifier : AIDSLINE MED/94091660; Lyman WD; Hatch WC; Larocca JN; Rashbaum WK; Department of Pathology, Albert Einstein College of Medicine,; Bronx, New York 10461.
Animal models for perinatal transmission of pathogenic viruses.: Ann N Y Acad Sci. 1993 Oct 29;693:213-28. Unique Identifier : AIDSLINE MED/94091661; Ruprecht RM; Fratazzi C; Sharma PL; Greene MF; Penninck D; Wyand M; Dana-Farber Cancer Institute, Boston, MA 02115.; In earlier work, mouse models have been used to demonstrate the efficacy and lack of toxicity of transplacental and perinatal AZT therapy. These practical small animal models can be useful for evaluating antiviral drugs aimed at common retroviral func
AIDS and the central nervous system. Examining pathobiology and testing therapeutic strategies in the SIV-infected rhesus monkey.: Ann N Y Acad Sci. 1993 Oct 29;693:229-44. Unique Identifier : AIDSLINE MED/94091662; Eiden LE; Rausch DM; da Cunha A; Murray EA; Heyes M; Sharer L; Nohr D; Weihe E; Section on Molecular Neuroscience, National Institute of Mental; Health, National Institutes of Health, Bethesda, Maryland 20892.
Maternal drug use in perinatal HIV studies. The Women and Infants Transmission Study.: Ann N Y Acad Sci. 1993 Oct 29;693:245-8. Unique Identifier : AIDSLINE MED/94091663; Rodriguez EM; Mendez H; Rich K; Sheon A; Fox H; Green K; Diaz C; Brambilla D; Mofenson L; Division of AIDS, National Institute of Allergy and Infectious; Disease, National Institutes of Health, Bethesda, Maryland 20892.
A controlled study of cognitive and language function in school-aged HIV-infected children.: Ann N Y Acad Sci. 1993 Oct 29;693:249-51. Unique Identifier : AIDSLINE MED/94091664; Havens J; Whitaker A; Feldman J; Alvarado L; Ehrhardt A; New York State Psychiatric Institute, New York 10032.
Elective pregnancy terminations and HIV-1.: Ann N Y Acad Sci. 1993 Oct 29;693:252-4. Unique Identifier : AIDSLINE MED/94091665; Rashbaum WK; Lyman WD; Department of Obstetrics & Gynecology, Albert Einstein College of; Medicine, Bronx, New York 10461.
Use of PCR for detection of HIV-1 sequences in babies born to seropositive mothers.: Ann N Y Acad Sci. 1993 Oct 29;693:255-7. Unique Identifier : AIDSLINE MED/94091666; Manak MM; Snider JV; Petersen D; Frederick W; Barnes S; Huang DP; Biotech Research Labs, Rockville, Maryland 20850.
Diagnosis and quantitation of HIV-1 infection in infants and children by whole-blood culture.: Ann N Y Acad Sci. 1993 Oct 29;693:258-61. Unique Identifier : AIDSLINE MED/94091667; Raszka WV Jr; Robb ML; Fowler AK; Roberts CR; Waecker NJ; Ascher DP; Moriarty RA; Goldberg D; Fischer GW; Department of Pediatrics, Uniformed Services University of Health; Sciences, Bethesda, MD 20814.
HIV-specific IgG3 in cord blood. Predictive value for seroreversion.: Ann N Y Acad Sci. 1993 Oct 29;693:262-3. Unique Identifier : AIDSLINE MED/94091668; Caselli D; Marconi M; Maccabruni A; Bossi G; Pasinetti G; Stronati M; Arico M; Department of Pediatrics, IRCCS Policlinico San Matteo,; University of Pavia, Italy.
A rapid, sensitive, PCR-based method for detection of HIV-1 specific nucleic acid in the culture supernatant of infected cells.: Ann N Y Acad Sci. 1993 Oct 29;693:264-7. Unique Identifier : AIDSLINE MED/94091669; Hewlett IK; Joshi B; Riordan G; Pollock L; Epstein JS; Laboratory of Retrovirology, Food and Drug Administration,; Bethesda, Maryland 20892.
HIV-1 specific IgG capture enzyme immunoassay to study the dynamics of HIV-1 antibody and to diagnose HIV-1 infection in infants. NYC Perinatal HIV Transmission Collaborative Study Group.: Ann N Y Acad Sci. 1993 Oct 29;693:268-71. Unique Identifier : AIDSLINE MED/94091670; Parekh B; Shaffer N; Schochetman G; Coughlin RT; Hung CH; George JR; Centers for Disease Control, Atlanta, Georgia 30333.
Detection of HIV-1 IgA by an IgA capture enzyme immunoassay for early diagnosis in infants. NYC Perinatal HIV Transmission Collaborative Study Group.: Ann N Y Acad Sci. 1993 Oct 29;693:272-4. Unique Identifier : AIDSLINE MED/94091671; George JR; Parekh BS; Shaffer N; Coughlin RT; Hung CH; Rogers M; Schochetman G; Centers for Disease Control, Atlanta, Georgia 30333.
Indeterminate western blot in children who serorevert for HIV.: Ann N Y Acad Sci. 1993 Oct 29;693:275-6. Unique Identifier : AIDSLINE MED/94091672; Caselli D; Maccabruni A; Deicas A; Bossi G; Degioanni M; Achilli G; Arico M; Department of Pediatrics, IRCCS Policlinico San Matteo,; University of Pavia, Italy.
Analysis of the HIV-1 envelope V3-loop sequences from ten mother-child pairs.: Ann N Y Acad Sci. 1993 Oct 29;693:277-80. Unique Identifier : AIDSLINE MED/94091673; Scarlatti G; Leitner T; Halapi E; Wahlberg J; Jansson M; Wigzell H; Fenyo EM; Albert J; Uhlen M; Rossi P; Department of Virology, Karolinska Institute, Stockholm, Sweden.
The presence of cryptococcal capsular polysaccharide increases the sensitivity of HIV-1 coculture in children.: Ann N Y Acad Sci. 1993 Oct 29;693:281-3. Unique Identifier : AIDSLINE MED/94091674; Pettoello-Mantovani M; Casadevall A; Goldstein H; Department of Pediatrics, Albert Einstein College of Medicine,; Bronx, New York 10461.
HCV vertical transmission in infants born to HIV-HCV seropositive mothers.: Ann N Y Acad Sci. 1993 Oct 29;693:284-5. Unique Identifier : AIDSLINE MED/94091675; Maccabruni A; Caselli D; Degioanni M; Institute of Infectious Diseases, IRCCS Policlinico S. Matteo,; University of Pavia, Italy.
Preliminary data on Chlamydia pneumoniae seroprevalence in HIV-1 infected children.: Ann N Y Acad Sci. 1993 Oct 29;693:286-7. Unique Identifier : AIDSLINE MED/94091676; Plebani A; Schoeller MC; Blasi F; Cosentini R; I Pediatric Clinic, University of Milan, Italy.
Mycobacterium avium complex in HIV-infected children.: Ann N Y Acad Sci. 1993 Oct 29;693:288-90. Unique Identifier : AIDSLINE MED/94091677; Gleason-Morgan D; Church JA; Ross LA; Division of Allergy-Clinical Immunology, Childrens Hospital Los; Angeles, California 90027.
Peripheral B-cell activation and immaturity in HIV-infected children.: Ann N Y Acad Sci. 1993 Oct 29;693:291-4. Unique Identifier : AIDSLINE MED/94091678; Rodriguez C; Stiehm ER; Plaeger-Marshall S; Department of Pediatrics, UCLA School of Medicine 90024.
Central nervous system in pediatric AIDS. Results from Neuropathologic Pediatric AIDS Registry.: Ann N Y Acad Sci. 1993 Oct 29;693:295-6. Unique Identifier : AIDSLINE MED/94091679; Kozlowski PB; Sher JH; Rao C; Anzil PA; Wrzolek MA; Sharer L; Cho ES; Dickson DW; Weidenheim KM; Llena JF; et al; New York State Institute for Basic Research, Staten Island 10314.
Administration of aerosolized pentamidine to HIV-infected infants.: Ann N Y Acad Sci. 1993 Oct 29;693:300-1. Unique Identifier : AIDSLINE MED/94091681; Hand IL; Wiznia A; Porricola M; Bronx Lebanon Hospital Center, Albert Einstein College of; Medicine, New York 10457.
Pharmacokinetics of trimetrexate glucuronate in infants with AIDS and Pneumocystis carinii pneumonia.: Ann N Y Acad Sci. 1993 Oct 29;693:302-5. Unique Identifier : AIDSLINE MED/94091682; Freij BJ; Wientzen RL Jr; Hayek G; Whitfield LR; Department of Pediatrics, William Beaumont Hospital, Royal Oak,; Michigan 48073.
Evaluation of anti-HIV agents in vitro by quantitative PCR.: Ann N Y Acad Sci. 1993 Oct 29;693:306-8. Unique Identifier : AIDSLINE MED/94091683; Joshi B; Epstein J; Lee SF; Mayner R; Hewlett IK; Laboratory of Retrovirology, Food and Drug Administration,; Bethesda, Maryland 20892.
Immunoregulation of tumor necrosis factor production by HIV-1 gp-120 in neonates and adults.: Ann N Y Acad Sci. 1993 Oct 29;693:309-11. Unique Identifier : AIDSLINE MED/94091684; Nair MP; Sweet AM; Schwartz SA; Department of Medicine, State University of New York at Buffalo; 14203.
Different strains of HIV-1 infect distinct human fetal neural cells.: Ann N Y Acad Sci. 1993 Oct 29;693:312-3. Unique Identifier : AIDSLINE MED/94091685; Hatch WC; Pousada E; Losev L; Lyman WD; Department of Pathology, Albert Einstein College of Medicine,; Bronx, New York 10461.
Productive infection of human fetal microglia in vitro by HIV-1.: Ann N Y Acad Sci. 1993 Oct 29;693:314-6. Unique Identifier : AIDSLINE MED/94091686; Lee SC; Hatch WC; Liu W; Brosnan CF; Dickson DW; Department of Pathology (Neuropathology), Albert Einstein College; of Medicine, Bronx, New York 10461.
HIV infection of human cortical neuronal cells. Enhancement by differentiating growth factor.: Ann N Y Acad Sci. 1993 Oct 29;693:317-9. Unique Identifier : AIDSLINE MED/94091687; Rodriguez R; Renne S; Volsky DJ; Mizrachi Y; Columbia University, St. Luke's-Roosevelt Hospital, New York, New; York 10019.
Neural cell receptor for HIV-1. Initial biochemical characterization.: Ann N Y Acad Sci. 1993 Oct 29;693:320-3. Unique Identifier : AIDSLINE MED/94091688; Mizrachi Y; Division of Allergy and Immunology, Albert Einstein College of; Medicine of Yeshiva University, Bronx, New York 10461-1602.
HIV-1 mRNA transcripts from persistently infected human fetal astrocytes.: Ann N Y Acad Sci. 1993 Oct 29;693:324-5. Unique Identifier : AIDSLINE MED/94091689; Atwood WJ; Tornatore CS; Meyers K; Major EO; Laboratory of Viral and Molecular Pathogenesis, National; Institute of Neurological Disorders and Stroke, National; Institutes of Health, Bethesda, Maryland 20892.
Epidemiology of pediatric human immunodeficiency virus infection in the United States.: Ann N Y Acad Sci. 1993 Oct 29;693:4-8. Unique Identifier : AIDSLINE MED/94091691; Rogers MF; Caldwell MB; Gwinn ML; Simonds RJ; Centers for Disease Control and Prevention, U.S. Department of; Health and Human Services, Atlanta, Georgia 30333.; HIV infection is an important cause of morbidity and mortality in the pediatric population. Providers of health care to children need to be aware of the problem and the characteristics of the most affected populations. Early diagnosis of HIV infection is critical for initiating appropriate antiviral therapy and prophy
Reservoirs of HIV infection or carriage: monocytic, dendritic, follicular dendritic, and B cells.: Ann N Y Acad Sci. 1993 Oct 29;693:52-64. Unique Identifier : AIDSLINE MED/94091692; Laurence J; Department of Medicine, Cornell University Medical College, New; York, New York 10021.
Pathology of pediatric AIDS. Overview, update, and future direction.: Ann N Y Acad Sci. 1993 Oct 29;693:71-92. Unique Identifier : AIDSLINE MED/94091694; Joshi VV; Department of Pathology and Laboratory Medicine, East Carolina; University School of Medicine, Greenville, North Carolina; 27858-4354.
Antibody in human immunodeficiency virus infection.: Ann N Y Acad Sci. 1993 Oct 29;693:9-13. Unique Identifier : AIDSLINE MED/94091695; Brunell PA; Division of Infectious Diseases, Ahmanson Pediatric Centers,; Cedars-Sinai Medical Center, UCLA School of Medicine 90048.
Central nervous system pathology in pediatric AIDS.: Ann N Y Acad Sci. 1993 Oct 29;693:93-106. Unique Identifier : AIDSLINE MED/94091696; Dickson DW; Llena JF; Nelson SJ; Weidenheim KM; Department of Pathology (Neuropathology), Albert Einstein College; of Medicine, Bronx, New York 10461.; Children with AIDS frequently have neurological manifestations due to complications of immunodeficiency or intrinsic effects of human immunodeficiency virus type 1 (HIV-1) on the central nervous system (CNS). The most common neurological disorders not directly related to HIV-1 infection include cerebrovascular disease
HIV nephropathy management with peritoneal dialysis.: ANNA J. 1993 Dec;20(6):688-9. Unique Identifier : AIDSLINE MED/94091838; McGann E; Clark MK
Sex, AIDS, and the elderly [editorial]: Arch Intern Med. 1994 Jan 10;154(1):19-20. Unique Identifier : AIDSLINE MED/94091913; Feldman MD
AIDS risk behaviors among late middle-aged and elderly Americans. The National AIDS Behavioral Surveys.: Arch Intern Med. 1994 Jan 10;154(1):57-63. Unique Identifier : AIDSLINE MED/94091919; Stall R; Catania J; Department of Epidemiology and Biostatistics, University of; California, San Francisco.; OBJECTIVES: Although 10% of all acquired immunodeficiency syndrome (AIDS) cases diagnosed in the United States have been among Americans aged 50 years of age or older, little attention has been devoted to understanding AIDS risk-taking behaviors among middle-aged or older Americans. Th
Use of a rule based graph-theoretical system in evaluating the activity of a class of nucleoside analogues against human immunodeficiency virus.: Arzneimittelforschung. 1993 Oct;43(10):1122-5. Unique Identifier : AIDSLINE MED/94092244; Raychaudhury C; Dey I; Bag P; Biswas G; Das BN; Roy PK; Banerjee A; Department of Biophysics and Macromolecular Science, Bose; Institute, Calcutta, India.; A rule based graph-theoretical system has been used to evaluate qualitatively the activity of a class of nucleoside analogues against human immunodeficiency virus (HIV). The system identifies biologically relevant vertices (atoms) in the molecular graphs of the compounds which have the biological activity of interest.
Esophageal ulcers as presenting features of human immunodeficiency virus disease [letter; comment]: J Infect Dis. 1993 Dec;168(6):1596. Unique Identifier : AIDSLINE MED/94065300; McLean DM
Role of accessory spleens in human immunodeficiency virus-related immune thrombocytopenic purpura [letter; comment]: Blood. 1993 Dec 1;82(11):3504-5. Unique Identifier : AIDSLINE MED/94060390; Kao NL
Randomized trial of dapsone and aerosolized pentamidine for the prophylaxis of Pneumocystis carinii pneumonia and toxoplasmic encephalitis [see comments]: Am J Med. 1993 Dec;95(6):573-83. Unique Identifier : AIDSLINE MED/94082600; Torres RA; Barr M; Thorn M; Gregory G; Kiely S; Chanin E; Carlo C; Martin M; Thornton J; Department of Medicine St. Vincent's Hospital, New York, New York; 10011.; PURPOSE: Pneumocystis carinii pneumonia (PCP) and toxoplasmic encephalitis are the most frequent pulmonary and central nervous system opportunistic infections associated with human immunodeficiency virus (HIV) infection. We designed a prospective study to compare the effects of aerosolized pentamidine and dapsone in t
Viral immunopathology of human tumors.: Curr Opin Immunol. 1993 Oct;5(5):693-700. Unique Identifier : AIDSLINE MED/94059428; Masucci MG; Karolinska Institute, Stockholm, Sweden.; Virally induced tumors provide the strongest case of host surveillance against neoplastic cells and their precursors. Human cancers associated with Epstein-Barr virus, hepatitis B virus, papilloma virus and human T cell leukemia virus infection are responsible for approximately 15-20% of the total incidence of cancer
Enhancement of retroviral infection in vitro by anti-Le(y) IgG: reversal by humanization of monoclonal mouse antibody.: APMIS. 1993 Sep;101(9):711-8. Unique Identifier : AIDSLINE MED/94059532; Hansen JE; Sorensen AM; Arendrup M; Olofsson S; Nielsen JO; Janzek E; Nielsen C; Loibner H; Department of Infectious Diseases 144, Hvidovre Hospital,; Denmark.; Monoclonal mouse IgG3 antibody (ABL 364) against the carbohydrate Le(y) antigen enhanced infection in vitro with HTLV-1 and with HIV-1 when propagated in both transformed and normal lymphocytes. Enhancement was independent of complement, occurred with both lymphocytes and monocytes as target cells, and did not use eit
Down-regulation of CD4 molecules by the expression of Nef: a quantitative analysis of CD4 antigens on the cell surfaces.: Int Immunol. 1993 Sep;5(9):1067-73. Unique Identifier : AIDSLINE MED/94059858; Inoue M; Koga Y; Djordjijevic D; Fukuma T; Reddy EP; Yokoyama MM; Sagawa K; Department of Immunology, Kurume University School of Medicine,; Fukuoka, Japan.; Nef is one of the non-structural genes encoded by human immunodeficiency viruses. The protein product is associated with the cellular and plasma membranes, and is synthesized soon after entry of the virus. However, little is known about its functions relevant to viral replication and cytopathogenesis. CD4 is considere
Non-covalent complexes of HIV gp120 with CD4 and/or mAbs enhance activation of gp120-specific T clones and provide intermolecular help for anti-CD4 antibody production.: Int Immunol. 1993 Sep;5(9):1109-17. Unique Identifier : AIDSLINE MED/94059863; Manca F; Seravalli E; Valle MT; Fenoglio D; Kunkl A; Li Pira G; Zolla-Pazner S; Celada F; Department of Immunology, University of Genoa, San Martino; Hospital, Italy.; The dangerous liaison between CD4 and gp120 that offers the first entry opportunity to HIV may also provoke perturbations of the immune control of the host with far-reaching immunopathological consequences. We wondered whether a mechanism of intermolecular help (T help across the gap of a non-covalent bond, in contr
Accelerated apoptosis in peripheral blood mononuclear cells (PBMCs) from human immunodeficiency virus type-1 infected patients and in CD4 cross-linked PBMCs from normal individuals.: Blood. 1993 Dec 1;82(11):3392-400. Unique Identifier : AIDSLINE MED/94060374; Oyaizu N; McCloskey TW; Coronesi M; Chirmule N; Kalyanaraman VS; Pahwa S; Department of Pediatrics, North Shore University Hospital,; Cornell University Medical College, Manhasset, NY 11030.; This study investigates apoptosis as a mechanism for CD4+ T-cell depletion in human immunodeficiency virus type-1 (HIV-1) infection. Although several recent studies have shown that T cells of HIV-infected individuals show enhanced susceptibility to cell death by apoptosis, the mechanisms responsible for apoptosis are
A HTLV-I carrier who showed various symptoms and antibodies of autoimmune diseases.: Intern Med. 1993 Jun;32(6):449-54. Unique Identifier : AIDSLINE MED/94060482; Mizuki M; Tagawa S; Shibano M; Okamoto Y; Nojima J; Sakata K; Takatsuki K; Kawata S; Hashimoto M; Hashimoto K; et al; Department of Clinical Research, Osaka University, Japan.; We report a 37-year-old female HTLV-I carrier with complicating primary biliary cirrhosis (PBC) and mixed connective tissue disease (MCTD). Serum anti-HTLV-I antibody titer was x256. Flower cells (4.5%) were found in the peripheral blood. Southern blot analysis showed no clonal integration in peripheral blood lymphocy
Clinical manifestations of allergy and their relation to HIV infection.: Int Arch Allergy Immunol. 1993;102(4):408-13. Unique Identifier : AIDSLINE MED/94060734; Dikeacou T; Katsambas A; Lowenstein W; Romana C; Balamotis A; Tsianakas P; Carabinis A; Renieri N; Metaxotos N; Fragouli E; et al; 3rd Dermatology Clinic and Microbiology Laboratory, A. Sygros; Hospital, Athens, Greece.; In this retrospective study 141 HIV positive subjects were included. Allergy was studied by a specific questionnaire and the Phadia Top Test, an in vitro screening test for specific IgE. Both were related to the patients history, clinical symptoms and the treatment used. Allergy was studied in reference to HIV negati
Effect of anticancer drugs on the glucuronidation of 3'-azido-3'-deoxythymidine in human liver microsomes.: Drug Metab Dispos. 1993 Sep-Oct;21(5):823-9. Unique Identifier : AIDSLINE MED/94062533; Rajaonarison JF; Lacarelle B; Catalin J; Durand A; Cano JP; Laboratoire de Toxicologie et Pharmacie Clinique, Faculte de; Pharmacie, Marseille, France.; Because zidovudine (3 -azido-3 -deoxythymidine or AZT ) is frequently used in combination with other drugs for the treatment of acquired immune deficiency syndrome (AIDS) or AIDS-related complex diseases, drug interaction studies are required to improv
Pharmacokinetics and metabolism of 3'-azido-2',3'-dideoxy-5-methylcytidine in rhesus monkeys.: Drug Metab Dispos. 1993 Sep-Oct;21(5):855-60. Unique Identifier : AIDSLINE MED/94062539; Boudinot FD; Schinazi RF; Doshi KJ; McClure HM; Chu CK; Department of Pharmaceutics, College of Pharmacy, University of; Georgia, Athens 30602.; 3 -Azido-2 ,3 -dideoxy-5-methylcytidine (AzddMeC, CS-92), a nucleoside analog with structural similarities to both 3 -azido-3 -deoxythymidine ( AZT ) and 2 ,3 -dideoxycytidine ( ddC ), ha
Glucuronidation as a transient intermediate metabolic step in the elimination of (-)-carbovir. Identification of (-)-carbovir-5'-O-glucuronide in rat bile.: Drug Metab Dispos. 1993 Sep-Oct;21(5):902-10. Unique Identifier : AIDSLINE MED/94062545; Zimmerman CL; Iyer KR; Faudskar AL 2d; Remmel RP; Department of Pharmaceutics, College of Pharmacy, University of; Minnesota, Minneapolis 55455.; Carbocyclic 2 ,3 -didehydo-2 ,3 -dideoxy-guanosine [(-)-CBV] is a potent and selective inhibitor of the human immunodeficiency virus. The formation of the (-)-CBV-5 -O-glucuronide has been reported to be species-specific and stereoselective with rats forming little of the metabolite after administration of (-)-CBV. A
Proceedings of the 1st Multidisciplinary Conference on HIV/AIDS in Israel. Tel Aviv, Israel, 1993.: Isr J Med Sci. 1993 Oct;29(10 Suppl):1-54. Unique Identifier : AIDSLINE MED/94064274
Epidemiological and immunological study of HIV-seropositive Ethiopian immigrants in Israel. The Israel AIDS Study Group.: Isr J Med Sci. 1993 Oct;29(10 Suppl):19-23. Unique Identifier : AIDSLINE MED/94064277; Pollack S; Division of Clinical Immunology and Allergy, Rambam Medical; Center and B. Rappaport Faculty of Medicine, Technion, Haifa,; Israel.; A cohort of 243 HIV-seropositive Ethiopian immigrants has been studied clinically and immunologically since their arrival in Israel in May 1991. The prevalence of HIV infection in this Ethiopian community is 1.74%, with a male to female ratio of 1.3:1. The median age is 30 years; w
P-glycoprotein (MDR 1 gene product) in cells of the immune system: its possible physiologic role and alteration in aging and human immunodeficiency virus-1 (HIV-1) infection.: J Clin Immunol. 1993 Sep;13(5):289-301. Unique Identifier : AIDSLINE MED/94064853; Gupta S; Gollapudi S; University of California, Irvine 92717.; P-glycoprotein, a 170-kd glycoprotein encoded by the MDR 1 gene, is a member of a highly conserved superfamily of ATP-binding cassette (ABC) transport proteins. It shares extensive homology with numerous bacterial and eukaryotic ABC transport proteins. P-glycoprotein acts as an energy-dependent efflux pump that appear
A cross-sectional comparison of persons with syncytium- and non-syncytium-inducing human immunodeficiency virus [see comments]: J Infect Dis. 1993 Dec;168(6):1374-9. Unique Identifier : AIDSLINE MED/94065259; Bozzette SA; McCutchan JA; Spector SA; Wright B; Richman DD; Department of Medicine, University of California, San Diego.; The association between isolation of the syncytium-inducing (SI) phenotype of human immunodeficiency virus (HIV) and unfavorable clinical and immune status was evaluated in a cross-sectional study. Data on HIV phenotype were available for 341 of 878 persons entering clinical trials of antiretroviral therapies. Patient
Response of radiation-sensitive human cells to defined DNA breaks.: Int J Radiat Biol. 1993 Nov;64(5):523-9. Unique Identifier : AIDSLINE MED/94065420; Costa ND; Thacker J; DNA Repair and Mutagenesis Group, MRC Radiobiology Unit, Chilton,; UK.; We have investigated the response of four human cell lines, representing a range of sensitivities to ionizing radiation, to enzymes which induce defined DNA double-strand breaks (dsbs). Cell lines were derived from a normal individual, from the cancer-prone disorders ataxia-telangiectasia (AT) and Bloom s syndrome (BS
Breast feeding and HIV [published erratum appears in Lancet 1994 Jan 22;343(8891):244] [see comments]: Lancet. 1993 Dec 11;342(8885):1437-8. Unique Identifier : AIDSLINE MED/94066607; Ziegler JB; Department of Immunology/Allergy, Prince of Wales Children's; Hospital, Randwick, New South Wales, Australia.
Role of HTLV-I in development of non-Hodgkin lymphoma in Jamaica and Trinidad and Tobago. The HTLV Lymphoma Study Group.: Lancet. 1993 Dec 11;342(8885):1447-50. Unique Identifier : AIDSLINE MED/94066612; Manns A; Cleghorn FR; Falk RT; Hanchard B; Jaffe ES; Bartholomew C; Hartge P; Benichou J; Blattner WA; Epidemiology and Biostatistics Program, National Cancer; Institute, Rockville, Maryland 20852.; Human T-cell lymphotropic virus type I (HTLV-I) has been implicated in the aetiology of adult T-cell leukaemia/lymphoma in Japan and elsewhere, particularly the Caribbean. We have carried out parallel case-control studies in Jamaica and in
HIV-1 antibody serum negativity with urine positivity.: Lancet. 1993 Dec 11;342(8885):1458-9. Unique Identifier : AIDSLINE MED/94066615; Urnovitz HB; Clerici M; Shearer GM; Gottfried TD; Robison DJ; Lutwick LI; Montagnier L; Landers DV; Calypte Biomedical Corporation, Berkeley, CA 94710.; 7 individuals who were negative for HIV-1 antibody in a licensed serum enzyme immunoassay (EIA) were positive in a urine EIA and western blot (WB). Follow-up in individuals by use of a cell-mediated immune response showed 1 positive and 1 negative for HIV-1 peptide reactivity. In a second study, 4 out of 5 subjects po
Renewed US AIDS strategy [news]: Lancet. 1993 Dec 11;342(8885):1478. Unique Identifier : AIDSLINE MED/94066622; Horton R
French AIDS initiative [news]: Lancet. 1993 Dec 11;342(8885):1479. Unique Identifier : AIDSLINE MED/94066623; Nau JY
Cutaneous T-cell lymphoma after blood transfusion [letter]: Lancet. 1993 Dec 11;342(8885):1483. Unique Identifier : AIDSLINE MED/94066625; Grossman D; Duvic M
Pharmacovigilance for plasma-derived clotting factor concentrates [letter; comment]: Lancet. 1993 Dec 11;342(8885):1489. Unique Identifier : AIDSLINE MED/94066638; Tagariello G; Cavallin F; Davoli PG; Gajo GB; De Biasi E; Traldi A
Novel, negatively charged, human serum albumins display potent and selective in vitro anti-human immunodeficiency virus type 1 activity.: Mol Pharmacol. 1993 Nov;44(5):1003-7. Unique Identifier : AIDSLINE MED/94067033; Jansen RW; Schols D; Pauwels R; De Clercq E; Meijer DK; Department of Pharmacology and Therapeutics, University Centre; for Pharmacy, Groningen State University, The Netherlands.; We prepared a series of modified proteins and peptides by derivatizing the positively charged epsilon-amino groups of the lysine amino acids through reaction with anhydrides of succinic acid (Suc) and aconitic acid (Aco). Human serum albumin (HSA) was modified by introduction of a single carboxylic group (Suc-HSA) or
Zidovudine in asymptomatic HIV infection [letter]: N Engl J Med. 1993 Dec 16;329(25):1895; discussion 1895-6. Unique Identifier : AIDSLINE MED/94067227; Berger PB
Zidovudine in asymptomatic HIV infection [letter]: N Engl J Med. 1993 Dec 16;329(25):1895; discussion 1895-6. Unique Identifier : AIDSLINE MED/94067228; Martinez R
Clinical manifestations of AIDS in the era of pneumocystis prophylaxis. Multicenter AIDS Cohort Study.: N Engl J Med. 1993 Dec 23;329(26):1922-6. Unique Identifier : AIDSLINE MED/94067238; Hoover DR; Saah AJ; Bacellar H; Phair J; Detels R; Anderson R; Kaslow RA; Department of Epidemiology, School of Hygiene and Public Health,; Johns Hopkins University, Baltimore, MD 21205.; BACKGROUND. Among patients infected with human immunodeficiency virus type 1 (HIV-1), early and widespread use of prophylactic regimens against Pneumocystis carinii is changing the pattern of illnesses related to the acquired immunodeficiency syndrome (AIDS). METHODS. We conducted a subcohort analysis of 844 men with
Mechanism for the T4 lymphopenia of AIDS.: Proc Natl Acad Sci U S A. 1993 Dec 1;90(23):10982-3. Unique Identifier : AIDSLINE MED/94068528; Micali S; Laboratory for Computer Science, Massachusetts Institute of; Technology, Cambridge 02139.
Programmed cell death and AIDS [letter; comment]: Science. 1993 Nov 26;262(5138):1355-7. Unique Identifier : AIDSLINE MED/94069308; Martin SJ
Autologous neutralizing antibodies to SIVsm in cynomolgus monkeys correlate to prognosis.: Virology. 1993 Dec;197(2):609-15. Unique Identifier : AIDSLINE MED/94069934; Zhang YJ; Ohman P; Putkonen P; Albert J; Walther L; Stalhandske P; Biberfeld G; Fenyo EM; Department of Virology, Karolinska Institute, Stockholm, Sweden.; Sequential virus isolates from eight cynomolgus monkeys experimentally infected with SIVsm were studied for susceptibility to neutralization by autologous antibodies. The biological and antigenic characteristics of sequential reisolates differed both from the inoculum virus and from each other. Five monkeys developed
Current situation of African trypanosomiasis.: Acta Trop. 1993 Sep;54(3-4):153-62. Unique Identifier : AIDSLINE MED/94070503; Kuzoe FA; UNDP/WORLD BANK/WHO Special Programme for Research and Training; in Tropical Diseases, World Health Organization, Geneva,; Switzerland.; African trypanosomiasis (sleeping sickness) is fatal, if untreated, and occurs in 36 African countries, south of the Sahara, where some 50 million people are at risk of acquiring infection. In the absence of adequate control measures epidemics occur, which are costly and difficult to control. The history of sleeping s
CD4 counts as surrogate markers for progression to AIDS [letter; comment]: Ann Intern Med. 1994 Jan 1;120(1):87; discussion 88. Unique Identifier : AIDSLINE MED/94071335; Hirschel B
CD4 counts as surrogate markers for progression to AIDS [letter; comment]: Ann Intern Med. 1994 Jan 1;120(1):87; discussion 88. Unique Identifier : AIDSLINE MED/94071336; Nightingale SD
CD4 counts as surrogate markers for progression to AIDS [letter; comment]: Ann Intern Med. 1994 Jan 1;120(1):87-8. Unique Identifier : AIDSLINE MED/94071337; Phillips AN; Sabin CA
CD4 counts as surrogate markers for progression to AIDS [letter; comment]: Ann Intern Med. 1994 Jan 1;120(1):88. Unique Identifier : AIDSLINE MED/94071338; Harris PJ
An HTLV-I carrier who developed CD4+ T-CLL expressed the IL-2 receptor beta chain alone without expressing the alpha chain.: Br J Haematol. 1993 Sep;85(1):185-7. Unique Identifier : AIDSLINE MED/94072442; Mori N; Murakami S; Oda S; Eto S; First Department of Internal Medicine, University of Occupational; and Environmental Health, School of Medicine, Kitakyushu, Japan.; We describe a case of T-chronic lymphocytic leukaemia (T-CLL) with monoclonal proliferation of CD3+4+8- T cell expressing the interleukin 2 receptor (IL-2R) beta chain without expressing the alpha chain. Southern blot analysis of T-cell receptor beta chain gene revealed rearranged bands. The serum antibody was positiv
Risk of reactivation of tuberculosis in the course of human immunodeficiency virus infection.: Eur J Med. 1993 May;2(5):264-8. Unique Identifier : AIDSLINE MED/94073369; Di Perri G; Micciolo R; Vento S; Cruciani M; Marocco S; Carlotto A; Adami T; Mazzi R; Cazzadori A; Concia E; et al; Institute of Immunology and Infectious Diseases, University of; Verona, Italy.; OBJECTIVES: To establish, in a longitudinal study, whether reactivation of latent tuberculous infection takes place below an identifiable immunological threshold in subjects with human immunodeficiency virus (HIV) infection. METHODS: We followed up for 2 years 44 subjects with HIV infection who had a positive intrader
Mycobacterial diseases and HIV infection.: Eur J Med. 1993 Jun-Jul;2(6):344-8. Unique Identifier : AIDSLINE MED/94073394; Pagano G; Carrega G; Senno E; Cruciani M; Bassetti D; Department of Infectious Diseases, University of Genoa, Italy.; OBJECTIVES: Evaluation of the incidence of mycobacterial diseases in patients infected with human immunodeficiency virus (HIV) and analysis of survival after diagnosis of mycobacteriosis. METHODS: Retrospective analysis of clinical and laboratory data of HIV-infected patients admitted in our hospital from January 1st,
The expansion of CD8 lymphocytes using T cell receptor variable gene products during HIV infection.: Clin Exp Immunol. 1993 Dec;94(3):486-9. Unique Identifier : AIDSLINE MED/94074221; De Paoli P; Caffau C; D'Andrea M; Ceolin P; Simonelli C; Tirelli U; Santini G; Microbiology-Immunology-Virology Division, Centro di Riferimento; Oncologico, Aviano, Italy.; Fresh peripheral blood was obtained from HIV-infected subjects and from age-matched healthy controls. Single-, two- and three-colour flow cytometry was performed using FITC-labelled MoAbs directed against the following TCR V beta subfamilies: V2, V3, V5a, V5b, V5c, V6, V8, V12, V13.3, V17, V19, alone or in combination
The effect of fenclofenac on the regeneration of lymphocytes in rats following total body irradiation.: Int J Immunopharmacol. 1993 Nov;15(8):865-9. Unique Identifier : AIDSLINE MED/94075071; Spiers EM; Watson NT; Beck JS; Chapman IV; Dettmar PW; Department of Pathology, University of Dundee, U.K.; The effect of fenclofenac on the regeneration of white blood cells in Sprague-Dawley rats following total body irradiation was investigated. The lowest dose of total body irradiation that would suppress the peripheral blood lymphocyte count by at least 50% was found to be 1.0 Gray in a preliminary experiment. Fenclofe
Apoptosis: the physiologic pathway of cell death.: Hosp Pract (Off Ed). 1993 Dec 15;28(12):35-43. Unique Identifier : AIDSLINE MED/94075469; Cohen JJ; University of Colorado Health Science Center, Denver.; Physiologic roles of apoptosis may be subverted in pathologic processes. Apoptotic control of lymphocyte overproduction, for example, protects against cancer and autoimmunity, but in a disease such as AIDS, helper T cells may be programmed for suicide rather than an immune response. Drugs could be designed to limit ap
Peripheral blood mononuclear cell human immunodeficiency virus type 1 proviral DNA quantification by polymerase chain reaction: relationship to immunodeficiency and drug effect.: J Clin Microbiol. 1993 Oct;31(10):2692-6. Unique Identifier : AIDSLINE MED/94075549; Montoya JG; Wood R; Katzenstein D; Holodny M; Merigan TC; Center for AIDS Research, Stanford University Medical Center,; California 94305.; Human immunodeficiency virus type 1 (HIV-1) proviral DNA from peripheral blood mononuclear cells (PBMCs) was quantitated in 61 HIV-1-seropositive individuals by a nonisotopic polymerase chain reaction assay. Primers from the gag region (SK38, SK39) were used to determine the log10 HIV-1 proviral copy number per 10(6)
HIV-1 infection of human CD4+ T cells in vitro. Differential induction of apoptosis in these cells.: J Immunol. 1994 Jan 1;152(1):330-42. Unique Identifier : AIDSLINE MED/94075840; Martin SJ; Matear PM; Vyakarnam A; Department of Immunology, University College London Medical; School, UK.; The H9 and CEM CD4+ T cell lines were infected with HIV-1 (NY5/LAV-1 isolate) and monitored for losses in cell viability, syncytium formation, and internucleosomal DNA cleavage (a marker for apoptosis). H9 cells were found to undergo cell death via apoptosis as a result of HIVNY5 infection, but this effect was not app
CD4+ T-lymphocyte counts among seronegative heterosexual partners of persons infected with human immunodeficiency virus type 1 [letter]: J Acquir Immune Defic Syndr. 1993 Dec;6(12):1374-5. Unique Identifier : AIDSLINE MED/94076138; O'Brien TR; VanDevanter N; Paxton H; Polan C; Holmberg SD
A slippery defence against HIV.: Lancet. 1993 Dec 18-25;342(8886-8887):1500. Unique Identifier : AIDSLINE MED/94076923; Thompson C
Atypical HIV transmissions [news; comment]: Lancet. 1993 Dec 18-25;342(8886-8887):1544. Unique Identifier : AIDSLINE MED/94076941; Sharp D
Renegade HIV immunity hypothesis gains momentum [news]: Lancet. 1993 Dec 18-25;342(8886-8887):1545. Unique Identifier : AIDSLINE MED/94076942; Horton R
Patient-to-patient transmission of HIV in private surgical consulting rooms [letter] [see comments]: Lancet. 1993 Dec 18-25;342(8886-8887):1548-9. Unique Identifier : AIDSLINE MED/94076943; Chant K; Lowe D; Rubin G; Manning W; O'Donoughue R; Lyle D; Levy M; Morey S; Kaldor J; Garsia R; et al
HIV testing and blood recipients [letter] [see comments]: Lancet. 1993 Dec 18-25;342(8886-8887):1549. Unique Identifier : AIDSLINE MED/94076944; Frerichs RR; Seymour E
HIV testing and blood recipients [letter]: Lancet. 1993 Dec 18-25;342(8886-8887):1549-50. Unique Identifier : AIDSLINE MED/94076945; Stephenson PA
HIV in the developing world [letter; comment]: Lancet. 1993 Dec 18-25;342(8886-8887):1550. Unique Identifier : AIDSLINE MED/94076946; Wabitsch R
[The dermal dendrocyte]: Pathol Biol (Paris). 1993 Sep;41(7):613-8. Unique Identifier : AIDSLINE MED/94077553; Hoyo E; Kanitakis J; Schmitt D; INSERM U.346, Laboratoire d'Anatomie Pathologique, Hopital Ed.; Herriot, Lyon, France.; Dermal dendrocytes represent a population of resident cells of the dermis identified recently by virtue of the immunohistochemical expression of the coagulation factor XIIIa (fXIIIa). These dendritic cells of bone-marrow origin bear particular histoenzymatic and immunohistochemical features, some of which are shared w
In vitro modulation of proliferation and phenotype of resting and mitogen-stimulated bovine mononuclear leukocytes by 1,25-dihydroxyvitamin D3.: Vet Immunol Immunopathol. 1993 Sep;38(1-2):75-89. Unique Identifier : AIDSLINE MED/94078567; Nonnecke BJ; Franklin ST; Reinhardt TA; Horst RL; United States Department of Agriculture, National Animal Disease; Center, Ames, IA 50010-0070.; Effects of 1,25-dihydroxyvitamin D3 [1,25(OH)2D3] on the proliferation and phenotype of normal bovine peripheral blood mononuclear leukocytes (MNL) were studied in vitro. Resting and pokeweed mitogen (PWM)-stimulated MNL cultures were supplemented with 1.0 nM of 1,25(OH)2D3 at the beginning of the culture period. Leuk
Induction of CD8+ cytotoxic T cells by immunization with killed influenza virus and effect of cholera toxin B subunit.: Vaccine. 1993 Sep;11(12):1205-13. Unique Identifier : AIDSLINE MED/94078650; Mbawuike IN; Wyde PR; Department of Microbiology and Immunology, Baylor College of; Medicine, Houston, TX 77030-3498.; The MHC class I cytotoxic T-lymphocyte (CTL) response in mice given formalin-inactivated influenza whole-virus vaccine (WVV) with or without cholera toxin B subunit (CTB) was studied. Intraperitoneal injection of Balb/c (H-2d) mice with high doses of A/
Dietary micronutrient intake and risk of progression to acquired immunodeficiency syndrome (AIDS) in human immunodeficiency virus type 1 (HIV-1)-infected homosexual men.: Am J Epidemiol. 1993 Dec 1;138(11):937-51. Unique Identifier : AIDSLINE MED/94078959; Tang AM; Graham NM; Kirby AJ; McCall LD; Willett WC; Saah AJ; Department of Epidemiology, Johns Hopkins University, School of; Hygiene and Public Health, Baltimore, MD 21205.; The authors sought to determine if different levels of dietary intake of micronutrients are associated with the progression of human immunodeficiency virus type 1 (HIV-1) infection to acquired immunodeficiency syndrome (AIDS). A total of 281 HIV-1 seropositive homosexual/bisexual men were seen semiannually since 1984
Changes in survival after acquired immunodeficiency syndrome (AIDS): 1984-1991.: Am J Epidemiol. 1993 Dec 1;138(11):952-64. Unique Identifier : AIDSLINE MED/94078960; Jacobson LP; Kirby AJ; Polk S; Phair JP; Besley DR; Saah AJ; Kingsley LA; Schrager LK; Johns Hopkins University, School of Public Health, Department of; Epidemiology, Baltimore, MD 21205.; In a prospective cohort of 2,647 human immunodeficiency virus type 1 (HIV-1) seropositive homosexual men enrolled in Baltimore, Chicago, Los Angeles, and Pittsburgh, 891 developed clinical acquired immunodeficiency syndrome (AIDS) between June 1984 and January 1992. Cox proportional hazards models were used to examine
Plasma amino acid dysregulation after lentiviral infection.: AIDS Res Hum Retroviruses. 1993 Sep;9(9):807-9. Unique Identifier : AIDSLINE MED/94079804; Droge W; Murthy KK; Stahl-Hennig C; Hartung S; Plesker R; Rouse S; Peterhans E; Kinscherf R; Fischbach T; Eck HP; Division of Immunochemistry, Deutsches Krebsforschungszentrum,; Heidelberg, Germany.; The absence of AIDS-like symptoms in HIV-infected chimpanzees and SIV-infected African Green monkeys (AGMs) may provide important clues about the pathogenic mechanism of AIDS and about mechanisms of resistance. HIV-infected persons and SIV-infected rhesus macaques have, on the average, markedly decreased cysteine, cys
HTLV-I maternal transmission in Martinique, using serology and polymerase chain reaction.: AIDS Res Hum Retroviruses. 1993 Sep;9(9):869-74. Unique Identifier : AIDSLINE MED/94079812; Monplaisir N; Neisson-Vernant C; Bouillot M; Duc-Dodon M; Ugarte E; Valette I; Dezaphy Y; Ouka M; Eudaric MG; Gazzolo L; et al; Centre de Transfusion de Fort-de-France, Martinique, French West; Indies.; We have investigated HTLV-I and HTLV-II infection in children born to HTLV-I-seropositive or indeterminate Western blot mothers in Martinique by using the polymerase chain reaction (PCR). Only HTLV-I and no HTLV-II-positive samples
Summary of the National Institutes of Health workshop on primary human immunodeficiency virus type 1 infection.: AIDS Res Hum Retroviruses. 1993 Sep;9(9):913-24. Unique Identifier : AIDSLINE MED/94079818; Niu MT; Jermano JA; Reichelderfer P; Schnittman SM; Medical Branch, National Institute of Allergy and Infectious; Diseases (NIAID), National Institutes of Health (NIH), Bethesda,; Maryland 20892.; A Workshop on primary human immunodeficiency virus type 1 (HIV-1) infection sponsored by the National Institute of Allergy and Infectious Diseases (NIAID) and the Office of AIDS Research (OAR) of the National Institutes of Health (NIH) was held February 25-26, 1993 in Bethesda, Maryland. The major goals of this scient
Enhanced myocardial lesions in chronically Trypanosoma cruzi-infected rats subjected to adult thymectomy.: Immunol Lett. 1993 Aug;37(2-3):175-80. Unique Identifier : AIDSLINE MED/94081031; Bottasso OA; Revelli SS; Davila H; Valenti JL; Musso OC; Ferro ME; Romero-Piffiguer M; Morini JC; Division Immunologia, Facultad de Ciencias Medicas,; Universidad Nacional de Rosario, Argentina.; Control animals and rats infected 90 days earlier, by inoculation of 1 x 10(6) trypomastigotes of Trypanosoma cruzi at weaning, were subjected to adult thymectomy (ATx) or sham operation (S-ATx) and assessed 3 months later for the presence of myocardial lesions and levels of lymph node and spleen T-cell populations. C
Normal T cell receptor-mediated signaling in T cell lines stably expressing HIV-1 envelope glycoproteins.: J Immunol. 1993 Dec 15;151(12):7337-48. Unique Identifier : AIDSLINE MED/94081385; Tani Y; Tian H; Lane HC; Cohen DI; Laboratory of Immunoregulation, National Institute of Allergy and; Infectious Diseases, National Institutes of Health, Bethesda, MD; 20892.; A series of T cell lines transfected to stably express HIV-1 envelope (env) glycoproteins were analyzed for viability and for T cell signaling. One transfectant was distinguished by its stable expression of gp120 and gp41, whereas the remainder of the T cell lines were similar to previously reported env-expressing T c
[Vertical transmission human T-cell lymphotropic virus type-I (HTLV-I)--genetic diagnosis and assessment of the probable routes of HTLV-I infection]: Nippon Sanka Fujinka Gakkai Zasshi. 1993 Nov;45(11):1283-8. Unique Identifier : AIDSLINE MED/94081387; Ikeda K; Inaba N; Takamizawa H; Department of Obstetrics and Gynecology, School of Medicine,; Chiba University.; Human T-cell lymphotropic virus type-I (HTLV-I) provirus DNA from peripheral lymphocyte of 39 infants delivered by 26 pregnant carriers was detected by the nested double polymerase chain reaction (PCR) method to identify vertical transmission (VT) of HTLV-I. The 39 infants included 12 breast-fed and 27 bottle-fed infa
[Cerebral changes and HIV infection. Diagnostic methods are continuously improved]: Lakartidningen. 1993 Nov 17;90(46):4092-3. Unique Identifier : AIDSLINE MED/94081691; Alexius B; Psykiatriska klinikerna, Danderyds sjukhus.
Restoration of HIV-specific cell-mediated immune responses by interleukin-12 in vitro.: Science. 1993 Dec 10;262(5140):1721-4. Unique Identifier : AIDSLINE MED/94082291; Clerici M; Lucey DR; Berzofsky JA; Pinto LA; Wynn TA; Blatt SP; Dolan MJ; Hendrix CW; Wolf SF; Shearer GM; Experimental Immunology Branch, National Cancer Institute (NCI),; National Institutes of Health (NIH), Bethesda, MD 20892.; Peripheral blood mononuclear cells (PBMCs) from many asymptomatic individuals infected with human immunodeficiency virus-type 1 (HIV) are unresponsive as measured by in vitro T cell proliferation and interleukin-2 ( IL-2 ) production to influenza virus and synthetic pept
Simultaneous confirmation and differentiation of human T-lymphotropic virus types I and II infection by modified western blot containing recombinant envelope glycoproteins.: Transfusion. 1993 Nov-Dec;33(11):925-9. Unique Identifier : AIDSLINE MED/94082384; Brodine SK; Kaime EM; Roberts C; Turnicky RP; Lal RB; Department of Health Sciences and Epidemiology, Naval Health; Research Center, San Diego, California.; A modified Western blot (WB) that includes both shared (r21e) and unique recombinant envelope proteins from human T-lymphotropic virus (HTLV) type I (rgp46I) and type II (rgp46II) was compared to conventional HTLV serologic tests in 379 United States blood donors and individuals residi
Nef 27, but not the Nef 25 isoform of human immunodeficiency virus-type 1 pNL4.3 down-regulates surface CD4 and IL-2R expression in peripheral blood mononuclear cells and transformed T cells.: Virology. 1994 Jan;198(1):245-56. Unique Identifier : AIDSLINE MED/94082455; Greenway AL; McPhee DA; Grgacic E; Hewish D; Lucantoni A; Macreadie I; Azad A; National Centre in HIV Virology Research, Macfarlane Burnet; Centre for Medical Research, Fairfield, Victoria, Australia.; Continuing controversy surrounds the cellular effects of the Nef protein of HIV-1, a nonstructural protein expressed by most isolates. Highly purified protein isoforms of MW 27 kDa (Nef 27) and 25 kDa (Nef 25), produced in Escherichia coli by translation from the first and second start codons of HIV-1 nef clone pNL4.3
Impairment of T cell receptor-dependent stimulation in CD4+ lymphocytes after contact with membrane-bound HIV-1 envelope glycoprotein.: Virology. 1994 Jan;198(1):360-5. Unique Identifier : AIDSLINE MED/94082472; Schwartz O; Alizon M; Heard JM; Danos O; Departement SIDA et Retrovirus, Institut Pasteur, Paris,; France.; A CD4+ human T cell clone (SPB21) or primary blood mononuclear cells were grown in the presence of HeLa cells stably expressing functional human immunodeficiency virus type 1 envelope glycoprotein complexes at their surface. After a short cocultivation, SPB21 cells lost their ability to proliferate in response to T ce
Childhood anemia in Africa: to transfuse or not transfuse?: Acta Trop. 1993 Oct;55(1-2):47-51. Unique Identifier : AIDSLINE MED/94082581; Holzer BR; Egger M; Teuscher T; Koch S; Mboya DM; Smith GD; St. Francis Designated District Hospital, Ifakara, Kilombero,; Tanzania.; Blood transfusions are an important route for HIV transmission in Africa. To explore whether transfusions are necessary in the case management of childhood anemia, a randomized trial was performed in Ifakara, Tanzania , a holoendemic malaria region. 116 children were randomized to
[The 9th World AIDS Congress]: TVZ. 1993 Sep 2;(16):553-4. Unique Identifier : AIDSLINE MED/94082966; Hoeksema K
Molecular specificities of CD4+ T cell-reactive IgM in human immunodeficiency virus (HIV-1) infection.: Clin Immunol Immunopathol. 1994 Jan;70(1):40-6. Unique Identifier : AIDSLINE MED/94084967; Silvestris F; Cafforio P; Romito A; Dammacco F; Department of Biomedical Sciences and Human Oncology, University; of Bari Medical School, Italy.; The molecular targets and biological properties of lymphocytotoxic sera in 11 human immunodeficiency virus (HIV)+ subjects in CDC stages II to IVC were investigated. A purified soluble CEM membrane used as the CD4+ T cell clonotypic model in immunoblotting techniques revealed a homogeneous pattern of IgM-mediated reac
Association between HLA antigens and progression of HIV infection in Greek haemophiliacs.: Dis Markers. 1993 Sep;11(2-3):131-7. Unique Identifier : AIDSLINE MED/94085036; Papasteriades C; Economidou J; Pappas H; Psarra K; Kapsimali V; Karafoulidou K; Mandalaki T; Papaevangelou G; Dept. of Immunology and Histocompatibility, Evangelismos; Hospital, Athens, Greece.; The frequencies of HLA antigens in 33 HIV seronegative and in 88 HIV seropositive haemophiliacs, who have been followed for at least 6 years since seroconversion or first HIV positive test, were evaluated in relation to disease susceptibility and disease progression. A high frequency of HLA-A2 and -DR2 antigens and a
The cost of AIDS and HIV infection: the experience of a public hospital in the context of national forecasts.: Compr Ther. 1993;19(4):174-6; quiz 177-81. Unique Identifier : AIDSLINE MED/94085077; Rietmeijer CA; Denver Disease Control Service, CO 80204-4507.
High prevalence of HTLV antibodies in wild-caught bonnet monkeys in southern India.: Indian J Med Res. 1993 Sep;97:183-6. Unique Identifier : AIDSLINE MED/94086039; Babu PG; Saraswathi NK; Ishida T; Mukundan P; John TJ; Department of Microbiology & Virology, Christian Medical College,; Vellore.; The prevalence of human T-lymphotropic virus (HTLV) type-1 antibodies was determined in the bonnet monkeys, living naturally, within about 30 km radius of Vellore (south India ). Sera from 157 animals, collected between January 1982 and May 1993 were screened for the presence of HTLV
Candida albicans genotyping in studies with patients with AIDS developing resistance to fluconazole.: J Clin Microbiol. 1993 Nov;31(11):2933-7. Unique Identifier : AIDSLINE MED/94086791; Bart-Delabesse E; Boiron P; Carlotti A; Dupont B; Unite de Mycologie, Institut Pasteur, Paris, France.; We characterized Candida albicans strains responsible for recurrent oropharyngeal candidosis (OPC) in four patients with AIDS who developed clinical and mycological resistance to fluconazole (FCZ). Karyotype and restriction fragment length polymorphism analyses were performed on the clonal populations to differentiate
Biological variation and quality control of plasma human immunodeficiency virus type 1 RNA quantitation by reverse transcriptase polymerase chain reaction.: J Clin Microbiol. 1993 Nov;31(11):2960-6. Unique Identifier : AIDSLINE MED/94086796; Winters MA; Tan LB; Katzenstein DA; Merigan TC; Center for AIDS Research, Stanford University Medical Center,; California 94305.; Quantitation of human immunodeficiency virus type 1 (HIV-1) RNA in the plasma of seropositive individuals was performed by using an external control assay with techniques to standardize and control each measurement. Rigorous study of the variability of the assay showed that the median intraassay reproducibility was lo
Dendritic cells are potent antigen-presenting cells for in vitro induction of primary human CD4+ T-cell lines specific for HIV gp120.: J Acquir Immune Defic Syndr. 1994 Jan;7(1):15-23. Unique Identifier : AIDSLINE MED/94087527; Manca F; Li Pira G; Fenoglio D; Fang SP; Habeshaw A; Knight SC; Dalgleish AG; Department of Immunology, University of Genoa, San Martino; Hospital, Italy.; Activation of T helper cells specific for viral antigens is critical for antibody production and for generation of cytotoxic cells during the immune response to HIV. Since T-cell activation depends on antigen-presenting cells (APCs), it is important to define the cells that have a role in presentation of HIV antigens
Long-term follow-up of zidovudine therapy in asymptomatic HIV infection: results of a multicenter cohort study. The Italian Zidovudine Evaluation Group.: J Acquir Immune Defic Syndr. 1994 Jan;7(1):31-8. Unique Identifier : AIDSLINE MED/94087529; Vella S; Giuliano M; Dally LG; Agresti MG; Tomino C; Floridia M; Chiesi A; Fragola V; Moroni M; Piazza M; et al; Laboratory of Virology, Istituto Superiore di Sanita, Rome,; Italy.; In 1990 the results of a placebo-controlled study conducted within the AIDS Clinical Trials Group (ACTG 019) showed that in the short term, zidovudine was effective in slowing progression to advanced disease in HIV-infected asymptomatic patients with low CD4 cell counts. More recently, the preliminary results of the C
Prevalence of HIV-1 DNA and p24 antigen in breast milk and correlation with maternal factors.: J Acquir Immune Defic Syndr. 1994 Jan;7(1):68-73. Unique Identifier : AIDSLINE MED/94087535; Ruff AJ; Coberly J; Halsey NA; Boulos R; Desormeaux J; Burnley A; Joseph DJ; McBrien M; Quinn T; Losikoff P; et al; Department of International Health, Johns Hopkins University; School of Hygiene and Public Health, Baltimore, MD 21205.; Breast milk specimens from human immunodeficiency virus type 1 (HIV-1)-seropositive and HIV-1-seronegative women were examined for the presence of HIV-1 p24 antigen by the antigen capture method and for viral DNA using the polymerase chain reaction. HIV-1 DNA was present in 70% of milk specimens collected from 47 HIV-
Increased serum concentrations of soluble tumor necrosis factor receptors in HIV-infected individuals are associated with immune activation.: J Acquir Immune Defic Syndr. 1994 Jan;7(1):79-85. Unique Identifier : AIDSLINE MED/94087537; Zangerle R; Gallati H; Sarcletti M; Weiss G; Denz H; Wachter H; Fuchs D; Department of Dermatology and Venereology, University of; Innsbruck, Austria.; Serum concentrations of soluble tumor necrosis factor receptors (sTNF-Rs) were measured in 61 human immunodeficiency virus (HIV)-infected individuals. Thirty-five percent of these had increased serum concentrations of sTNF-R type I (p55) (sTNF-R55) and 82% had increased concentrations of sTNF-R type II (p75) (sTNF-R75
Detecting frame shifts by amino acid sequence comparison.: J Mol Biol. 1993 Dec 20;234(4):1140-57. Unique Identifier : AIDSLINE +; Claverie JM; National Center for Biotechnology Information, National Library; of Medicine, National Institutes of Health Bethesda, MD 20894.; Various amino acid substitution scoring matrices are used in conjunction with local alignments programs to detect regions of similarity and infer potential common ancestry between proteins. The usual scoring schemes derive from the implicit hypothesis that related proteins evolve from a common ancestor by the accumula
Human T-lymphotropic virus type I (HTLV-I) provirus-related DNA sequences in peripheral blood mononuclear cells of a patient, in the absence of a definite serological positivity.: New Microbiol. 1993 Oct;16(4):373-9. Unique Identifier : AIDSLINE MED/94088314; Re MC; Furlini G; Ramazzotti E; D'Antuono A; Vignoli M; La Placa M Jr; Monari P; Zauli G; La Placa M; Institute of Microbiology, University of Bologna, St. Orsola; General Hospital, Italy.; The true extent of human T-lymphotropic virus type I and II (HTLV-I/II) infection in European countries and its pathogenetic potential are still unknown. To find out more about HTLV-I/II incidence in our area we studied a group of 160 outpatients attending a sexually transmitted disease clinic over a six-month period.
HIV-1 and HCV co-infected patients: detection of active viral expression using a nested polymerase chain reaction.: Mol Cell Probes. 1993 Oct;7(5):405-10. Unique Identifier : AIDSLINE MED/94088613; Richard L; Pellegrin JL; Barbeau P; Brossard G; Leng B; Fleury HJ; Laboratoire de Virologie, Universite de Bordeaux II, France.; The aim of the present study was to determine, in a population of 70 HIV-1 infected patients with antibodies to HCV, the percentages of individuals with an active replication of HIV-1, HCV or both. During a one year follow-up of these patients at different stages of disease, blood samples were regularly collected for
HIV 'cofactor' comes in for more heavy fire [news; comment]: Science. 1993 Dec 24;262(5142):1971. Unique Identifier : AIDSLINE MED/94090332; Cohen J
T cell activation antigen, CD26, as a cofactor for entry of HIV in CD4+ cells [see comments]: Science. 1993 Dec 24;262(5142):2045-50. Unique Identifier : AIDSLINE MED/94090346; Callebaut C; Krust B; Jacotot E; Hovanessian AG; Unite de Virologie et Immunologie Cellulaire, UA CNRS, Institut; Pasteur, Paris, France.; The CD4 molecule is essential for binding HIV particles, but is not sufficient for efficient viral entry and infection. The cofactor was shown to be dipeptidyl peptidase IV (DPP IV), also known as CD26. This serine protease cleaves its substrates at specific motifs; such motifs area also highly conserved in the V3 loo
Very-high-purity versus intermediate-purity factor VIII in human immunodeficiency virus-positive hemophiliacs: conclusions of a prospective 3-year study. Monoclate Study Group.: Semin Hematol. 1993 Oct;30(4 Suppl 5):10-3. Unique Identifier : AIDSLINE MED/94090364; Seremetis SV; Department of Medicine, Mount Sinai School of Medicine, New York,; NY 10029.
Changes in CD4 count relative to product usage: findings from the transfusion safety study.: Semin Hematol. 1993 Oct;30(4 Suppl 5):7-9. Unique Identifier : AIDSLINE MED/94090366; Hilgartner MW; Division of Pediatric Hematology/Oncology, New York; Hospital-Cornell Medical Center, NY 10021.
Transfection of a retroviral construct carrying a non producer HIV-1 variant induces HIV-1 resistance in CD4+ CEMss cells.: J Biol Regul Homeost Agents. 1993 Apr-Jun;7(2):41-9. Unique Identifier : AIDSLINE MED/94091170; Federico M; Taddeo B; Nappi F; Nicolini A; Rossi GB; Verani P; Laboratory of Virology, Istituto Superiore di Sanita, Roma,; Italy.; The phenotype of Human Immunodeficiency Virus-1 (HIV)-infected HUT-78 cell clone (F12) has been described (Federico et al, AIDS Res Hum Retrov 1989; 5: 365-96). Briefly, F12 cells are: i) CD4 down-regulated, ii) non producer and iii) fully resistant to homologous superinfection. We tested whether this phenotype was de
Pediatric AIDS: Clinical, Pathologic, and Basic Science Perspectives. Conference proceedings. Washington, D.C., November 18-21, 1992.: Ann N Y Acad Sci. 1993 Oct 29;693:1-328. Unique Identifier : AIDSLINE MED/94091648
Intravenous gammaglobulin for pediatric HIV-1 infection. Effects on infectious complications, circulating immune complexes, and CD4 cell decline.: Ann N Y Acad Sci. 1993 Oct 29;693:151-7. Unique Identifier : AIDSLINE MED/94091653; Rubinstein A; Calvelli T; Rubinstein R; Department of Pediatrics, Microbiology, and Immunology, Albert; Einstein College of Medicine, Bronx, New York 10461.
Immunologic targets of HIV infection: T cells. NICHD IVIG Clinical Trial Group, and the NHLBI P2C2 Pediatric Pulmonary and Cardiac Complications of HIV Infection Study Group.: Ann N Y Acad Sci. 1993 Oct 29;693:35-51. Unique Identifier : AIDSLINE MED/94091690; Shearer WT; Rosenblatt HM; Schluchter MD; Mofenson LM; Denny TN; Department of Allergy & Immunology, Texas Children's Hospital,; Houston 77030.; One of the principal targets of HIV infection is the human peripheral blood CD4+ T cell, resulting in progressive CD4+ lymphocyte loss. Hypothesized mechanisms for this loss include apoptosis, cytolytic reactions, V-beta gene deletion of the T-cell receptor (TCR) by superantigens, CD4+ lymphocyte syncytium formation,
Passive immunity in the prevention of maternal-fetal transmission of human immunodeficiency virus infection.: Ann N Y Acad Sci. 1993 Oct 29;693:186-93. Unique Identifier : AIDSLINE MED/94091657; Lambert JS; Stiehm ER; Department of Medicine, University of Rochester School of; Medicine and Dentistry, New York 14642.
The envelope glycoprotein of HIV-1 alters NMDA receptor function.: Eur J Neurosci. 1993 Mar 1;5(3):276-83. Unique Identifier : AIDSLINE MED/94084256; Sweetnam PM; Saab OH; Wroblewski JT; Price CH; Karbon EW; Ferkany JW; NovaScreen, A Division of Nova Pharmaceutical Corporation,; Baltimore, MD 21224.; Human immunodeficiency virus (HIV-1) infection often results in central nervous system (CNS) dysfunction, yet the mechanism(s) of action for HIV-1 in the CNS are not fully understood. In the present study gp120, the HIV-1 envelope glycoprotein, was shown to selectively inhibit N-methyl-D-aspartate (NMDA) receptor func
Isolation, characterization, and transmission of human T-lymphotropic virus types I and II in culture.: Curr Microbiol. 1993 Dec;27(6):355-60. Unique Identifier : AIDSLINE MED/94060873; Kitamura K; Rudolph DL; Goldsmith C; Folks TM; Lal RB; Retrovirus Diseases Branch, Centers for Disease Control and; Prevention, Atlanta, GA 30333.; Highly sensitive coculture methods were developed both for isolation of human T-lymphotropic virus types I and II (HTLV-1 and HTLV-II) from infected individuals and for productive infection of lymphoid cells. Mitogen-activated peripheral blood mononuclear cells (PBMC) from 13 HTLV-I- and 20 HTLV-II-positive specimens
Structure/function studies of HIV-1(1) reverse transcriptase: dimerization-defective mutant L289K.: Biochemistry. 1993 Dec 7;32(48):13012-8. Unique Identifier : AIDSLINE MED/94059976; Goel R; Beard WA; Kumar A; Casas-Finet J