[New York, N.Y.] : Public Agenda Foundation, c1989 1 videocassette (22 min.) : sd., col. with b&w ; 1/2 in Unique Identifier : AIDSLINE AV/9300256A
(Producer) This program gives voice to the many moral, legal, ethical and economic concerns that the epidemic raises. It presents a broad range of opinions on such issues as AIDS education in the schools, needle-exchange programs, mandatory testing, the rights of people with AIDS, and condom advertising on televisio
[United States : s.n., 1991] 1 videocassette (12 min.) : sd., col. ; 1/2 in. + 1 guide (UCLA AIDS education for health care providers ; module 10) Unique Identifier : AIDSLINE AV/9300214A
Lewis CE
(Producer) Various scenarios depict the problems associated with children and HIV/AIDS. Foster parents, single mothers, and social workers point out the fears and myths about transmission and discuss the difficulties in providing adequate services to children with AIDS.
New York, N.Y : Filmakers Library, [1991] 1 videocassette (52 min.) : sd., col. with b&w ; 1/2 in Unique Identifier : AIDSLINE AV/9300302A
(Producer) This documentary grapples with the special problems of women in the AIDS epidemic. It will encourage frank and open discussion on a wide range of subjects such as safe sex for both straight and lesbian women, health care for HIV positive women, and advocacy efforts.
[California?] : Kaiser Permanente, c1992 1 videocassette (13 min.) : sd., col. ; 1/2 in Unique Identifier : AIDSLINE AV/9300231A
(Producer) Directed towards teenagers and young adults, this program is an interview with a young mother who is HIV positive. Her preschool daughter is also positive, but her husband, the child s father is not. She tells of the great anguish she feels at being responsible for her daughter s condition because of havin
New York, N.Y. : Filmakers Library, [1992] 1 videocassette (39 min.) : sd., col. ; 1/2 in Unique Identifier : AIDSLINE AV/9300255A
(Producer) In this interview from her Virginia farm, Dr. Elizabeth Kubler-Ross, well known for her work with the terminally ill, speaks about the satisfactions of caring for AIDS babies. After her own community prevented her from creating a home for sick mothers and babies on her property, she organized a network of
[Oakland, Calif.] : Kaiser Foundation Health Plan, c1992 1 videocassette (50 min.) : sd., col. ; 1/2 in (Medicine in the nineties) Unique Identifier : AIDSLINE AV/9300275A
Perth, W.A. : Curtin University of Technology, School of Economics and Finance, [1990] 27 p (Working paper series, ISSN 1035-901X) Unique Identifier : AIDSLINE CAT/9302629
London : Institute of Biology ; London ; New York : Royal Society of Medicine Services, 1990 viii, 87 p. : ill Unique Identifier : AIDSLINE CAT/9303082
the Demographic Impact of the AIDS Epidemic in Pattern II Countries New York : United Nations, Dept. of International Economic and Social Affairs ; Geneva : World Health Organization, Global Programme on AIDS, c1991 ix, 140 p. : ill Unique Identifier : AIDSLINE CAT/9303081
Washington, D.C. : Congress of the U.S. : Office of Technology Assessment : [Supt. of Docs., U.S. G.P.O., distributor], v. : ill Unique Identifier : AIDSLINE CAT/9303856
Control Programmes Manila, Philippines : Printed and distributed by the Regional Office for the Western Pacific of the World Health Organization, [1992] 28 p. : ill (Report series ; no. RS/91/GE/20(PHL)) Unique Identifier : AIDSLINE CAT/9303998
During the last decade, advances in antimicrobial development have offered viable alternatives to traditional therapy to protect the immunocompromised patient (pt) from the early morbidity and mortality that ensues from untreated bacterial infections. Newer antibiotics (3rd-generation cephalosporins, imipenem, aztreon
Int Congr Ser; 956:137-40 1991. Unique Identifier : AIDSLINE ICDB/93688676
Hattori T; Sakai K; Suzushima H; Asou N; Takatsuki K; Matsuzaki Y; Nakauchi H; Natori H; Oizumi K; Second Dept. of Internal Medicine, Kumamoto Univ. Medical Sch.,; Japan
Human T-cell leukemia virus type 1 (HTLV-1) is associated etiologically with adult T-cell leukemia (ATL). A distinctive feature of ATL cells is the universally expressed activated T-cell antigens, such as HLA-DR and CD25, with a phenotype of mature helper T cells (CD3+, CD4+, CD8-). The origins of ATL cells apparently
Dick JE; Dept. of Genetics, Res. Inst., Hosp. for Sick Children, Toronto,; Ontario, Canada
Knowledge of the hematopoietic cell system has been derived primarily from studies of the mouse. In vivo assays for the various cells within the stem cell hierarchy have played an important role in these advances. In contrast, understanding of the biology of the human hematopoietic system has suffered because of the l
Venuti MC; Dept. of Bioorganic Chemistry, Genentech, Inc., South San; Francisco, CA
As medicinal chemistry has become a more methodical science, the task of discovering new therapeutic agents that work potently, specifically, and without side effects has become increasingly important and difficult. This science, which once relied almost solely on near-blind synthesis and screening for in vivo effects
Fan N; Poiesz BJ; Gavalchin J; Silverstone A; State Univ. of New York Health Science Center, Syracuse, NY 13210
A monoclonal IgM antibody, MAb 34-23, that identifies a cell surface antigen on cells susceptible to infection by HTLV-I has been produced and its ability to block HTLV-I binding to target cells and inhibit cell-free HTLV-I entry into target cells examined. Preincubation of PHA-activated peripheral blood mononuclear c
Soubrane C; Mouawad R; Ichen M; Suissa J; Borel C; Weil M; Khayat D; Dept. of Medical Oncology, Pitie-Salpetriere Hosp., Paris, France
16 patients (pts) with MMM were included in this study. They received 100 mg/m2 of cisplatin (CDDP) over 4 hr at days 1 and 28, followed by 18 MIU/m2/day of interleukin-2 (IL2-Eurocetus) in continuous infusion from days 3 to 6, 17 to 21, 31 to 34 and 45 to 49. Alpha interferon (IFN-Roche) 9 MU/day was given sc 3x/wk.
Eighth Mediterranean Congress of Chemotherapy. May 24-9, 1992, Athens, Greece, p. 731, 1992. Unique Identifier : AIDSLINE ICDB/93688839
Mathe G; Chenu E; Bourut C; Orbach-Arbouys S; Institut du Cancer et d'Immunogenetique, Hopital Paul-Brousse,; Villejuif, France
Bestatin, dipeptide N-([2S,3R]-3-amino-2-hydroxy-4-phenylbutanoyl)-L-leucine is a leucine aminopeptidase and B aminopeptidase inhibitor which exerts a direct stimulating effect on lymphocytes (and monocytes) via its fixation on cell surface leucine aminopeptidase, and an indirect one on monocytes (and lymphocytes) via
Current interest in antisense technology started with studies published in 1984, although endogenous antisense mechanisms had been identified and tested almost two decades before. Antisense transgenes in plants, slime mold, and other nonvertebrate systems yielded nearly complete elimination of target gene expression,
Ann Oncol; 3(Suppl 5):136 1992. Unique Identifier : AIDSLINE ICDB/93689686
Gramaglia A; Milani F; Villa S; Palazzi M; Giampetruzzi E; Radiotherapy C, Istituto Nazionale Tumori, Milan, Italy
The incidence of epidemic Kaposi s sarcoma (EKS) is increasing (EKS is 15,000x more frequent in AIDS patients [pts] than in the normal population). Oral presentation is about 47% of all cases. Dental pain/loss dysphagia, mucositis, ulceration, and bleeding have a great impact on quality of life of the pt. RT still rep
Ann Oncol; 3(Suppl 5):136 1992. Unique Identifier : AIDSLINE ICDB/93689688
Shamebo M; Dept. of Internal Medicine, Faculty of Medicine, Addis Ababa; Univ., Addis Ababa, Ethiopia
Patients (pts; n=103) with lymphoid neoplasia, 77 males and 26 females aged 14-78 yr (mean age 42.6 yr), were seen in the Department of Internal Medicine, Tikur Anbessa Hospital (Black Lion) Teaching Hospital, Addis Ababa, between January 1988 and December 1991. 50 pts (48.5%) were non
International Symposium on Cancer, Sapporo Cancer Seminar: Oxyradicals and Anti-oxidative Responses in Cancer. July 14-16, 1992, Sapporo, Japan, p. 43, 1992.. Unique Identifier : AIDSLINE ICDB/93690044
Baeuerle PA; Schreck R; Meyer M; Schluter V; Caselmann W; Hofschneider PH; Gene Center, Ludwig-Maximilians Univ., Munich, Germany
The nuclear factor kappa B (NF-kappa B) is an inducible transcription factor that is activated when cells are exposed to TNF, IL-1, viruses, double-stranded RNA, lipopolysaccharide, UV light and gamma rays. A hallmark of NF-kappa B is that, in nonstimulated cells, it resides in the cytoplasm in complex with the inhibi
International Symposium on Cancer, Sapporo Cancer Seminar: Oxyradicals and Anti-oxidative Responses in Cancer. July 14-16, 1992, Sapporo, Japan, p. 46, 1992.. Unique Identifier : AIDSLINE ICDB/93690047
Taniguchi Y; Kawabe T; Masutani H; Nakamura H; Matsuda M; Okamoto T; Yodoi J; Dept. of Biological Responses, Inst. for Virus Res., Kyoto Univ.,; 53 Shogoin, Kawahara-cho, Sakyo-ku, Kyoto 606, Japan
Human T-lymphotropic virus type 1 (HTLV-1)-transformed T cells overexpress interleukin-2 receptor alpha chain (IL-2R alpha) and adult T-cell leukemia-derived factor (ADF), originally defined as an IL-2R inducer. Subsequent ADF cDNA cloning showed that ADF is a human homolog of thioredoxin (TRX), an endogenous thiol-re
Pentosan polysulfate (PPS), a polyanionic mucopolysaccharide, which has been shown to exert inhibitory effects on human immunodeficiency virus (HIV-I) replication and on tumor growth, inhibited the activities of protein tyrosine kinases (PTK) from lymphocytes (Jurkat cells) and rat lung. In addition, the autophosphory
Eighth Mediterranean Congress of Chemotherapy. May 24-29, 1992, Athens, Greece, p. 625, 1992.. Unique Identifier : AIDSLINE ICDB/93688738
Kallinikos-Maniatis A; Lab. of Hematology and Transfusion Medicine, Univ. of Patras,; Greece
Hemopoietic growth factors have recently been incorporated in a number of clinical trials both in hematology and in oncology, and results (although preliminary) are certainly promising. Correction of anemia by the administration of rEPO has been achieved in anemia of renal failure and responses have been observed in a
Eighth Mediterranean Congress of Chemotherapy. May 24-9, 1992, Athens, Greece, p. 742-3, 1992. Unique Identifier : AIDSLINE ICDB/93688851
Illarionova M; Zheleva A; Raikov Z; Todorov D; Dudov; Natl. Oncological Center, Sofia, Bulgaria
The nitrosourea derivatives from several groups (spin-labeled and nonspin-labeled 2-chloroethyl-nitrosourea derivatives of some amino acids as alanine, glycine, methionine, leucine and others) on the rational basis were synthesized. The antitumor activity and some related to that activity, and biochemical properties (
Ann Oncol; 3(Suppl 5):136 1992. Unique Identifier : AIDSLINE ICDB/93689687
Munarriz J; Mohedano N; Jimenez U; Donnay O; Lazaro M; Sanz J; Verdejo J; Martinez MC; Castrillo JM; Guardiola L; et al; S. Oncologia Medica-E, Infecciosas, Hosp. de la Princesa, Madrid,; Spain
Chemotherapy was planned on those HIV+ patients (pts) with Kaposi s sarcoma (KS) with unfavorable prognostic factors. In a first group which showed rapid progression with CD4 A and with skin affects, chemotherapy was carried out with vincristine/vinblastine (VBL). In a second group with III/IV stages, CD4 200 and prio
Ann Oncol; 3(Suppl 5):137 1992. Unique Identifier : AIDSLINE ICDB/93689689
Katz A; Levy GC; Albert Einstein Hosp., Sao Paulo, Brazil
AIDS patients (pts) often develop leukopenia and G, either related to the HIV infection itself or associated with the use of myelosuppressive drugs such as AZT or DHPG. This common event further complicates the clinical course of the pts and may requi
Ann Oncol; 3(Suppl 5):164 1992. Unique Identifier : AIDSLINE ICDB/93689791
Biron P; Droz JP; Pico JL; Kramar A; Bouzy J; GU group of the French Federation of Cancer Centers
The role of early HDCT + ABMT in the treatment of PP nonseminomatous GCT as defined in our group (Droz, Cancer 62:54, 1988) was studied by a multicentric Phase III trial. Patients (pts) were randomized to receive either arm A: the NCI cisplatin (P), vinblastine (Ve), bleomycin (B), VP16 (V) regimen (PVeBV; Ozols, JCO
Blood Cell Growth Factors: Their Present and Future Use in Hematology and Oncology. Murphy MJ Jr, ed. Dayton, OH, AlphaMed Press, p. 3-20, 1991.. Unique Identifier : AIDSLINE ICDB/93689904
GM-CSF entered the clinic only 4 yr ago, yet it has already demonstrated widespread efficacy and utility in a number of clinical settings. As a single agent, GM-CSF can reverse the neutropenia of myelodysplastic syndrome and aplastic anemia. GM-CSF can also enhance recovery from bone marrow transplantation and thus re
Int J Immunotherapy; 7(4):189-95 1991. Unique Identifier : AIDSLINE ICDB/93690155
Madarnas P; Dube M; Nigam VN; Dept. of Pathology, Univ. of Sherbrooke, Sherbrooke, Quebec, J1H; 5N4, Canada
Dimethylhydrazine treatment of CD1 mice for more than 30 wk induced colorectal-anal cancer as well as skin and visceral angiosarcomas in high proportions. These mice were tested as models for AIDS-associated Kaposi s sarcoma (KS) with respect to their immune status and for the histological similarity of skin lesions w
Johanet H; Marmuse JP; Benhamou G; Charleux H; Service de Chirurgie generale et digestive, hopital Bichat,; Paris.
Appendectomy is the most current digestive surgical procedure in France . Ascending prevalence of infection by HIV, invites us to report 19 documented cases of appendicular syndroma in a population infected by HIV, within 13 cases who required criteria for AIDS. In 31.5% of cases, o
Kawai H; Kashiwagi S; Inui T; Tamaki Y; Sano Y; Saito S; 1st Department of Internal Medicine, School of Medicine,; University of Tokushima, Japan.
Two cases of HTLV-I-associated myelopathy (HAM/TSP) with Hashimoto s thyroiditis are reported. One patient is a 47-year-old female with goiter and the other a 60-year-old female. Both have slowly progressive spastic paraparesis and have anti-HTLV-I antibodies in their serum and cerebrospinal fluid. Anti-thyroid antibo
Wis Med J. 1991 Dec;90(12):676-8. Unique Identifier : AIDSLINE MED/93118351
Friedenberg WR; Department of Oncology, Marshfield Clinic, WI 54449.
Although dramatic progress has been made in the treatment of advanced non-Hodgkin s lymphoma , a majority of patients eventually die from this disease. Improvements in histopathology, staging techniques, immunophenotyping, and knowledge of prognostic factors have improved our abilit
Kovacsovics-Bankowski M; Carini C; Kashala O; Essex M; Harvard School of Public Health, Department of Cancer Biology,; Boston, Massachusetts.
Individuals infected with human immunodeficiency virus type 1 (HIV-1) develop a humoral immune response to the virus s major structural gene products env, gag, and pol. The distribution of antibodies to env, gag, and pol proteins in Central African populations is of interest as they have a high level of immune system
Lanza P; Washington LC; Zanetti M; Department of Medicine, University of California, San Diego.
The study presents a new in vitro method to investigate the interaction between the glycoprotein (gp)120 of human immunodeficiency virus (HIV) and its receptor, CD4. The method is based on the binding of soluble recombinant CD4 to a human T cell line, 8E5, which constitutively expresses gp120 at its surface as a resul
Lamhamedi-Cherradi S; Culmann-Penciolelli B; Guy B; Kieny MP; Dreyfus F; Saimot AG; Sereni D; Sicard D; Levy JP; Gomard E; INSERM U152, ICGM, Hopital Cochin, Paris, France.
OBJECTIVE: To study the degree of immunogenicity of each HIV-1 protein. DESIGN: In most viral systems, antiviral cytotoxic T-lymphocytes (CTL) from a given donor preferentially recognize only one or a small number of viral proteins. METHODS: Anti-HIV CTL were generated by in vitro stimulation of peripheral blood monon
Ellaurie M; Rubinstein A; Special Immunology Service, Children's National Medical Center,; Washington, District of Columbia.
OBJECTIVE: To evaluate the diagnostic and prognostic value of serum tumor necrosis factor-alpha (TNF-alpha) levels in HIV-1-infected children. DESIGN: Serum levels of TNF-alpha were evaluated in 57 HIV-1-infected symptomatic children aged between 7 months and 8 years. METHODS: TNF-alpha levels were determined by enzym
Hakkarainen K; Jansson E; Ranki A; Valle SL; Krohn KJ; Institute of Biomedical Sciences, University of Tampere, Finland.
OBJECTIVE: To assess the frequency of mycoplasma infections in HIV-antibody-positive and -negative individuals by studying the serological responses against mycoplasmas, especially Mycoplasma fermentans and M. pirum. DESIGN: An enzyme-linked immunosorbent assay (ELISA) was used to measure immunoglobulin G (IgG) class
French MA; Mallal SA; Dawkins RL; Department of Clinical Immunology, Royal Perth Hospital, Western; Australia.
OBJECTIVE: To describe a localized form of Mycobacterium avium intracellulare (MAI) infection occurring concurrently with the restoration of cutaneous delayed-type hypersensitivity (DTH) responses to mycobacterial antigens after commencement of zidovudine therapy in immunodeficient HIV-infected patients. PATIENTS: The
Wiley CA; Achim CL; Schrier RD; Heyes MP; McCutchan JA; Grant I; Department of Pathology, University of California San Diego, La; Jolla 92093-0612.
OBJECTIVES AND DESIGN: Because macrophages are the predominant immune cell and the predominant infected cell in the brains of patients with HIV encephalitis, we studied macrophage and immune activation-associated factors in the cerebrospinal fluid (CSF) from 39 autopsied AIDS cases for whom complete neuropathologic ev
Kemper CA; Zolopa AR; Hamilton JR; Fenstersheib M; Bhatia G; Deresinski SC; Department of Medicine, Stanford University School of Medicine,; California.
OBJECTIVES: To determine the prevalence of measles (rubeola) immunity in a group of HIV-1-infected adults and to examine predictors of measles seronegativity in this population. SETTING: County hospital outpatient clinic and public-health department early HIV intervention clinic. PATIENTS: A total of 262 HIV-infected
Ong EL; Hanley SP; Mandal BK; Regional Department of Infectious Diseases and Tropical Medicine,; Monsall Hospital, Manchester, England, UK.
OBJECTIVE: To study bronchial responsiveness to inhaled histamine among HIV-infected patients. DESIGN: A prospective study in a regional infectious diseases unit. METHODS: Three groups of patients were studied. Group A consisted of AIDS patients (n = 7) who had had Pneumocystis carinii pneumonia (PCP), group B of AIDS
Laleman G; Magazani K; Perriens JH; Badibanga N; Kapila N; Konde M; Selemani U; Piot P; Centre Regional de Lutte Contre le SIDA, Lubumbashi, Zaire.
OBJECTIVE: To prevent blood transfusion-acquired HIV infection with a decentralized approach to HIV screening of blood donors, using an instrument-free rapid test. SETTING: Shaba province, Zaire (496,877 km2). METHODS: The programme consisted of training health-care workers, distr
Santana RT; Monzon OT; Mandel J; Hall TL; Hearst N; Research Institute for Tropical Medicine, Department of Health,; Muntinlupa, Metro Manila, Philippines.
OBJECTIVE: To evaluate an AIDS education intervention for health workers in Metro Manila hospitals. METHODS: A randomized controlled education program consisting of lectures, role-plays, posters and pamphlets was delivered to physicians, nurses, laboratory technologists and orderlies in Manila hospitals. Knowledge, at
Pineda JA; Aguado I; Rivero A; Vergara A; Hernandez-Quero J; Luque F; Pino R; Abad MA; Santos J; Cruz E; et al; Viral Hepatitis and AIDS Study Group, Virgen del Rocio; University Hospital, Seville, Spain.
OBJECTIVES: To assess the prevalence of HIV-1 infection among non-intravenous drug user (IVDU) female prostitutes in Spain and to determine risk factors for HIV-1 infection in this population. DESIGN: Cross-sectional seroepidemiological study of 519 non-IVDU prostitutes. SETTING: Fo
Frischer M; Green ST; Goldberg DJ; Haw S; Bloor M; McKeganey N; Covell R; Taylor A; Gruer LD; Kennedy D; et al; Communicable Diseases Scotland Unit, Ruchill Hospital, Glasgow,; UK.
OBJECTIVE: To use research and surveillance studies in Glasgow (Scotland, UK) to estimate the number of current injectors infected with HIV, the total number of injectors infected up to the end of 1990 and the recent incidence of infection. DESIGN: (A) Prevalence of injecting drug use was estimated using log-linear mo
OBJECTIVE: To evaluate the costs and cost-effectiveness of home-care assistance (HCA) as an alternative to hospital-based care only for patients with AIDS (PWA). DESIGN: A 6-month prospective study. Use of resources by a control group of PWA receiving ordinary hospital-based care (OC group) was compared with that by a
Engel RR; Samuel MC; Rieder HL; Billo N; Somaini B; Department of Biomedical and Environmental Health Sciences,; University of California, Berkeley 94720.
OBJECTIVES: To assess completeness and determinants of reporting to the AIDS registry of the Swiss Federal Office of Public Health. DESIGN AND METHODS: Death certificates indicative of AIDS or HIV for deaths occurring between December 1987 and June 1990 were reviewed and compared with reports to the AIDS registry. RES
Arnold BL; Itakura K; Rossi JJ; Department of Molecular Genetics, City of Hope, Duarte, CA 91010.
Beginning with 10(3)-10(5) molecules of a purified HIV-1 target sequence as a starting template, we have examined the effects of starting template concentration and cycle number on the amplification efficiency of the polymerase chain reaction. An external standard DNA sequence has been designed that when added to a DN
Physicians have key roles both in treating disease and educating their patients about health and disease-related issues. To assess which factors correlate with Austrian physician s willingness to treat and educate patients about HIV-related risk behaviors and deal with AIDS issues, we conducted a survey of general pra
AIDS Educ Prev. 1992 Winter;4(4):295-307. Unique Identifier : AIDSLINE MED/93112498
Langer LM; Zimmerman RS; Hendershot EF; Singh M; University of Miami, Florida.
This paper reports data on the effects that Earvin Magic Johnson s announced HIV infection had on the clients of an Philadelphia sexually-transmitted-disease (STD) clinic. Interviews conducted after Johnson s announcement (N = 148) included questions about whether respondents had heard his announcement and how this ne
AIDS Educ Prev. 1992 Winter;4(4):308-18. Unique Identifier : AIDSLINE MED/93112499
Clemo L; Department of Political Science, State University of New York,; Oswego 13216.
Many studies examining AIDS issues have detailed the policy implications of negative attitudes toward homosexuals, intravenous (IV) drug users, and the inner-city poor; however, none have specifically examined whether existing biases and prejudicial fears expressed toward HIV-infected adults also affect political resp
AIDS Educ Prev. 1992 Winter;4(4):319-27. Unique Identifier : AIDSLINE MED/93112500
Coleman M; Dept. of Child and Family Development, University of Georgia,; Athens 30602.
A survey of child care providers knowledge of human immunodeficiency virus (HIV) transmission and attitudes toward recommended child care policies regarding AIDS was conducted in a Southeastern state. Significant knowledge differences regarding HIV transmission were found between certain comparison groups, although a
AIDS Educ Prev. 1992 Winter;4(4):328-37. Unique Identifier : AIDSLINE MED/93112501
Deren S; Davis WR; Tortu S; Friedman S; Tross S; Sufian M; Pascal J; Stull C; Narcotic and Drug Research, Inc., New York, NY.
AIDS outreach workers operate at the frontlines of the AIDS epidemic to provide information and education to high-risk individuals. Recent reports indicate that these workers have been effective in helping to reduce high-risk behaviors. However, a review of retention data for 62 outreach workers employed from 1986 to
AIDS Educ Prev. 1992 Winter;4(4):338-44. Unique Identifier : AIDSLINE MED/93112502
Zimet GD; Department of Pediatrics, Case Western Reserve University School; of Medicine, Cleveland, OH.
A common approach to evaluating the reliability of AIDS knowledge scales has relied on the demonstration of internal consistency through the use of Kuder-Richardson formula 20 (KR-20) or coefficient alpha. In this study, the argument was made that, in a knowledge-based scale with diverse content (exemplified by AIDS k
AIDS Educ Prev. 1992 Winter;4(4):345-9. Unique Identifier : AIDSLINE MED/93112503
Leslie M; St. Pierre RW; Schuster PA; Department of Health Education, Pennsylvania State University,; Monroeville 15146.
The reliability of a measuring instrument is a major criterion for assessing its quality and adequacy. This article describes reliability pilot testing done with the Ohio AIDS Prevention Survey (Fellner & Thomas, 1989-90) in a sample of sexually active women of childbearing age. Previous alpha reliabilities of the
AIDS Educ Prev. 1992 Winter;4(4):350-61. Unique Identifier : AIDSLINE MED/93112504
Gwede C; McDermott RJ; University of South Florida College of Public Health, Department; of Community and Family Health, Tampa 33612-3805.
This paper reviews the current epidemiologic status of AIDS in sub-Saharan Africa, focusing on what is currently understood about the distinctive features of heterosexual transmission in young men, women, and children. Epidemiologic data show that AIDS is transmitted primarily through heterosexual vaginal intercourse.
Int Immunol. 1992 Nov;4(11):1233-43. Unique Identifier : AIDSLINE MED/93112573
Mills GB; Arima N; May C; Hill M; Schmandt R; Li J; Miyamoto NG; Greene WC; Toronto General Hospital, Ontario, Canada.
IL-2 is one of the principal growth factors regulating the proliferation of T lymphocytes. Although two independent IL-2-binding molecules have been molecularly cloned and shown to participate in the formation of a high affinity receptor complex, their primary structur
New global method for computer prediction of functional sites in nucleotide sequences, based on the fractal representation, is presented. Fractal representation of set of sequences (FRS) provides simple way for generating recognitions matrix of functionally similar sequences and simple estimations of its efficiency fo
Aten Primaria. 1992 Nov 1;10(7):865-7. Unique Identifier : AIDSLINE MED/93112848
Garcia Orus C; Canovas Verge D; Cordon Gurpegui F; Cayla Buqueras JA; Escuela Universitaria de Enfermeria, Cruz Roja, Barcelona.
OBJECTIVE. To understand better the characteristics of tuberculosis (TBC) in children and to identify sources of infection. DESIGN. Crossover study. SITE. At the community level in the city of Barcelona. PATIENTS. Children under 15 with tuberculosis, who were diagnosed between Oct 1, 1989 and Sept 30, 1990 and were re
LaFond RE; Eaton RB; Watt RA; Villee CA; Actor JK; Schur PH; Laboratory of Human Reproduction and Reproductive Biology,; Harvard Medical School, Boston, MA 02115.
Sera from U.S. patients with SLE, RA, and various malignancies, clinically normal individuals with sero-activity to HIV, AIDS, and from pregnant women were tested for the presence of anti-c-myc antibodies. In an ELISA using recombinant human c-myc protein as the antigen, no difference in mean antibody titer was genera
Thomas TJ; Gunnia UB; Thomas T; Program in Clinical Pharmacology, University of Medicine and; Dentistry of New Jersey-Robert Wood Johnson Medical School, New; Brunswick 08903.
Polyamines--putrescine, spermidine, and spermine--are a group of positively charged organic molecules that are present in all living cells. They are important regulators of cell growth and differentiation, but the precise mechanism of their action is not known. Ornithine decarboxylase (ODC) is a key enzyme in the bios
Weber R; Muller A; Spycher MA; Opravil M; Ammann R; Briner J; Departement Innere Medizin, Universitatsspital, Zurich.
A 39-year-old patient with acquired immunodeficiency syndrome was diagnosed as having intestinal Enterocytozoon bieneusi microsporidiosis after persistent watery diarrhea for 30 months and a 16-kg weight loss. Microsporidian parasites were found by light and electron m
This article explores the duty of health care providers to inform patients of the risk of contracting AIDS through blood transfusions that may be necessitated by surgery or other forms of medical treatment. Although the quantitative risk of receiving HIV-contaminated blood in a transfusion is small, the qualitative ri
Crockett CO; Guede-Guina F; Pugh D; Vangah-Manda M; Robinson TJ; Olubadewo JO; Ochillo RF; Laboratory of Pharmacology, Xavier University of Louisiana, New; Orleans 70125.
In our search for therapeutic agents from natural sources with potential for the treatment of opportunistic infections in patients afflicted with acquired immunodeficiency syndrome (AIDS), we investigated antibacterial and antifungal activities of water extracts of Cassia alata (C. alata). The extracts are traditional
Shimamoto Y; Yamaguchi M; Department of Internal Medicine, Saga Medical School, Japan.
HTLV-I induced not only nodal but also primary extranodal lymphomas. In this report we describe 12 patients with HTLV-I induced extranodal T-cell lymphoma collected from the literature and our institute experience. There were 5 males and 7 female patients of middle age positive for HTLV-I antibody. The sites of primar
To establish an animal model of AIDS, two different wild or adapted HIV2 Rod and Eho strains were cultivated on monkey cells from different species (baboons, cynomolgus, Rhesus monkeys). Five different available strains were then injected both by intravenous (i.v.) and intracerebral (i.c.) route into ten Rhesus monkey
Grau JM; Casademont J; Pedrol E; Fernandez-Sola J; Cardellach F; Barros N; Urbano-Marquez A; Department of Internal Medicine, Hospital Clinic i Provincial,; Barcelona, Spain.
Chronic fatigue syndrome represents a poorly defined disease with protean clinical manifestations, the majority of them expressed as a muscle fatigue or as inability to maintain the expected muscle strength. In the present work we studied muscle function and muscle histopathology in 20 patients fulfilling the proposed
East Afr Med J. 1992 Oct;69(10):563-5. Unique Identifier : AIDSLINE MED/93114295
Fox E; Constantine NT; Rodier G; Abbatte EA; U.S. Naval Medical Research Unit No. 3, Cairo, Egypt.
During a sero-survey for lymphotropic retroviruses, seven screening tests were performed for the three lymphotropic retroviruses of relevance in Djibouti , East Africa (HIV-1, HIV-2 and HTLV-1). Of the 82 subjects whose sera reacted in at least one retroviral screening assay, abou
Lacki J; Markowska J; Wiktorowicz K; Cell. Immunol. Lab., University School of Medicine, Poznan.
Phenotype of lymphocytes was estimated in 16 peritoneal fluids obtained from 9 ovarian cancer patients. Peritoneal fluids contained predominantly T cells (more than 80%) while B cell content was relatively low. Approximately 50% lymphocytes carried T-helper cell marker (CD4). Percentage of T-cytotoxic/suppressor cells
Dev Comp Immunol. 1992 Nov-Dec;16(6):425-30. Unique Identifier : AIDSLINE MED/93114463
Wegmann TG; Guilbert LJ; Department of Immunology, University of Alberta, Edmonton,; Canada.
In this review the afferent and efferent signals involved in immune signalling at the maternal-fetal interface are highlighted in the light of recent information. MHC antigen expression is reviewed. Immunizing mothers against class I and II MHC antigens can prevent spontaneous fetal resorption in mice. In addition, th
Gen Hosp Psychiatry. 1992 Nov;14(6):387-403. Unique Identifier : AIDSLINE MED/93114609
Bussing R; Johnson SB; University of Florida, Department of Psychiatry, Gainesville.
The human immunodeficiency virus (HIV) has had a fundamental impact on quality of life, delivery of care, and directions of research efforts for the hemophilia community. Studies of psychosocial issues in hemophilia before and after the HIV crisis are reviewed. Before this crisis, research addressed personality factor
Harefuah. 1992 Nov 1;123(9):315-9, 372. Unique Identifier : AIDSLINE MED/93114671
Mankuta D; Holcberg G; Glezerman M; Dept. of Obstetrics and Gynecology, Soroka Medical Center, Beer; Sheba.
The epidemic of human immunodeficiency virus (HIV) is now affecting populations that were less susceptible in the early 1980s. It is estimated that 8% of patients with AIDS in the US are women in the reproductive age, and 1% are children. In Israel up to 1992, 134 women and 14 chil
Hornick D; Schlesinger L; Wenzel R; University of Iowa College of Medicine.
Since 1985 there has been an 18% increase in the number of cases of tuberculosis nationally. Even more alarming is the increasing incidence of multidrug-resistant tuberculosis which presents a serious public health problem, particularly for HIV-infected patients.
Bergamini A; Perno CF; Capozzi M; Mannella E; Salanitro A; Calio R; Rocchi G; Department of Public Health, University of Rome, Tor Vergata,; Italy.
A sensitive assay was developed for in vitro evaluation of anti-HIV agents in monocyte-macrophage cells (M/M) (a crucial target of HIV in the body). Monocyte-macrophage cells are usually poorly sensitive to the cytopathic effect induced by HIV. However, when fresh adherent monocyte-macrophage cells are cultured at rel
Martin EM; Robertson LC; Edelstein HE; Jagust WJ; Sorensen DJ; San Giovanni D; Chirurgi VA; Department of Neurology, University of California-Davis.
HIV-seropositive and seronegative control subjects performed a standard paper-and-pencil version and an experimental reaction time version of the Stroop Color-Word Naming Task. Results indicated that both symptomatic and asymptomatic HIV-positive subjects showed an exaggerated Stroop effect compared to controls, but t
Shuler KR; Dunham RG; Kanda P; Department of Virology and Immunology, Southwest Foundation for; Biomedical Research, San Antonio, TX 78228.
In this report, we have described methods to improve the efficiency of coupling synthetic peptides to keyhole limpet hemocyanin (KLH) and for the analysis of the composition of the resulting peptide-protein conjugates. KLH was first dissolved in buffers containing 3 M guanidine hydrochloride to maintain solubility and
Mandy FF; Bergeron M; Recktenwald D; Izaguirre CA; Division of Infectious Immunology, Bureau of Laboratories and; Research Services, Health and Welfare Canada, Ottawa, Ontario.
We describe a method for simultaneous analysis of CD3, CD4, and CD8 positive cells from whole blood utilizing single laser flow cytometers. All three T cell values are attained from a single test tube. CD4 and CD8 positive cells are identified only if they are CD3 positive. Thus the values obtained by this method for
Int J Lepr Other Mycobact Dis. 1992 Sep;60(3):353-67. Unique Identifier : AIDSLINE MED/93115542
Mullins RJ; Fournie JJ; Moloney B; Baumgart K; Jones P; Brown P; Basten A; Centenary Institute of Cancer Medicine and Cell Biology,; University of Sydney, New South Wales, Australia.
The serological response to a monoclonal antibody-defined phosphatidylinositol mannoside (L4-PIM) present in all mycobacteria was examined in patients with various mycobacterial diseases and healthy subjects from different populations. IgG but not IgM antibodies were detected in most patients with untreated lepromatou
J Ky Med Assoc. 1992 Nov;90(11):548-54. Unique Identifier : AIDSLINE MED/93115571
Stapleton M; Adams K; Finger R
Of all reported Kentucky adult/adolescent cases of AIDS (124) with diagnosis dates from July 1, 1990, through June 30, 1991, 33% died within three months of diagnosis. To discern possible reasons for these very short survival times, information was analyzed from the CDC AIDS Confidential Case Report of the 124 patient
Cordoliani YS; Derosier C; Pharaboz C; Jeanbourquin D; Schill H; Cosnard G; Service d'imagerie medicale, Hopital d'instruction des Armees; du Val-de-Grace, Paris.
AIM: Determining which semiological criteria might help to suggest lymphoma when an intracerebral mass in observed in a patient with AIDS. The use of these criteria might shorten the duration of the anti-toxoplasmic test treatment and to perform puncture earlier. The fast growth of the lymphomas may account for the ra
Jaffe IA; Department of Medicine, Columbia University College of Physicians; and Surgeons, New York, NY.
The approach to the treatment of rheumatoid arthritis is currently undergoing fundamental change. The demonstration of erosions by magnetic resonance imaging early in the disease, when conventional radiographs only show soft tissue swelling, demands rapid intervention with more effective drugs. The increasing use of m
Sakiyama H; Nishi K; Kikukawa H; Ueda S; Department of Urology, Kumamoto University Medical School.
Patients with human T-cell lymphotropic virus type 1 associated myelopathy (HAM) have complaints of urinary disturbance frequently. Symptoms and urodynamic examinations were evaluated in untreated twenty-one patients with HAM. Although two cases (11%) had no urinary symptom, nineteen cases (89%) suffered from dysuria,
Tanaka N; Saitoh A; Nakata A; Shinagawa H; Department of Experimental Chemotherapy, Osaka University, Japan.
A simple method for the overproduction in Escherichia coli and purification of major core protein p24 of human immunodeficiency virus type 1 (HIV-1) was described. The gag-pol region encoding p24, p15, and protease was fused to 3 end of lacZ gene on plasmid. A LacZ-Gag fusion protein, the major primary product, is de
Choudhury AM; Yamada O; Wakamiya N; Kurimura T; Department of Pathology, Research Institute for Microbial; Diseases, Osaka, Japan.
As the majority of human immunodeficiency virus (HIV) carriers are in asymptomatic stage for a long period of time, it is important to investigate the factors or surrogate markers for conversion from asymptomatic to symptomatic stage. Our study is designed to evaluate the relationship among virus isolation rate, anti-
Lal RB; Hjelle B; Rudolph DL; Retrovirus Diseases Branch, Centers for Disease Control, Atlanta,; GA 30333.
Peripheral blood lymphocytes obtained from HTLV-II-infected persons (n = 13) and cultured in the absence of exogenous stimulator demonstrated augmented spontaneous proliferation (17,672 +/- 5,498 cpm) when compared with cells from healthy donors (1,921 +/- 1,306 cpm). Removal of non-T population did not abrogate the p
Med Hypotheses. 1992 Nov;39(3):225-8. Unique Identifier : AIDSLINE MED/93116656
Krvavac S; Public Health Center Stari Grad, Sarajevo, Bosnia.
All three existing species of human trichomonads cause similar immune and histopathological host responses. The elicited crossimmunity causes interspecific competition of trichomonal infections in their typical localizations, which results in very rare simultaneous colonization of the same host by different species. T
Borensztein L; Hatin I; Simonpoli AM; Ugarte E; Girard PM; Jaureguiberry G; INSERM U.13, Hopital Claude Bernard, Paris, France.
We have used new specific primers and probe in a polymerase chain reaction (PCR) followed by Southern blot assays to detect Pneumocystis carinii in human bronchoalveolar lavage samples obtained from HIV-infected patients with pulmonary symptoms. To facilitate the procedure we developed a filtration technique without D
Williams DL; Gillis TP; Fiallo P; Job CK; Gelber RH; Hill C; Izumi S; G. W. Long Hansen's Disease Center, LSU SVM, Baton Rouge 70894.
An improved protocol for PCR analysis of Mycobacterium leprae-infected tissues, based on enzymatic lysis, has been developed and used to demonstrate the feasibility of using PCR for detecting M. leprae in routine skin biopsies taken from leprosy patients throughout the clinical spectrum. Of 92 multibacillary patients
Raineri I; Senn HP; Institute for Medical Microbiology, University of Basel,; Switzerland.
To study host gene activation by retroviral promotor insertion, a polymerase chain reaction (PCR) assay was developed. This method allows a sensitive and selective detection of chimeric provirus-host gene transcripts, hallmarks of insertional activation events, which does not rely on an induction of tumor cell growth.
Public Health. 1992 Nov;106(6):449-56. Unique Identifier : AIDSLINE MED/93117320
Doyle YG; Conway M; Camberwell Health Authority/South East London Commissioning; Agency, London.
Almost one quarter of all deaths among residents of Camberwell District Health Authority during 1990 occurred without the district ( transferable deaths ). These deaths differed from total deaths in that the main cause of study deaths was cancer, and many of these cases died in a hospice with which the district has no
Swiderska H; Kalinowska B; Zaklad Immunopatologii Panstwowego Zakladu Higieny, Warszawie.
The incidence of various patterns of antibodies against HIV 1 proteins was tested by Western blot in EIA--positive serum samples from intravenous drug abusers. The presence of anti-p24, anti-gp160 and anti-gp120 antibodies was the most typical pattern suggestive for early humoral response. In most instances of indeter
Roig P; Carrasco R; Salavert M; Navarro V; Guix J; Nieto A; Bernacer B; Seccion de enfermedades infecciosas, Hospital General; Universitario de Valencia Hospital Clinico Universitario de; Valencia.
Candidiasic laryngitis is a very rare Candida spp infection of mucosa, appearing typically in immunosuppressed patients, mainly in patients with neoplasia, and, recently, in patients with Human Immunodeficiency Virus (VIH) infection. We present four cases of candidiasic laryngitis and HIV infection, as well as the cli
Almenar L; Sotillo J; Osa A; Fenollosa B; Perello A; Moreno MT; Salvador A; Lopez-Aldeguer J; Algarra F; Servicio de Cardiologia, Hospital La Fe, Valencia.
We studied by Echocardiographic-Doppler 114 consecutive intravenous drugs addicts (IVDA); 91 were positive human immunodeficiency virus (HIV+) and 23 negatives. We classified them in five groups; beginning the negative HIV as group 0, and groups I to IV stratified according the Central Disease Control (CDC) classifica
Schweiz Rundsch Med Prax. 1992 Dec 22;81(52):1561-4. Unique Identifier : AIDSLINE MED/93117629
Brandli O; Zurcher Hohenklinik, Faltigberg-Wald.
In spite of alarming reports from third world and industrialized countries, no increase in the incidence of tuberculosis has been seen in Switzerland . This is mainly attributable to the consistently performed initial treatment with a multiple-drug combination and the good comp
Boldsen JL; Jeune B; Madsen PC; Institute of Community Health, University of Odense, Denmark.
In nearly 2,000 intercourses 14 different types of condoms were tested by 80 heterosexual and seven homosexual volunteer couples. The test couples were generally quite experienced in the use of condoms. It appears that the condoms rarely (1.3%) ruptured or slipped off during the actual intercourse. This means that emp
Margo CE; Hamed LM; Department of Ophthalmology, University of Florida College of; Medicine, Gainesville.
There has been a steady increase in the number of cases of syphilis in the United States since the middle 1980s, with a dramatic rise in incidence among heterosexual men and women and of congenital syphilis. There also have been changes in geographic distribution of cases and an associ
Trans R Soc Trop Med Hyg. 1992 Sep-Oct;86(5):467-9. Unique Identifier : AIDSLINE MED/93118113
Porter JD; McAdam KP; Department of Clinical Sciences, London School of Hygiene and; Tropical Medicine, UK.
An estimated 2.8 million people in Africa have dual infections with tuberculosis and human immunodeficiency virus (HIV). Because of the increasing numbers of cases of tuberculosis as a consequence of the HIV epidemic, chemoprophylaxis may become a cost effective tuberculosis control measure in high prevalence countrie
Trans R Soc Trop Med Hyg. 1992 Sep-Oct;86(5):470-1. Unique Identifier : AIDSLINE MED/93118114
Brindle R; Wellcome Trust Research Laboratories, Nairobi, Kenya.
A group of African patients with tuberculosis were followed over the first month of treatment to assess the bactericidal response to 2 treatment regimens (streptomycin/thiacetazone/isoniazid and streptomycin/rifampicin/isoniazid/pyrazinamide). Patients also infected with human immunodeficiency virus (HIV) had lower pr
Trans R Soc Trop Med Hyg. 1992 Sep-Oct;86(5):511-2. Unique Identifier : AIDSLINE MED/93118127
Da-Cruz AM; Machado ES; Menezes JA; Rutowitsch MS; Coutinho SG; Instituto Oswaldo Cruz, Rio de Janeiro, Brazil.
The lymphocyte responsiveness to leishmanial antigens and its influence on the course of cutaneous leishmaniasis was studied in a patient with AIDS-associated American cutaneous leishmaniasis caused by Leishmania braziliensis. The patient had cutaneous disseminated erythematous papules or nodules and mucosal lesions a
Trans R Soc Trop Med Hyg. 1992 Sep-Oct;86(5):516. Unique Identifier : AIDSLINE MED/93118130
Molina R; Lopez-Velez R; Gutierrez-Solar B; Jimenez I; Alvar J; Servicio de Parasitologia, Centro Nacional de Microbiologia,; Instituto de Salud Carlos III, Majadahonda, Madrid, Spain.
Trans R Soc Trop Med Hyg. 1992 Sep-Oct;86(5):543-5. Unique Identifier : AIDSLINE MED/93118140
Hunter G; Bagshawe AF; Baboo KS; Luke R; Prociv P; Department of Parasitology, University of Queensland, Australia.
Previous studies have found a high prevalence of Isospora belli and Cryptosporidium parvum infections in African acquired immune deficiency syndrome (AIDS) patients with chronic diarrhoea. We aimed to determine the prevalence of gastrointestinal parasite in AIDS patients in hospital, not only those with diarrhoea, and
Higashi J; Kumagai S; Hatanaka M; Imura H; Department of Second Internal Medicine, Faculty of Medicine,; Kyoto University, Japan.
Sera of patients with systemic lupus erythematosus (SLE) were tested for their reactivity to HTLV-I by western blotting (WB). Seven (18%) of 40 SLE serum samples reacted to the p24gag protein of HTLV-I by WB using purified gag antigens. The specificity of anti-p24gag antibodies in the SLE sera was confirmed by competi
West J Med. 1992 Dec;157(6):637-40. Unique Identifier : AIDSLINE MED/93118291
Tucker KJ; Anton B; Tucker HJ; Intensive Care Unit, California Pacific Medical Center, San; Francisco.
To determine the frequency and distribution of pneumonia in an intensive care unit (ICU), we retrospectively examined the records of 1,854 consecutive ICU admissions between January 1987 and April 1990. A total of 266 patients met criteria for pneumonia (unilateral or bilateral infiltrate by chest roentgenogram, plus
Am J Med Sci. 1992 Sep;304(3):168-73. Unique Identifier : AIDSLINE MED/93118676
Nolan CM; Seattle-King County Department of Public Health, University of; Washington, Seattle 98104.
Optimum treatment of tuberculosis in persons with human immunodeficiency virus (HIV) infection is still being defined. Tuberculosis treatment failure in an HIV-infected patient is described and 10 similar cases from the medical literature are reviewed to search for common patterns associated with an adverse outcome of
Am J Med Sci. 1992 Sep;304(3):180-7. Unique Identifier : AIDSLINE MED/93118678
Duvic M; University of Texas Medical School, M. D. Anderson Cancer Center,; Houston 77030.
The human immunodeficiency virus (HIV) is a member of a family of retroviruses that cause chronic persistent infections in animals and in humans. The structure of this virus resembles that of other retroviruses but also contains important and complex regulatory elements. The expression of HIV can be influenced by the
Am J Med Sci. 1992 Sep;304(3):188-91. Unique Identifier : AIDSLINE MED/93118679
Nedelcu I; Department of Dermatology, Central Military Hospital, Bucharest,; Romania.
Of the 1446 AIDS cases reported in Romania , 79% were in the pediatric age group. Of these children, 28% lived with their families, 30% were orphans, and 42% were abandoned. Among the AIDS-affected children, 32% were less than 1 year old and 67% were 1-4 years old. The natural hist
Ann Fr Anesth Reanim. 1992;11(5):558-75. Unique Identifier : AIDSLINE MED/93118969
Lelarge P; Mariot J; Departement d'Urgence et de Reanimation, Hopital Central,; Nancy.
Candida proliferate within the body of patients with deficient cellular immunity either by the haematogenous route or by adjacency. This condition is often found in hospital patients. It explains the increasing incidence of disseminated candidiasis. They are preferentially found in patients who have had complicated su
Appl Environ Microbiol. 1992 Dec;58(12):3984-90. Unique Identifier : AIDSLINE MED/93119153
Ansari SA; Farrah SR; Chaudhry GR; Department of Biological Sciences, Oakland University, Rochester,; Michigan 48309.
The human immunodeficiency virus type 1 (HIV-1) released by infected individuals or present in human and hospital wastes can potentially cause contamination problems. The presence of HIV-1 was investigated in 16 environmental samples, including raw wastewater, sludge, final effluent, soil, and pond water, collected fr
Kavanagh KH; Harris RM; Hetherington SE; Scott DE; School of Nursing, University of Maryland, Baltimore.
An eight-session training model used a social interactive framework to combine theoretical and methodological aspects of peer counseling, cross-cultural communication, and transcultural nursing, with a conviction that the participants (volunteers from an ongoing, urban methadone maintenance program) had significant st
Aust N Z J Psychiatry. 1992 Dec;26(4):560-6. Unique Identifier : AIDSLINE MED/93119343
Perdices M; Dunbar N; Grunseit A; Hall W; Cooper DA; National Centre in HIV Epidemiology and Clinical Research,; University of New South Wales, Sydney.
Levels of anxiety and depression were assessed for 207 HIV seropositive homosexual/bisexual men (AIDS = 34, ARC = 72, asymptomatic HIV infection = 101), and 36 seronegative controls. Lymphocyte subset enumeration, history of opportunistic infections, and occurrence of HIV-related symptoms were recorded at the time of
Addy JH; University of Ghana Medical School Accra.
A 52-years-old policeman suffering from tuberculous meningitis, developed pseudo-umbilicated nodular skin lesions which increased rapidly in size during the course of his illness. Histology revealed cutaneous sporotrichosis. Human immuno-deficiency virus infection was excluded by absence of history of exposure and rep
Okpara RA; Department of Medicine, Central Hospital Owerri Imo State,; Nigeria.
An attempt has been made to review the available strategies to contain the spread of the Acquired Immunodeficiency Syndrome (AIDS). Also options for clinical management of AIDS patients are summarized. Development and production of a suitable vaccine is the ultimate goal in the attempts to stop the spread of AIDS. Th
Hofman P; Le Tourneau A; Negre F; Michiels JF; Diebold J; Department of Pathology, Hopital Pasteur, Nice, France.
A case of primary intraocular malignant lymphoma without cerebral involvement is reported in a 30-year-old man with acquired immunodeficiency syndrome. The study of the enucleation specimen showed a B immunoblastic lymphoma with a CD30 positive anaplastic large cell component. There was no involvement of the adnexal s
Kojima H; Ikeda H; Kubo T; Higuchi A; Fujimoto N; Nishibe M; Nagashima K; Department of Pathology, Kushiro Rohsai Hospital, Japan.
A large gastric lymphoma was detected in a 42-year-old woman who was seropositive for HTLV-I. The tumor was histologically shown to be of diffuse large cell type, and phenotypic analysis revealed high expression of CD3 and CD4, indicative of a helper/inducer type of T-cell lymphoma. In Southern blot analyses, the tumo
Ronald AR; Corey L; McCutchan JA; Handsfield HH; Department of Internal Medicine, University of Manitoba,; Winnipeg, Canada.
Chancroid is a mucocutaneous infection caused by Haemophilus ducreyi that produces ulcerative lesions and enhances the efficiency of transmission of human immunodeficiency virus (HIV). Confirmation of infection by culture of H. ducreyi is essential in therapeutic trials. Minimal inhibitory concentrations of antibiotic
Ronald AR; Silverman M; McCutchan JA; Corey L; Handsfield HH; Department of Internal Medicine, University of Manitoba,; Winnipeg, Canada.
Syphilis is caused by Treponema pallidum, a spirochetal bacterium pathogenic only for humans. The clinical course of disease is divided into three stages interspersed by periods of latency. Penicillin remains the treatment of choice for all stages of infection; tetracycline or erythromycin may be used as therapeutic a
Sande MA; Whitley RJ; McCracken GH; Lentnek A; Scheld WM; Department of Medicine, San Francisco General Hospital,; California.
Toxoplasma gondii is a protozoan that exists in three forms, all of which are potentially infectious for humans. After acute infection, cysts persist in the central nervous system and extraneural tissue. Human hosts with compromised immunity, particularly those with the acquired immunodeficiency syndrome, are vulnerab
Medoff G; Dismukes WE; Pappagianis D; Diamond R; Gallis HA; Drutz D; Infectious Diseases Division, Washington University School of; Medicine, St. Louis, Missouri 63110.
These guidelines are applicable to all fungal pathogens that produce systemic infections in humans. Specific examples are provided whenever they might clarify special issues. Systemic fungal infections usually are divided into two broad categories: endemic systemic fungal diseases, which occur classically in healthy h
Hopewell P; Cynamon M; Starke J; Iseman M; O'Brien R; Chest Service, San Francisco General Hospital, California 94110.
The bacteria of the Mycobacterium avium complex are ubiquitous; thus it is often difficult to distinguish environmental contamination from colonization or infection. Patients with either pulmonary or disseminated infection may be enrolled in clinical trials. Disseminated disease occurs mostly in patients infected with
Corey L; McCutchan JA; Ronald AR; Handsfield HH; Department of Medicine, University of Washington School of; Medicine, Seattle.
This guideline addresses clinical trials of new therapies for genital infections due to herpes simplex virus (HSV). Of the two types of virus, HSV-2 is the more common pathogen. Both HSV-1 and HSV-2 become latent in sacral nerve root ganglia and intermittently reactivate. Patients who have frequent recurrences (more t
Neil GA; Sammons DW; Department of Internal Medicine, University of Iowa, Iowa City; 52242.
Human hybridomas with specificity for recombinant hepatitis B surface antigen (HBSAg) were produced by adoptive transfer of human peripheral blood mononuclear cells prepared from HBSAg-immune donors to CB.17 mice bearing the severe combined immunodeficiency (SCID) phenotype. A total of ten SCID-Hu mice were immunized
Gopinath R; Hutcheon M; Cheema-Dhadli S; Halperin M; Department of Medicine, University of Toronto, Ontario, Canada.
A 30-yr-old man with acquired immunodeficiency syndrome treated with zidovudine developed biopsy-proven mitochondrial myopathy. Chronic lactic acidosis (lactate, 10 +/- 1 mmol/L) persisted for more than 5 wk. Liver function tests were normal, but the concentration of lactose rose to 16.1 mmol/L when 500 mmol of ethano
Sridhar NR; Blanton M; Whitacre L; Balakrishnan K; First MR; Division of Nephrology and Hypertension, University of Cincinnati; Medical Center, OH 45267-0585.
The presence of the S6F1+ epitope on the surface of CD8+ lymphocytes is believed to be uniquely representative of cytotoxic subpopulations. A preliminary study was conducted to evaluate the CD8+ S6F1+ peripheral lymphocytes by flow cytometry in patients undergoing renal allograft biopsy for allograft dysfunction. Lymp
Int J Hematol. 1992 Dec;56(3):233-7. Unique Identifier : AIDSLINE MED/93120526
Marutsuka K; Suzumiya J; Sumiyoshi A; First Department of Pathology, Miyazaki Medical College, Japan.
Cavitating necrosis is rare in Pneumocystis carinii pneumonia. In this report, we describe an autopsy patient with adult T-cell leukemia associated with cavitating Pneumocystis carinii pneumonia. The patient, a 61-year-old woman, died of an acute crisis of adult T-cell leukemia associated with diffuse pulmonary infect
Barrera L; de Kantor I; Ritacco V; Reniero A; Lopez B; Benetucci J; Beltran M; Libonatti O; Padula E; Castagnino J; et al; National Institute of Microbiology, Buenos Aires, Argentina.
The effect of the human immunodeficiency virus (HIV) on mycobacterial antibody production was investigated. Using an enzyme-linked immunosorbent assay (ELISA) for detecting IgG against Mycobacterium tuberculosis PPD, it was observed that individuals at risk of HIV infection show a pattern of humoral response to the tu
Nisar M; Narula M; Beeching N; Davies PD; Tuberculosis Research Unit, Sefton General Hospital, Liverpool,; UK.
Numbers of tuberculosis notifications in England and Wales increased by 8% from 1987 to 1989. An analysis of notifications by age and sex has been undertaken to determine whether this increase has been due to an increase in young male adults, as has occurred in the USA, implying that HIV is largely responsible for the
Githui W; Nunn P; Juma E; Karimi F; Brindle R; Kamunyi R; Gathua S; Gicheha C; Morris J; Omwega M; Kenya Medical Research Institute, Nairobi.
We have set up a cohort of human immunodeficiency virus (HIV) positive and negative patients with tuberculosis in order to address the problems associated with HIV-related tuberculosis. We present here the results of sputum smear microscopy, culture, mycobacterial identification tests and drug susceptibility assays fr
Ann Pharmacother. 1992 Nov;26(11):1365-9. Unique Identifier : AIDSLINE MED/93120682
Cortese LM; Gasser RA Jr; Bjornson DC; Dacey MJ; Oster CN; Henry M. Jackson Foundation, Walter Reed Army Medical Center,; Washington, DC 20307.
OBJECTIVE: To report a case of recurrent pentamidine-induced torsades de pointes (TdP) and to review previously reported cases in the literature. DATA SOURCES: Medical records of the subject patient, case reports, and relevant studies identified by MEDLINE. DATA EXTRACTION: Data were abstracted from pertinent publishe
Kikuchi Y; Oka S; Kimura S; Mitamura K; Shimada K; Department of Infectious Diseases, University of Tokyo, Japan.
A gene amplification method of Mycobacterium tuberculosis DNA by the polymerase chain reaction (PCR) has been devised. A primer pair used in this study is 5 GTTGCCGTGGCGG TATCGG3 and 5 GCGACATTACGGGGCAGGTGG3 , which brackets a 152-base region encoding the 65KD antigen, and a specific probe is 5 TTTGGGGTCATCTTTGGAGCG3
Ijichi T; Higuchi I; Fukunaga H; Izumo S; Osame M; Third Department of Internal Medicine, Faculty of Medicine,; Kagoshima University, Japan.
Recent epidemiologic studies have shown that human T-lymphotropic virus type I (HTLV-I) is associated with polymyositis. To clarify the histological features of HTLV-I positive polymyositis, we studied muscle tissue from two groups of patients with polymyositis, those seropositive for HTLV-I (5 patients) and those ser
Chung Kuo Chung Hsi I Chieh Ho Tsa Chih. 1992 Aug;12(8):478-9, 453-4. Unique Identifier : AIDSLINE MED/93120817
Fan GR; Affiliated Subei People's Hospital of Yang Zhou Medical College,; Jiangsu.
T lymphocyte subsets were investigated in 57 aged persons with Kidney Deficiency Syndrome as well as in 30 normal controls with application of the monoclonal antibody (OKT3, OKT4, OKT8). The results showed that the percentage of OKT3, OKT4 in the aged persons was significantly lower than that of control (P
Ger J Ophthalmol. 1992;1(2):91-5. Unique Identifier : AIDSLINE MED/93121022
Mueller AJ; Lachenmayr BJ; Eckstein A; Holzl M; Universitats-Augenklinik, Munchen, Federal Republic of Germany.
In all, 55 eyes of 55 patients were examined prospectively in random order with the Humphrey field analyzer [central field 76 points, full threshold strategy, single-stimulus presentation, response-button control (HFA 1); central field 76 points, defect-depth strategy, response-button control (HFA 2)] and the Dicon TK
Winters MA; Holodniy M; Katzenstein DA; Merigan TC; Center for AIDS Research, Stanford University Medical Center,; California 94305-5107.
We have developed a quantitative gene amplification procedure to assess the replication of human immunodeficiency virus (HIV) in cell cultures and evaluate the effect of drugs on viral replication. Increases in HIV gag RNA and DNA in phytohemagglutinin-stimulated normal peri-pheral blood mononuclear cells (PBMC) infec
Casareale D; Pottathil R; Diaco R; Roche Molecular Systems, Branchburg, New Jersey 08876-1760.
To simplify our procedure for blood sample processing for PCR, we introduced a simpler, shorter, and more cost-effective method for the separation of peripheral blood lymphocytes (PBL) and DNA extraction for amplification with Taq polymerase. By this method, blood samples are processed in two simple 15-min steps: (1)
Rodrigues J; Niederman MS; State University of New York, Stony Brook.
Although pregnancy is infrequently complicated by pneumonia, lung infection by bacteria, viruses, and fungi can pose serious maternal and fetal hazards. Pneumonia may lead to preterm labor and certain infecting agents, most notably the HIV virus, can cross the placenta and lead to neonatal infection. There is some evi
FEMS Microbiol Lett. 1992 Dec 15;79(1-3):423-31. Unique Identifier : AIDSLINE MED/93122558
Razin S; Department of Membrane and Ultrastructure Research, Hebrew; University-Hadassah Medical School, Jerusalem, Israel.
Mycoplasmas are the smallest and simplest prokaryotes capable of self-replication, with information provided by a genome which may be as small as 600 kb, estimated to carry less than 500 genes. Keeping the number of structural elements, metabolic pathways and components of the protein synthesizing machinery to an esse
Brackmann HH; Eickhoff HJ; Oldenburg J; Hammerstein U; Institute for Experimental Haematology and Blood Transfusion,; Bonn, FRG.
Between 1978 and 1989, a controlled study was performed on children and adolescents suffering from severe haemophilia A. Special attention was given to long-term therapy adjusted to the patients requirements. The clinical and the X-ray scores of the Orthopaedic Advisory Committee of the World Haemophilia Society were
de Tezanos Pinto M; Fernandez J; Perez Bianco PR; Fundacion de la Hemofilia, Instituto de Investigaciones; Hematologicas. Buenos Aires, Argentina.
Between 1960 and 1991, 156 episodes of central nervous system (CNS) bleeding were documented in 106 patients from a total population of 1,410 hemophiliacs (7.5%). Ninety-one hemophilia A patients presented 131 bleeding episodes; 15 hemophilia B patients had 25 episodes. 32% of these episodes took place in patients les
In many countries we could note the dramatic developments in regard to financial assistance of HIV-infected haemophiliacs and their families since we distributed the first overview on this to all World Federation of Hemophilia member countries. As a result of the untiring efforts of the National Haemophilia Societies,
Martin-Villar J; Hematology Service, La Paz Hospital, Madrid, Spain.
In 1967, once urgent blood requirements had been resolved in La Paz Hospital, Madrid, Spain , and adequate supplies of plasma for cryoprecipitation, therefore, being available, a Hemophilia Unit (later Hemophilia Center) was set up to attend to the comprehensive care of hemophilia pa
Health Soc Work. 1992 Nov;17(4):261-72. Unique Identifier : AIDSLINE MED/93122657
Rhodes F; Wolitski RJ; Thornton-Johnson S; Psychology Department, California State University, Long Beach; 90840.
This article describes the development and implementation of an acquired immune deficiency syndrome (AIDS) intervention program for female sex partners of male injection-drug users. Four psychoeducational workshops were designed to motivate personal risk reduction, provide participants with necessary cognitive and beh
Health Soc Work. 1992 Nov;17(4):273-81. Unique Identifier : AIDSLINE MED/93122658
Smith MY; Knickman JR; Oppenheimer LM; Health Research Program, Robert F. Wagner School of Public; Service, New York University, NY 10003.
Despite pressing need, the development of a continuum of long-term-care services for people with acquired immune deficiency syndrome (AIDS) has been hampered by the dearth of information on the characteristics and service needs of patients eligible for such care. This article presents findings from a process evaluatio
Immunol Lett. 1992 Sep;34(1):27-30. Unique Identifier : AIDSLINE MED/93122849
Gallily R; Salman M; Tarshis M; Rottem S; Lautenberg Center for General and Tumor Immunology, Hebrew; University-Hadassah Medical School, Jerusalem, Israel.
We have demonstrated that Mycoplasma fermentans (incognitus strain), as well as M. fermentans KL4, PG 18 and IM 1 strains have the ability to activate human peripheral blood monocytes and murine macrophages of two inbred strains to secrete a high level of tumor necrosis factor alpha (TNF alpha) in a dose-dependent man
Indian J Med Res. 1992 Sep;95:213-5. Unique Identifier : AIDSLINE MED/93122872
Kulkarni S; Thakar M; Rodrigues J; Banerjee K; National Institute of Virology, Pune.
Two hundred serum samples were tested to detect the presence of HIV-2 infection in Maharashtra state. The serum samples were derived from various groups including those with high risk behaviour for HIV infection. All samples were tested by three combined HIV-1 and HIV-2 ELISA kits. The reactivity was confirmed by LiaT
Int J Pept Protein Res. 1992 Sep-Oct;40(3-4):180-93. Unique Identifier : AIDSLINE MED/93122966
Schnolzer M; Alewood P; Jones A; Alewood D; Kent SB; Scripps Research Institute, La Jolla, CA.
Simple, effective protocols have been developed for manual and machine-assisted Boc-chemistry solid phase peptide synthesis on polystyrene resins. These use in situ neutralization [i.e. neutralization simultaneous with coupling], high concentrations (> 0.2 M) of Boc-amino acid-OBt esters plus base for rapid coupling,
Int J Pept Protein Res. 1992 Sep-Oct;40(3-4):214-21. Unique Identifier : AIDSLINE MED/93122969
Defoort JP; Nardelli B; Huang W; Tam JP; Rockefeller University, New York, NY.
We describe a peptide vaccine model containing a built-in adjuvant. This model used a multiple antigen peptide system (MAPS) to amplify peptide antigens and a lipoamino acid, tripalmitoyl glyceryl cysteine (P3C), as a built-in adjuvant. An 18-residue peptide antigen (B2) derived from the third variable domain (amino a
This report details the structure-activity relationships of the HIV gag substrate analog Val-Ser-Gln-Asn-Leu psi[CH(OH)CH2]Val-Ile-Val (U-85548E), an inhibitor exhibiting subnanomolar affinity towards HIV type-1 aspartic proteinase (HIV-1 PR). Our data show that the P1-P2 tripeptidyl sequence provides the minimal che
Nogales-Gaete J; Syndulko K; Tourtellotte WW; Depto de Medicina, Facultad Medicina, Universidad de Chile,; Santiago.
This paper will focus on CSF findings in HIV-1 Neurological Disease (ND). Why use CSF as exploration window of the HIV-CNS involvement? Traditionally, CSF analysis has been an effective diagnostic method as well as a means of monitoring treatment in several infectious and immune pathologies of the CNS. Consequently th
Issues Ment Health Nurs. 1992 Oct-Dec;13(4):357-67. Unique Identifier : AIDSLINE MED/93123073
Carnes BA
Nurses as well as other health-care professionals have been impacted by the current human immunodeficiency virus (HIV) epidemic. Issues related to virus transmission, voluntary testing, and professional requirements to provide care for those infected can trigger emotional as well as cognitive responses for all involve
Health Visit. 1992 Oct;65(10):340-1. Unique Identifier : AIDSLINE MED/93123082
Levene S
The health of the nation white paper sets targets in five key areas for reductions in both mortality and morbidity: coronary heart disease and stroke, cancers, mental illness, HIV/Aids and sexual health and accidents. In a series of articles in Health visitor, experts will be considering the opportunities the white pa
Gwa LH; Hsieh CC; Ko YC; Lan SJ; Department of Epidemiology, Harvard School of Public Health,; Boston.
We discuss some theoretical features underlying the successful uses of pooling in testing HIV seroprevalence. In particular it is shown that there is a scaling relation for the distribution of positive sera among the pools. A multi-stage pooling method consisting of repeatedly halving the positive pools is proposed. C
Gow JW; Simpson K; Schliephake A; Behan WM; Morrison LJ; Cavanagh H; Rethwilm A; Behan PO; Department of Neurology, University of Glasgow, UK.
AIM: To examine peripheral blood and skeletal muscle from patients with chronic fatigue syndrome for exogenous retrovirus. METHODS: Blood samples from 30 patients and muscle biopsy specimens of 15 patients were examined for retroviral sequences by DNA extraction, polymerase chain reaction (PCR), and Southern blotting
Menni S; Brancaleone W; Grimalt R; First Department of Dermatology and Pediatric Dermatology,; University of Milan, Istituto di Ricovero e Cura a Carattere; Scientifico Ospedale Maggiore, Italy.
Sanchez-Viera M; Hernanz JM; Sampelayo T; Gurbindo MD; Lecona M; Soto-Melo J; Department of Dermatology, Hospital General Gregorio Maranon,; Madrid, Spain.
De Vega T; Echevarria S; Crespo J; Artinano E; San Miguel G; Pons Romero F; Gastroenterology Service, Marques de Valdecilla University; Hospital, Santander, Spain.
We report a young male IVDA with CAH caused by HBV who was infected with HIV and who contracted listeriosis in the form of acute hepatitis and bacteremia, with epithelioid granulomas in the liver. Treatment with ampicillin and a aminoglycoside for 3 weeks was followed by rapid and maintained improvement. Involvement o
Liberti A; Bisogno A; Izzo E; Hospital for Infectious Diseases D. Cotugno, Naples, Italy.
Our objective was to evaluate the efficacy of octreotide in the treatment of AIDS patients with persistent diarrhea refractory to conventional therapy. We have treated 11 patients with AIDS related diarrhea (M/F-5/2, mean age 28 +/- 3 yr). The stool volume was in all pts > or = 21/24h. In 4 pts the diarrhea was second
Bagwell CE; Goodwin SR; Department of Surgery, University of Florida College of Medicine,; Gainesville 32610-0286.
To evaluate decision-making factors of pediatric surgeons when faced with ethical dilemmas in a clinical setting, questionnaires were mailed to members of the Canadian Association of Paediatric Surgeons. The surgeons were asked to respond to scenarios regarding ethical dilemmas in the treatment of children. Fifty-one
Des Jarlais DC; Wenston J; Friedman SR; Sotheran JL; Maslansky R; Marmor M; Beth Israel Medical Center, New York, New York 10013.
We examined crack use in a cohort of methadone patients originally enrolled in 1984-86. Crack use questions were added to the study in 1987. Of the 494 methadone patients originally enrolled, 228 subjects remained in methadone and were re-interviewed in 1987-88, and 234 remained in methadone and were re-interviewed in
Okai T; Soejima A; Suzuki M; Yomogida S; Nakabayashi K; Kitamoto K; Nagasawa T; First Department of Internal Medicine, Kyorin University.
A 22 year old male of lupus nephritis associated with minimal change nephrotic syndrome was described. The patient was well until 4 years earlier, when Raynaud s phenomenon and photosensitivity developed. One week before admission, edema appeared suddenly and proteinuria was pointed out on July 28, 1990. On admission,
Holtzman D; Greene BZ; Ingraham GC; Daily LA; Demchuk DG; Kolbe LJ; Surveillance Research Section, Centers for Disease Control,; Atlanta, GA 30333.
To determine the extent to which HIV education and health education policies and practices are required by school districts in the United States , a national probability sample of public school districts was surveyed by mail in 1990. Of 2,150 districts selected, 78.1% responded. HIV edu
Sawyer LA; Carrow E; Snoy PJ; Hewlett IK; Quinnan GV Jr; Anand R; Division of Virology, Product Quality Control and Transfusion; Science, Food and Drug Administration, Bethesda, Maryland 20892.
The infectivity of different strains of HIV-1 in rabbits was investigated. The HIV-1RF and HIV-1MN inocula induced anti-envelope antibodies detectable by Western blot, and in the case of HIV-1RF, these antibodies were also detectable by ELISA. The peripheral blood lymphocytes (PBL) and lymph nodes from rabbits inocula
Havens PL; Dunne WM; Burd EM; Department of Pediatrics, Medical College of Wisconsin,; Milwaukee.
Shiga toxin and the related Shiga-like toxins (SLT), produced by Escherichia coli, can cause hemorrhagic colitis and hemolytic uremic syndrome (HUS). Human intravenous immune globulin (HIVIg) blocks the cytotoxicity of some SLTs in vitro. To examine the ability of HIVIg to modify disease caused by Shiga-like toxin I o
Mo Med. 1992 Dec;89(12):843-5. Unique Identifier : AIDSLINE MED/93125451
Spare KW; Craig J; Moore-Nichols J; Hoff GL; Biery RM; Gipson KS; Baumgartner T; Health Department, Kansas City, Missouri 64109.
The seroprevalence surveys being conducted in the Kansas City area have to date tested 15,778 persons and resulted in 85 seropositive HIV tests. The sexually transmitted disease (STD) surveys and women s surveys fall in the lowest quartile of the combined national surveys. The drug treatment (IVDU) survey data were co
Karon JM; Buehler JW; Byers RH; Farizo KM; Green TA; Hanson DL; Rosenblum LS; Gail MH; Rosenberg PS; Brookmeyer R; Division of HIV/AIDS, Centers for Disease Control and Prevention.
This report presents projections of the number of persons who will initially be diagnosed with a condition included in the 1987 surveillance definition for acquired immunodeficiency syndrome (AIDS) in the United States during the period 1992-1994. The report also presents estimates and
Bournique B; Akar A; Broly H; Ajana F; Counis R; Scholler R; Fondation de Recherche en Hormonologie, Fresnes, France.
To study the polymerase chain reaction (PCR) performance in detecting human immunodeficiency virus (HIV) infections, we tested 53 HIV-1 seropositive patients and 29 HIV-1 seronegative subjects for four different HIV-1 DNA regions. Fifty-one seropositive patients were found positive by PCR with at least one primer pair
Gudibande SR; Kenten JH; Link J; Friedman K; Massey RJ; Department of Molecular Biology, IGEN Inc., Rockville, MD 20852.
Described are rapid assays for the analysis of PCR products in a one step, non-separation assay based on the use of electrochemiluminescence generated from a tris-bipyridine ruthenium (II) label. The assay uses PCR incorporation of a biotinylated oligonucleotide as a primer, with the inclusion of a labelled oligonucle
Rose DN; Department of Community Medicine, Mount Sinai School of Medicine; (CUNY), New York 10029.
This report describes the AIDS epidemic in East and Central Harlem, among the hardest-hit communities in the nation. Information was obtained from two New York State mandatory reporting programs: anonymous HIV antibody testing of newborns, and physician and hospital reports of AIDS cases to city and county public heal
McClure HM; Anderson DC; Ansari AA; Klumpp SA; Yerkes Regional Primate Research Center, Emory University,; Atlanta, Georgia.
Maternal-to-infant transmission of simian immunodeficiency virus (SIV) has been demonstrated in the rhesus macaque following experimental infection of pregnant rhesus monkeys, either parenterally or by inoculation of virus into the amniotic fluid. Virus infection occurred in 3 of 12 (25%) rhesus infants born to mother
Denis F; Verdier M; Bonis J; Departement de Bacteriologie-Virologie, CHU Dupuytren, Limoges,; France.
Vertical transmission of the human T-cell leukemia type 1 (HTLV-1) from seropositive mothers to their offspring has been extensively studied. Transmission occurs mainly through breastfeeding. Prevention relies on screening pregnant women (and wet-nurses) for HTLV-1 antibodies and advising seropositive women to refrain
Rouzioux C; Laboratoire de Virologie, Hopital Necker-Enfants Malades, Paris,; France.
The rate of mother-to-infant transmission of the HIV approximates 20%. Early treatment and monitoring of infected infants are feasible only if diagnosis is established promptly. Diagnosis at birth relies on techniques that demonstrate presence of the virus (viral cultures, Polymerase Chain Reaction (PCR) antigenemia).
Postgrad Med J. 1992 Sep;68(803):753-5. Unique Identifier : AIDSLINE MED/93126190
Johnston SR; Hammond PJ; Department of Medicine, Royal Postgraduate Medical School,; Hammersmith Hospital, London, UK.
Hypercalcaemia occurs in up to 80% of patients with adult T-cell leukaemia-lymphoma (ATLL) associated with human T-cell leukaemia virus-1 infection. Elevated serum levels of 1,25-dihydroxycholecalciferol, implicated in the pathogenesis of hypercalcaemia in lymphoma, and of parathyroid hormone-related protein (PTHrP),
Presse Med. 1992 Oct 24;21(35):1658-62. Unique Identifier : AIDSLINE MED/93126223
Cabie A; Matheron S; Lepretre A; Bouchaud O; Deluol AM; Coulaud JP; Service des Maladies infectieuses et tropicales, Hopital; Bichat-Claude Bernard, Paris.
Visceral leishmaniasis occurring in immunocompromised patients, and in particular during HIV infection, has been described in recent years and differs from the usual Mediterranean kala-azar as encountered in France . In order to define the clinical, diagnostic and therapeutic featur
Presse Med. 1992 Oct 24;21(35):1677-9. Unique Identifier : AIDSLINE MED/93126227
Ayadi A; Dutoit E; Camus D; Service de Parasitologie-Mycologie, Faculte de Medecine de; Sfax, Tunisie.
Blastocystis hominis is a micro-organism which remains somewhat mysterious. Having defined its present position in the classification of Protozoa, the authors describe its ultrastructure and morphology. Its epidemiology and pathogenicity are discussed in the light of experimental studies and human clinical data, espec
Desser SS; Hong H; Yang YJ; Department of Zoology, University of Toronto, Ontario, Canada.
Human fibroblast cell cultures inoculated with microsporidia-infected corneal scrapings from an AIDS patient were fixed in situ and examined by scanning and transmission electron microscopy. The parasite grew prolifically and all developmental stages were observed. Meronts underwent binary fission and the daughter cel
Protein Eng. 1992 Oct;5(7):659-67. Unique Identifier : AIDSLINE MED/93126315
Sansom CE; Wu J; Weber IT; Jefferson Cancer Institute, Thomas Jefferson University,; Philadelphia, PA 19107.
Crystallographic structures of HIV protease with three different peptide-mimetic inhibitors were subjected to energy minimization using molecular mechanics, the minimized structures analyzed and the inhibitor binding energies calculated. Partial charge assignment for the hydrogen bonded catalytic aspartic acids, Asp25
Furnham A; Department of Psychology, University College, London.
202 subjects completed a questionnaire concerning their knowledge of and attitudes towards AIDS. The knowledge questionnaire had three sections, general knowledge, knowledge of spread and symptoms. Intercorrelations of the sections of the attitudinal measure were factor analysed, and five interpretable factors identif
Res Virol. 1992 Sep-Oct;143(5):311-9. Unique Identifier : AIDSLINE MED/93126661
Venaud S; Yahi N; Fehrentz JL; Guettari N; Nisato D; Hirsch I; Chermann JC; Unite de Recherches INSERM sur les Retrovirus et Maladies; Associees (U322), Marseille, France.
The processing of the human immunodeficiency virus (HIV) gag and gag-pol precursor proteins by the virus-encoded protease is an essential step in maturation of infectious virus particles. Like most retroviral proteases, the HIV protease belongs to the aspartyl-protease family and can be inhibited by specific inhibitor
More than 50% of all HIV-infected patients have gastrointestinal symptoms like dysphagia, abdominal pain, diarrhea or intestinal bleeding. We describe an emergency situation with gross gastrointestinal bleeding in a twenty-seven year old drug addicted female. Colonoscopy and histological examination of the biopsies we
Acta Med Port. 1992 Oct;5(9):493-8. Unique Identifier : AIDSLINE MED/93127917
Cordeiro D; Vieira R; Lara E; Cardoso N; Gois C; Ismail F; Goncalves MJ; Clinica Psiquiatrica Universitaria, Faculdade de Medicina de; Lisboa, Hospital de Santa Maria.
The research in child psychiatry faces general restrictions related to the observation and interpretation of child psychopathological phenomena. These restrictions are increased by the limits of the methodological credibility of the psychopathological and psychiatric research with adults. The specific form of the emer
An Esp Pediatr. 1992 Dec;37(6):443-8. Unique Identifier : AIDSLINE MED/93128678
Sanchez Ruiz E; Casabona Barbara J; Fortuny Guasch C; Curell Aguila N; Marti Gaudes C; Departament de Sanitat, Generalitat de Catalunya, Barcelona.
Up until November 30, 1990, 415 children born to HIV-positive mothers were followed in order to study the vertical transmission rate and the survival of those infected, as well as the associated risk factors. According to CDC criteria, 264 children could be considered definitely classified, with 82 classified as infec
Annu Rev Genet. 1992;26:479-506. Unique Identifier : AIDSLINE MED/93128854
Erlich HA; Arnheim N; Department of Human Genetics, Roche Molecular Systems, Inc.,; Alameda, California 94501.
The ability of PCR to amplify a specific DNA segment from a complex template in an automated reaction has made molecular analysis more accessible both to basic research and diagnostic laboratories. Modifications of the basic PCR method using generic primers now allow DNA amplification even in the absence of specific n
De Wit S; Hermans P; Sommereijns B; O'Doherty E; Westenborghs R; van de Velde V; Cauwenbergh GF; Clumeck N; Division of Infectious Diseases, St. Pierre University Hospital,; Free University of Brussels, Belgium.
The pharmacokinetics of oral administration of R 82913, or tetrahydroimidazol [4,5,1-jk]-benzodiazepin-2(1H)-one or -thione (TIBO), was compared with those of intravenous administration in five AIDS patients. TIBO was administered as a single daily 1-h infusion of 100 mg for 29 days and orally as a single daily dose f
Hardin TC; Sharkey PK; Lam YF; Wallace JE; Rinaldi MG; Graybill JR; Department of Medicine, University of Texas Health Science; Center, San Antonio.
The pharmacokinetics of SCH-39304, an investigational, orally active, broad-spectrum antifungal agent, were evaluated in 17 adult, human immunodeficiency virus-positive males. Patients were studied on days 1 and 16 and were divided into the following three treatment groups: (i) patients with culture-proven oropharynge
Bornman MS; Mokonoto JR; Mahomed MF; Boomker D; Reif S; Crewe-Brown HH; Department of Urology, Medical University of Southern Africa,; Ga-Rankuwa Hospital, Medunsa, South Africa.
The worldwide resurgence of syphilis may have serious implications on neonatal morbidity. The aim of this study was to evaluate the seroprevalence of syphilis in men attending an infertility clinic. Blood samples from 782 males were screened using the titrated RPR and TPHA tests. If either of these tests was positive,
Qirko S; Tase M; Popa Y; Clinique cardiologique, hopital n. 1, Tirana, Albanie.
Left (LV) and right ventricular (RV) filling was evaluated by pulsed doppler echocardiography in 56 hypertensive (HTN) untreated patients and in 30 normotensive (N) subjects, matched for age, body surface and heart rate. HTN were classified in two groups: HTN1: with normal LV mass index (LV mi) (
Ochoa E; Arias F; Somoza JC; Lopez-Ibor JJ; Unidad de Psiquiatria, Hospital Ramon y Cajal, Madrid.
Outcome of a maintenance treatment with naltrexone (350 mg/week) are examined in a sample of 365 patients with opiate dependence disorder. Treatment was followed in an outpatient facility, in a setting similar to patient s own environment. The average attendance rate was of 198 days. Six months after the onset of the
Sopelana P; Debora M; Lopez-Calvo S; Garcia-Alvarez JC; Polo C; Unidad de Desintoxicacion de Drogodependientes, Hospital; Psiquiatrico, Madrid.
The early organic mental disorder, caused by the human immunodeficiency virus type 1 (HIV) in the drug dependents (DD), if it is not taken into account, can disturb the diagnosis of the neuropsychiatric and the toxic disorders. The authors attempt to outline, with several neuropsychological tests (visuo-perceptual, me
Arch Sex Behav. 1992 Dec;21(6):559-85. Unique Identifier : AIDSLINE MED/93129114
Weinrich JD; Grant I; Jacobson DL; Robinson SR; McCutchan JA; HIV Neurobehavioral Research Center, University of California,; San Diego 92103.
The connections between childhood gender nonconformity (assessed by the Freund Feminine Gender Identity Scale, or FGI) and adult genitoerotic role (assessed by a sex history) were examined. The core sample was a group of 106 men who had sex with other men before 1980 and who are currently enrolled in two longitudinal
Akiyama Y; Suzuki T; Tanaka M; Katagiri T; Ishibashi T; Imai F; Ohno S; Doi Y; Second Department of Internal Medicine, Saitama Medical School.
A 49-year-old woman, who has had a past history of Raynaud s phenomenon since 1981, dry mouth since 1987 and dry eyes since 1990, was admitted to our hospital complaining of general fatigue, bilateral gonalgia, and shortness of breath in April 1991. Physical examinations revealed bilateral parotid gland enlargement an
Biochem Biophys Res Commun. 1992 Dec 30;189(3):1709-15. Unique Identifier : AIDSLINE MED/93129248
Suzuki YJ; Aggarwal BB; Packer L; Department of Molecular & Cell Biology, University of California,; Berkeley 94720.
Acquired immunodeficiency syndrome (AIDS) results from infection with a human immunodeficiency virus (HIV). The long terminal repeat (LTR) region of HIV proviral DNA contains binding sites for nuclear factor kappa B (NF-kappa B), and this transcriptional activator appears to regulate HIV activation. Recent findings su
Kuhne JH; Bartl R; Hammer C; Refior HJ; Jansson V; Zimmer M; Orthopedic Department, Ludwig Maximilians University, Munich,; Federal Republic of Germany.
The use of bone allografts is often essential in orthopedic surgery. Strict donor screening, including HIV testing 3 months postoperatively, is mandatory before a transplant may be used. Yet these measures do not definitely rule out the possibility of HIV transmission, as there is a window period before infection is r
Kaczmarski RS; Davison F; Blair E; Sutherland S; Moxham J; McManus T; Mufti GJ; Department of Haematological Medicine, King's College School of; Medicine and Dentistry, Denmark Hill, London.
Peripheral blood cytopenias present a major problem in the management of patients with HIV infection. Their pathophysiology is likely to be multifactorial, although there is controversy as to whether haemopoietic progenitors are a target for HIV. In order to investigate the haemopoietic defect in HIV infection, we loo
Miyazaki N; Hata T; Atogami S; Sohda H; Murata K; Yanagisako T; Tsukasaki K; Yamada Y; Kamihira S; Tomonaga M; Department of Hematology, Nagasaki University School of Medicine,; Japan.
Foresman MD; Nelson DM; McIvor RS; Institute of Human Genetics, University of Minnesota, Minneapolis; 55455.
To determine the effectiveness of retroviral-mediated purine nucleoside phosphorylase (PNP) gene transfer and expression for metabolic correction of PNP deficiency, we used as a gene transfer target the NSU-1 subline of murine S49 T lymphoma cells, an in vitro genetic model of PNP deficiency. NSU-1 cells were transduc
Aust J Public Health. 1992 Sep;16(3):232-7. Unique Identifier : AIDSLINE MED/93129693
Kehoe L; Hall W; Mant A; National Drug and Alcohol Research Centre, Sydney.
Three estimates of the number of injecting drug users residing within the Eastern Sydney Area Health Service (ESAHS) were obtained by applying the capture-recapture technique to data from three reliable sources, specifically, Methadone Services, the Bourke Street Drug Advisory Service and the Albion Street Clinic. The
Aust J Public Health. 1992 Sep;16(3):324-7. Unique Identifier : AIDSLINE MED/93129707
Ross MW; Chapman S; Wodak A; Miller M; Gold J; National Centre in HIV Social Research Unit, University of New; South Wales.
We report on media habits of 797 members of a sample of 1245 injecting drug users interviewed in Sydney, Australia . While preferred hours of television viewing and radio listening were similar to those of the general population, the preferred channels and stations were different
The authors undertook a review of published articles on reported worldwide seroconversions to the human immunodeficiency virus (HIV) among workers who sustained occupational exposure to HIV. Documented seroconversions are occupational exposures for which the worker is tested and found negative for HIV antibody shortly
Proc Annu Symp Comput Appl Med Care. 1992;:128-32. Unique Identifier : AIDSLINE MED/93129889
Das AK; Tu SW; Purcell GP; Musen MA; Section on Medical Informatics, Stanford University School of; Medicine, California 94305-5479.
We are developing a database implementation to support temporal data management for the T-HELPER physician workstation, an advice system for protocol-based care of patients who have HIV disease. To understand the requirements for the temporal database, we have analyzed the types of temporal predicates found in clinica
Proc Annu Symp Comput Appl Med Care. 1992;:161-5. Unique Identifier : AIDSLINE MED/93129896
Gustafson DH; Bosworth K; Hawkins RP; Boberg EW; Bricker E; Center for Health Systems Research and Analysis, University of; Wisconsin, Madison.
CHESS (the Comprehensive Health Enhancement Support System) is an interactive, computer-based system to support people facing health-related crises or concerns. CHESS provides information, referral to service providers, support in making tough decisions and networking to experts and others facing the same concerns. CH
Proc Annu Symp Comput Appl Med Care. 1992;:59-63. Unique Identifier : AIDSLINE MED/93129980
Henry SB; Schreiner JG; Borchelt D; Musen MA; Section on Medical Informatics, Stanford University School of; Medicine, CA 94305.
This study describes the complexity of the telephone-triage task in a community-based AIDS clinic. We identify deficiencies related to the data management for and documentation of the telephone-triage encounter, including inaccessibility of the medical record and failure to document required data elements. Our needs a
Proc Annu Symp Comput Appl Med Care. 1992;:719-23. Unique Identifier : AIDSLINE MED/93130005
Musen MA; Carlson RW; Fagan LM; Deresinski SC; Shortliffe EH; Section on Medical Informatics, Stanford University School of; Medicine, California 94305-5479.
There are increasing expectations that community-based physicians who care for people with HIV infection will offer their patients opportunities to enroll in clinical trials. The information-management requirements of clinical investigation, however, make it unrealistic for most providers who do not practice in academ
Int Arch Allergy Immunol. 1992;99(1):1-7. Unique Identifier : AIDSLINE MED/93130104
Fontana A; Constam DB; Frei K; Malipiero U; Pfister HW; Section of Clinical Immunology, University Hospital, Zurich,; Switzerland.
For the past several years immunologists have been fascinated by a series of experiments showing that transforming growth factor beta (TGF beta) suppresses T- and B-lymphocyte growth as well as IgM and IgG production by B cells. Moreover, while exerting chemotactic activity on monocytes and inducing expression of inte
Catalan J; Klimes I; Day A; Garrod A; Bond A; Gallwey J; Academic Department of Psychiatry, Charing Cross & Westminster; Medical School, Westminster Hospital, London.
This study aimed to establish the prevalence of psychosocial problems in gay men with HIV infection, and to identify factors associated with psychological morbidity. The study was a cross-sectional controlled investigation, which included 24 HIV seropositive and 25 seronegative gay men. Outcome measures included curre
Landonio G; Nosari A; Spinelli F; Vigorelli R; Caggese L; Schlacht I; Dipartimento di Ematologia, Ospedale Niguarda Ca Granda, Milano,; Italy.
BACKGROUND. Many factors have been considered in the pathogenesis of HIV-related Thrombocytopenia (HIV-rel TP): immunological destruction, retroviral infection of megakaryocytes and altered reticulo-endothelial function. Nevertheless the pathogenesis is still controversial. MATERIALS AND METHODS. We reviewed 52 patien
Stellini R; Rossi G; Paraninfo G; I Divisione di Malattie Infettive, Spedali Civili di Brescia,; Italy.
BACKGROUND. There is no generally accepted treatment for human immunodeficiency virus (HIV)--associated idiopathic thrombocytopenic purpura (ITP). recombinant alpha interferon (rIFN) has been used in classic ITP with conflicting results. We have tested its activity in a group of intravenous drug users (IVDUs) with HIV
Int J Pept Protein Res. 1992 Nov;40(5):363-9. Unique Identifier : AIDSLINE MED/93131456
Handa BK; Kay C; Department of Physical Chemistry, Roche Products Limited, Welwyn; Garden City, Hertfordshire, England.
Two small peptide substrates for HIV-1 proteinase were synthesised. The sequences chosen were basically from that of the gag-pol protein, which is the natural substrate for the proteinase. To protect these peptides from the attack of exopeptidases, the N- and C-termini were suitably protected, which also makes these s
Int J Pept Protein Res. 1992 Nov;40(5):370-9. Unique Identifier : AIDSLINE MED/93131457
Ball HL; Mascagni P; Italfarmaco Research Centre, Milan, Italy.
A rapid, versatile, reversible procedure for purifying synthetic peptides has been developed based on the specific incorporation of 4-carboxylate Fmoc derivatives onto the terminal amino acid of peptidyl-resins. The acid stable 4-COR-Fmoc derivatives were synthesised with a variety of chemical groups thus altering the
Calabrese LH; Section of Clinical Immunology, Cleveland Clinic, Cleveland; Heights, Ohio.
This article concludes the monthly series developed from the AOA Task Force on AIDS Writers Workshop, held August 16 to 18, 1991, in New York. The workshop was sponsored by an education grant from Burroughs Wellcome. This series has provided brief clinical updates and perspectives on the human immunodeficiency virus
Ami Y; Kushida S; Matsumura M; Yoshida Y; Kameyama T; Sugiyama Y; Yagami K; Uchida M; Uchida K; Koiso K; et al; Institute of Basic Medical Sciences, University of Tsukuba,; Ibaraki.
A female F344 rat was injected with 2.4 x 10(6) MT-2 cells intravenously at 3 and 4 weeks old, and was mated with a non-infected male rat at the 17th week after injection, when the dam rat contained HTLV-1 provirus in the peripheral blood mononuclear cells as determined by polymerase chain reaction. HTLV-1 provirus wa
Gerbert B; Bernzweig J; Bleecker T; Bader J; Miyasaki C; Department of Dental Public Health and Hygiene, University of; California, San Francisco.
The public traditionally has held dentistry in high regard as a profession. But some recent evidence suggests a decline in public confidence--a fact that may be affecting the way dentists view themselves. What should and can be done?
Masliah E; Ge N; Achim CL; Hansen LA; Wiley CA; Department of Neurosciences, University of California, San Diego,; La Jolla 92093-0624.
Recent studies of human immunodeficiency virus type 1 (HIV-1) encephalitis have shown that in addition to well established white matter damage, the neocortex shows thinning, loss of large neurons and dendritic damage. In order to identify neuronal populations affected in HIV encephalitis and to determine how neuronal
Edlind TD; Bartlett MS; Weinberg GA; Prah GN; Smith JW; Department of Microbiology and Immunology, Medical College of; Pennsylvania, Philadelphia 19129.
The development of new drugs for treating Pneumocystis carinii infections in AIDS patients is hampered by the lack of long-term culture systems, and by our generally limited knowledge of this organism. Recently, however, we observed significant activity of various benzimidazoles against growth of this organism in shor
Beaumanoir A; Nahory A; Fondazione P et L Mariani, Neurologia Infantile, Milano, Italie.
Since 1985, early changes in the EES have been demonstrated in the course of HIV infection. This method can be considered one of the accurate tests for the assessment of evolution of the disease. Abnormal anterior changes are present in about 30% of HIV+subjects with at least stage II disease. EEG abnormalities during
Somma-Mauvais H; Farnarier G; Service de neurologie, hopital Sainte-Marguerite, Marseille,; France.
The study of the literature data on the multimodal evoked potentials in HIV infected patients shows many abnormalities as well in asymptomatic subjects without AIDS as in AIDS subjects with or without neurological signs. Visual evoked potentials (VEPs) reveal prolonged P100 wave latency in 22% of HIV asymptomatic subj
Gil R; Breux JP; Neau JP; Becq-Giraudon B; Service de neurologie, CHU La Miletrie, Poitiers, France.
Endogenous event-related potentials (and especially the P300 component) have delayed latencies relative to normal controls in patients with dementias of diverse aetiologies. Moreover, the subcortical varieties of dementia tend to affect also the early-stage N1 and P2 components whereas both types of dementias affect t
Pinto F; Grippo A; Ghidini P; Mazzotta F; Di Pietro M; Department of Neurological and Psychiatric Sciences, University; of Florence, Italy.
This study explored the neurophysiological changes in 87 HIV1+ (20 AIDS, 24 ARC, 24 LAS and 19 AC) patients showing no clinical evidence of neurological impairment. Tracing somatosensory responses by recording SEPs from upper and lower limbs, we found a slowing of both peripheral and central nerve conduction. Peripher
Gastaut JL; Pouget J; Valentin P; Lafeuillade A; Dhiver C; Gastaut JA; Service de neurologie, hopital Sainte-Marguerite, Marseille,; France.
Subclinical impairment of the peripheral nervous system (PNS) is frequent during HIV infection. Nevertheless, little attention has been given to the autonomic nervous system (ANS). We undertook a prospective study of the ANS, exploring 55 HIV+ subjects with non-invasive functional tests for the cardiac ANS. We also ma
Public Health Nurs. 1992 Dec;9(4):270-6. Unique Identifier : AIDSLINE MED/93133790
Vicenzi AE; Thiel R; Southern Connecticut State University, School of Professional; Studies.
We assessed the beliefs of 49 college students regarding the acquired immunodeficiency syndrome (AIDS), condom use, and sexual behaviors related to AIDS prevention. Roy s modes of self-concept, interdependence, and role function were used as a framework to find psychosocial determinants that influence safer sex practi
The acquired immune deficiency syndrome (AIDS) is thought to result from infection of T cells by a pathogenic human retrovirus, human immunodeficiency virus [HIV (HTLV-III/LAV)]. In this report, we synthesized sulfated plant polyphenols such as tannic acid sulfate, rutin sulfate, ellagic acid sulfate, (-)-epicatechin
Elliott AM; Halwiindi B; Bagshawe A; Hayes RJ; Luo N; Pobee JO; McAdam KP; Department of Clinical Sciences, London School of Hygiene and; Tropical Medicine.
Corticosteroids are beneficial in the treatment of some forms of tuberculosis, but their role in TB affecting HIV-positive patients is not clear. During a cohort study of tuberculosis patients in Lusaka, Zambia , prednisolone was prescribed for specific indications. Six of 47 (13 pe
Holmes AH; Trotman-Dickenson B; Edwards A; Peto T; Luzzi GA; Infectious Diseases Unit, Churchill Hospital, Oxford.
An increased frequency of bacterial pneumonia occurs in HIV-infected individuals: however the development of bronchiectasis is not well recognized. We describe seven patients with HIV infection who developed chronic symptomatic lung disease, six with troublesome recurrent infective exacerbations. Bronchiectasis was de
Zuniga M; Aguado JM; Vada J; Department of Internal Medicine, Marques de Valdecilla National; Hospital, Santander, Spain.
A few cases of Listeria meningitis in healthy individuals have been recorded in the world literature. The lack of a prolonged follow-up in most of these cases makes it difficult to exclude the existence of an underlying disease. The clinical and CSF data of four previously healthy patients with meningitis due to Liste
Whitcup SM; Fenton RM; Pluda JM; De Smet MD; Nussenblatt RB; Chan CC; Laboratory of Immunology, National Eye Institute, National; Institutes of Health, Bethesda, MD 20892.
It has been hypothesized that coinfection with mycobacteria occurs in patients with Pneumocystis carinii choroiditis, but cases demonstrating ocular infection by both organisms have not been reported. This study reports the case of a patient with P. carinii choroiditis who was treated with intravenous trimethoprim and
Stat Med. 1992 Sep 30;11(13):1633-55. Unique Identifier : AIDSLINE MED/93134221
Rosenberg PS; Gail MH; Carroll RJ; National Cancer Institute, Epidemiology and Biostatistics; Program, Rockville, Maryland 20892.
The AIDS incubation distribution is changing in calendar time because of treatment and changes in the surveillance definition of AIDS. To obtain reliable estimates of HIV prevalence and projections of AIDS incidence in the 1990s using the method of backcalculation, we constructed an appropriate incubation distribution
Data gathered through the Latium HIV Surveillance System were used in conjunction with a compartmental mathematical model to describe the transmission dynamics of HIV-1 in Italy . In the Latium region, as in the rest of Italy, fewer than 1 in 5 cumulative cases of AIDS are attributab
Werdelin L; Misfeldt J; Melbye M; Olsen J; Steno Institute of Public Health, Department of Social Medicine,; Aarhus C.
Greenland is a considered high risk area for a self-sustained heterosexual HIV-epidemic due to rather relaxed sexual norms in larger segments of the population and a high incidence of sexual transmitted diseases. However, the preval
In sub-Saharan African countries where AIDS is established, HIV transmission is primarily by means of heterosexual intercourse. A major co-factor in such transmission is the presence of other, sexually transmitted diseases (STDs). Efforts to limit the heterosexual transmission of HIV in Africa must therefore address t
Lemma M; Vanelli P; Beretta L; Botta M; Antinori A; Santoli C; Department of Thoracic and Cardiovascular Surgery, Luigi Sacco; Hospital, Milan, Italy.
In the last years the number of HIV-positive patients needing cardiac surgery has greatly increased. Cardiopulmonary bypass is suspected to have a role in the progression of HIV-infection to acquired immunodeficiency syndrome (AIDS). From October 1988 to December 1990, 6 intravenous drug addicts underwent cardiac surg
Adv Exp Med Biol. 1992;323:57-66. Unique Identifier : AIDSLINE MED/93135043
Waldmann TA; Goldman C; Top L; Grant A; Burton J; Bamford R; Roessler E; Horak I; Zaknoen S; Kasten-Sportes C; et al; Metabolism Branch, National Cancer Institute, National Institutes; of Health, Bethesda, MD 20892.
Aust Nurses J. 1992 Sep;22(3):10-3. Unique Identifier : AIDSLINE MED/93135687
Kerr PG
In some African countries 10%-15% of the middle class may due during the 1990s and at the present time the human infrastructure is being eroded by HIV. Over 90% of home and community care is being supervised by nursing and midwifery personnel in some developing countries. What will happen if these carers become ill or
Ann Med. 1992 Dec;24(6):439-44. Unique Identifier : AIDSLINE MED/93135855
Nemunaitis J; Hematopoiesis Programme, Western Pennsylvania Cancer Institute,; West Penn Hospital, Pittsburgh 15224.
Haematopoietic colony stimulating factors (CSFs) stimulate the proliferation, differentiation and functional activity of myelocytes. Since approval of the use of these factors in patients with chemotherapy-induced neutropenia, patients undergoing autologous bone marrow transplantation (BMT) and patients with delayed e
Camacho J; Poveda F; Zamorano AF; Valencia ME; Vazquez JJ; Arnalich F; Department of Internal Medicine, La Paz Hospital, Facultad; Autonoma de Medicina, Madrid, Spain.
This study attempts to evaluate the adequacy of the erythropoietin (EPO) response in 42 anaemic patients with advanced human immunodeficiency virus (HIV) infection [30 with acquired immunodeficiency syndrome (AIDS) and 12 with AIDS-related conditions] by comparing their serum EPO levels with those found in a non-HIV r
Mientjes GH; van Ameijden EJ; Mulder JW; van den Hoek JA; Coutinho RA; von dem Borne AE; Municipal Health Service Amsterdam, Department of Public Health; and Environment, The Netherlands.
We studied the prevalence and risk factors for thrombocytopenia among 299 drug users and 461 homosexual men. The prevalence of thrombocytopenia was 3.3% in HIV-negative homosexual men, 8.7% in HIV-negative drug users, 16.4% in HIV-positive homosexual men, and 36.9% in HIV-positive drug users. With multivariate logisti
An Med Interna. 1992 Dec;9(12):579-84. Unique Identifier : AIDSLINE MED/93136341
Pintado Garcia V; Lopez-Dupla M; Valencia Ortega E; Lavilla Uriol P; Fonseca Capdevila E; Martin Martinez A; Garcia-Rubio B; Gonzalez Garcia MD; Gil Aguado A; Servicio de Medicina Interna, Hospital La Paz, Universidad; Autonoma, Madrid.
We have retrospectively studied 35 cases of Kaposi s sarcoma in 460 patients with AIDS (incidence of 7.6%) during a period of 10 years. All of them were males, with a mean age of 38 years. 88% of the cases belonged to the homosexual risk group. The tumor was the diagnostic criteria of AIDS in 25 patients. At the momen
Oshima K; Tani E; Masuda Y; Skoog L; Kikuchi M; Department of Pathology, Fukuoka University School of Medicine,; Japan.
We studied the fine needle aspiration (FNA) cytology of high grade peripheral T-cell lymphomas from eight human T-lymphotropic virus-1 (HTLV-1) positive patients. FNA smears from seven lymphomas showed a distinctive cytologic pattern with a dominance of rounded cells with irregular nuclei and a moderately basophilic c
Bull Cancer (Paris). 1992;79(9):873-82. Unique Identifier : AIDSLINE MED/93136544
Roithmann S; Tourani JM; Gastaut JA; Brice P; Raphael M; Dujardin P; Desablens B; Andrieu JM; Unite d'oncologie et hematologie, hopital Laennec, Paris,; France.
From May 1987 to July 1990, 45 cases of Hodgkin s disease (HD) were recorded by the French Registry of HIV-associated tumors. Thirty-nine patients were male and median age was 30 years. Twenty-two cases had mixed cellularity type (MC), 18 nodular sclerosis, two lymphocyte depletion and three were not classified. Thirt
Int J Med Microbiol Virol Parasitol Infect Dis. 1992 Oct;277(3):382-8. Unique Identifier : AIDSLINE MED/93136565
Gatti S; Cevini C; Atzori C; Muratori S; Zerboni R; Cusini M; Scaglia M; Dept. Infect. Dis., University-IRCCS S. Matteo, Pavia, Italy.
A cohort of 51 homosexuals who were either HIV-positive or had AIDS was followed prospectively with parasitologic stool examination and in vitro culture in order to determine the incidence of E. histolytica infection. Amoebic isolates were further characterized by electrophoretic isoenzyme study. Five subjects (9.8%)
The envelope protein of the human immunodeficiency virus (gp120) causes neuronal death in developing murine hippocampal cultures or rat retinal ganglion cells. In HIV-infected individuals, gp120 released from HIV-infected macrophages or other cells in the brain has been proposed as the etiology for the pathophysiology
Bull World Health Organ. 1992;70(6):751-6. Unique Identifier : AIDSLINE MED/93137388
Mortimer J; PHLS Communicable Disease Surveillance Centre, London, England.
The confirmation of positive screening assay reactions for antibodies to human immunodeficiency virus type 1 (anti-HIV-1) by Western blot is expensive and often gives indeterminate results. We therefore carried out a collaborative study to investigate the confirmation of screening assay reactions using a second screen
del Palacio A; Pereiro-Miguens M; Gimeno C; Cuetara MS; Rubio R; Costa R; Romero G; Department of Microbiology, Hospital 12 de Octubre, Madrid,; Spain.
We report the case of a 25-year-old, HIV-positive patient (group IV, A, C2 clinical stage) with a widespread dermatophyte infection. He was a male gypsy with a known history of intravenous drug abuse. After an episode of cerebral toxoplasmosis for which he was treated with systemic steroids (because of cerebral oedema
Gene. 1992 Dec 15;122(2):263-9. Unique Identifier : AIDSLINE MED/93138395
Rangwala SH; Finn RF; Smith CE; Berberich SA; Salsgiver WJ; Stallings WC; Glover GI; Olins PO; Monsanto Corporate Research, Monsanto Co., St. Louis, MO 63198.
High levels of active HIV-1 protease (PR) were produced in Escherichia coli, amounting to 8-10% of total cell protein. High production levels were achieved by altering the following parameters: (1) codon preference of the coding region, (2) A+T-richness at the 5 end of the coding region, and (3) promoter. To circumve
Coutinho RA; Rijsdijk AJ; van den Hoek JA; Leentvaar-Kuijpers A; Municipal Health Service, Department of Public Health and; Environment, Amsterdam.
OBJECTIVE--To study the incidence of pelvic inflammatory disease (PID) in Amsterdam in the period 1983-1990. METHODS--Patients diagnosed with PID based on a clinical definition were reported weekly by 30 general practices who covered 11% of the Amsterdam population. Annual age specific incidences were calculated using
O'Farrell N; City Health STD Department, King Edward VIII Hospital, Durban,; South Africa.
OBJECTIVE--To investigate recent trends in reported cases of donovanosis (granuloma inguinale) in Durban, South Africa . DESIGN--The annual reports of the Medical Officer of Health for Durban 1958-1988 were reviewed to identify cases of donovanosis, genital ulcer disease (GUD) and
OBJECTIVE--The aim of this study was to examine the nature and extent of bereavement problems in HIV + ve clients and the counselling input required. DESIGN--Ninety individuals referred consecutively for counselling by the medical teams after HIV diagnoses were included in the study. Specific bereavement data was gath
Bor R; Elford J; Murray D; Salt H; Tilling J; Miller R; Johnson M; HIV/AIDS Unit, Royal Free Hampstead, NHS Trust, London, UK.
OBJECTIVE--To investigate outpatients use of, and satisfaction with social care services in an HIV unit. DESIGN--Survey of patients with HIV infection using self administered questionnaire. SETTING--Outpatient HIV clinics at the Royal Free Hospital, London, March-April 1991. MAIN OUTCOME MEASURES--Patients social ci
McCarthy GA; Cockell AP; Kell PD; Beevor AS; Boag FC; John Hunter Clinic, St Stephen's Clinic, London.
OBJECTIVE--To evaluate a multidisciplinary women-only clinic (WOC) providing HIV testing, HIV follow-up, genitourinary screening and a substance misuse service. The clinic is designed to attract women who are at risk of acquiring sexually transmitted infections, including HIV, yet are not using existing medical servic
Williams IG; Shergold C; Evans B; Beecham M; Miller R; Johnson AM; Academic Department of Genitourinary Medicine, Middlesex; Hospital, London, UK.
OBJECTIVE--To evaluate completeness of reporting of cases of AIDS to the Communicable Disease Surveillance Centre (CDSC) between 1982-1991. SETTING--Southside of the Bloomsbury and Islington District Health Authority. DESIGN--Reconciliation exercise with CDSC of cases reported with those known to have received treatme
Immunol Lett. 1992 Oct-Nov;34(2):135-42. Unique Identifier : AIDSLINE MED/93138687
Haaheim LR; Jonsson R; University of Bergen, Norway.
We have used the ELISPOT assay in combination with ELISA procedures for rapid evaluation of properties of three different murine hybridoma cell lines, 104-I, -B and -G, secreting IgG1 kappa monoclonal antibodies against a 104-mer synthetic peptide from the C-terminal part of HIV-1 p24. By conventional ELISA we obtaine
The production of interleukin 1 (IL-1) by lipopolysaccharide (LPS)-stimulated myelomonocytic cell lines ML-1, THP-1 and PL-21 was significantly enhanced by the addition of insulin, insulin-like growth factor (IGF)-I or IGF-II into the cell cultures. The IL-1 activity in the supernatants from cell cultures stimulated w
Acquired immunodeficiency syndrome (AIDS) and human immunodeficiency virus (HIV) are growing problems among U.S. adolescents. By examining recent data on AIDS surveillance and HIV seroprevalence, surveys on teenagers knowledge, beliefs, and behaviors related to HIV/AIDS, key treatment issues, and barriers to preventi
Oswald H; Pforr P; Freie Universitat Berlin School of Education.
The study which was conducted in 1990 in Berlin, Germany , compares two samples of 542 adolescents from West Berlin and 340 from East Berlin. The present investigation shows that the general trend toward sexual liberality among adolescents is continuing and that necessary processes
Ford N; Institute of Population Studies, University of Exeter, Devon.
A programme of surveys was undertaken in collaboration with District Health Authorities to assess the AIDS awareness and sexual behaviour of young people, in order to help the development and implementation of HIV/AIDS risk-reduction strategies. Given that the patterns of findings were strongly replicated in the diffe
Moore S; Rosenthal D; Monash University, Clayton Victoria, Australia.
This study was an examination of the sexual worlds of 153 adolescents aged 15 to 18 years through the content analysis of interviews on the topics of love, romance, relationships between the sexes, sexual values and sexual behaviors. The aim was to develop more detailed descriptions of the dimension of adolescent sexu
Hernandez JT; Diclemente RJ; Department of Psychiatry, University of North Carolina, Chapel; Hill 27599-7160.
Male college students completed an anonymous self-report questionnaire assessing HIV-related knowledge, attitudes, moral development, personality factors and behaviors. Bivariate analyses were used to identify factors associated with high-risk sexual intercourse. Significant demographic psychosocial and behavioral pre
Mellanby A; Phelps F; Tripp J; Department of Child Health, University of Exeter, England.
Increasing demands for sex education have been associated with a plethora of recommendations, regulations and resources with resulting variability of content, strategy, quality and outcome. While numerous studies confirm that the health behaviour of teenagers is not altered by the teaching of facts alone, other data s
Brown LK; Spirito A; Reynolds LA; Hemstreet A; Dept. of Child Psychiatry, Rhode Island Hospital, Providence; 02903.
The coping strategies employed by adolescents (n = 871) when presented with a hypothetical situation of a friend with AIDS were examined. Adolescents reported a wide range of imagined responses that were generally adaptive. Girls more than boys and distressed students more than nondistressed students were likely to en
Int Clin Psychopharmacol. 1992 Nov;7(2):95-9. Unique Identifier : AIDSLINE MED/93139488
Perretta P; Nisita C; Zaccagnini E; Scasso A; Nuccorini A; Santa MD; Cassano GB; Psychiatric Clinic II, University of Pisa, Italy.
We evaluated in an open trial the safety and effectiveness of a high-potency neuroleptic (bromperidol) for the treatment of AIDS-related organic mental syndromes. Eleven (nine men and two women) seropositive patients with psychotic features were included; six were intravenous drug users (IVDU) and five were not IVDU (
J Math Biol. 1992;31(1):73-99. Unique Identifier : AIDSLINE MED/93139667
Artzrouni M; Department of Mathematical Sciences, Loyola University, New; Orleans, LA 70118.
Building on the Weibull distribution, we develop a modeled time-varying density function of the incubation time between exposure to HIV infection and full-blown AIDS. This approach leads to a series of cohort-specific density functions that take into account the increasing impact of new therapies such as zidovudine (
Ronchi O; Grippo A; Ghidini P; Lolli F; Lorenzo M; Di Pietro M; Mazzotta F; Department of Neurological and Psychiatric Sciences, University; of Florence, Italy.
HIV-1 seropositive patients have a high frequency of nervous system diseases, and asymptomatic abnormalities are frequently detected. We studied 124 neurologically asymptomatic HIV-1 seropositive subjects and 23 normal control subjects by nerve conduction studies. No alterations were detectable in the asymptomatic sta
Central venous catheters deliver life-prolonging medications to Group IVC AIDS patients. Unfortunately, the access device frequently provides a foci for debilitating infections. A Group IVC AIDS patient experienced repeated methicillin-resistant Staphylococcus epidermidis colonization and infection of his central veno
Goldstone IL; British Columbia Centre for Excellence in HIV/AIDS, Vancouver,; Canada.
St. Paul s Hospital, Vancouver has the largest Canadian experience of the care of persons with HIV/AIDS. This article reviews St. Paul s experience during the period 1987-1991, with particular emphasis on issues in palliative AIDS care. These issues include the implications of prolonged palliative care at home, precip
N Y State J Med. 1992 Nov;92(11):469-73. Unique Identifier : AIDSLINE MED/93141111
Cummings KM; Stiles J; Mahoney MC; Sciandra R; Department of Cancer Control and Epidemiology, Roswell Park; Cancer Institute, Buffalo, NY 14263.
This study provides estimates of deaths attributable to smoking, years of potential life lost (YPLL), and economic costs for each of New York s 57 counties and New York City for the period 1987 to 1989. Results show that in New York State, cigarette smoking was responsible for an average of 30,359 deaths, 409,129 YPLL
Meyer I; Cournos F; Empfield M; Agosin B; Floyd P; Washington Heights Community Service, New York State Psychiatric; Institute.
An HIV prevention program was piloted on an acute inpatient admission ward. Patients who volunteered to participate had significantly higher rates of histories of substance use than non-participants, suggesting that patients participated based on rational concerns about past HIV risk behavior. The program consisted of
Ortiz de Lejarazu R; Eiros JM; Almaraz A; Castrodeza J; Martin FJ; Rodriguez Torres A; Servicio de Microbiologia y Medicina Preventiva, Hospital; Clinico y Facultad de Medicina, Valladolid.
In order to determine the frequency of HIV seropositivity of sera from patients attending our hospital emergency department (ED) we used a HIV screening system based on the use of pooled sera. To determine the reliability of this marker we collect all ED serum samples during two different intervals of a week. From 577
Grob PR; Robens Institute of Health and Safety, University of Surrey,; Guildford, UK.
Appropriate prescribing of antibiotics should take into account the most likely causal pathogens and severity of the illness. Few laboratory diagnostic aids in community medicine have been available to the clinician. The development of databases on the epidemiology of infectious diseases defining the most probable cau
Adamczewska A; Zaklad Parazytologii, Instytut Zoologii UW., Warszawa.
Immunological aspects of cryptosporidiosis: its immunopathology, antigenicity, perspectives of treatment and diagnosis are reviewed. In particular pathology of this disease in immunodeficient (as a result of AIDS or suppressive drugs chemotherapy) patients is presented.
Am J Epidemiol. 1992 Dec 1;136(11):1349-57. Unique Identifier : AIDSLINE MED/93142775
Ho GY; Nelson K; Nomura AM; Polk BF; Blattner WA; Department of Epidemiology, School of Hygiene and Public Health,; Johns Hopkins University, Baltimore, MD.
The health effects of chronic human T-cell lymphotropic virus type I (HTLV-I) infection were examined in a cohort of Japanese men who had emigrated from Okinawa, Japan, and had been participants in a prospective study in Hawaii since 1965. In the present follow-up study carried out in 1987-1988, various health indicat
Am J Nephrol. 1992;12(5):281-7. Unique Identifier : AIDSLINE MED/93142814
Lopes GS; Marques LP; Rioja LS; Basilio-de-Oliveira CA; Oliveira AV; Nery AC; Santos O da R; Department of General Medicine, School of Medicine and Surgery,; University of Rio de Janeiro, Brazil.
Clinically overt glomerular disease was detected in 6 (1.1%) of 543 patients with HIV infection followed at a Brazilian National Referral Center for AIDS. In 4 cases, glomerulosclerosis was present (focal and segmental in 3, diffuse and global in 1) and rapid progression to terminal renal failure was observed 1-10 mon
Chawla PK; Klapper PJ; Kamholz SL; Pollack AH; Heurich AE; Department of Medicine, State University of New York Health; Science Center, Brooklyn 11203-2098.
In the past 5 yr, an increased incidence of tuberculosis has been noted in the United States . Simultaneously, the population infected with human immunodeficiency virus-type I (HIV-I) and the number of cases of acquired immunodeficiency syndrome (AIDS) have increased. Selected areas of
Van Rompay KK; Marthas ML; Ramos RA; Mandell CP; McGowan EK; Joye SM; Pedersen NC; California Regional Primate Research Center, School of Medicine,; University of California, Davis 95616.
The prophylactic and therapeutic properties of 3 -azido-3 -deoxythymidine ( AZT ) against simian immunodeficiency virus (SIV) infection were tested in four 3-month-old rhesus macaques. The infant monkeys were inoculated intravenously with a low dose (1
Ljungdahl-Stahle E; Guzenda E; Bottiger D; Wahren B; Oberg B; Stahle L; Department of Virology, Karolinska Institute, Stockholm, Sweden.
Cynomolgus monkeys had microdialysis probes implanted under ketamine anesthesia into peripheral veins, thigh muscles, and the brain in order to sample the extracellular fluid for the concentrations of unbound nucleoside analogs. A dose of 25 mg of zidovudine or 3 -fluoro-3 -deoxythymidine (FLT) per kg was administered
Araujo FG; Prokocimer P; Lin T; Remington JS; Research Institute, Palo Alto Medical Foundation, California; 94301.
The activity of the macrolide antibiotic clarithromycin was examined alone or in combination with other drugs for the treatment of acute or chronic infections with Toxoplasma gondii in mice. A dose of 300 mg of clarithromycin per kg per day administered alone for 10 days, beginning 24 hours after infection, protected
Slusher JT; Kuwahara SK; Hamzeh FM; Lewis LD; Kornhauser DM; Lietman PS; Division of Clinical Pharmacology, Johns Hopkins University; School of Medicine, Baltimore, Maryland 21287-5554.
In vitro studies of zidovudine (ZDV) phosphorylation may not accurately reflect the in vivo dose-response relationship, which is crucial to determining the relationship between ZDV exposure, efficacy, and toxicity. However, measurement of ZDV phosphorylated anabolites in peripheral blood mononuclear cells (PBMCs) from
Senaldi G; Portmann B; Mowat AP; Mieli-Vergani G; Vergani D; Department of Immunology, King's College School of Medicine and; Dentistry, King's College Hospital, London.
The portal tract mononuclear cell infiltrate has been characterised in 28 liver biopsy samples showing features of chronic aggressive hepatitis from 12 patients with autoimmune chronic active hepatitis, 12 with primary sclerosing cholangitis, and four with other chronic liver diseases (two with alpha 1-antitrypsin def
Crit Care Nurse. 1992 Oct;12(7):64-71. Unique Identifier : AIDSLINE MED/93121799
Timby BK
Nurses need to be aware that pneumocystosis is one of the most common and lethal opportunistic infections among AIDS patients. They are extremely susceptible because HIV impairs physiological mechanisms for microbial defense. Patients exhibit only minor symptomatology while the unchecked P carinii organisms accumulate
Watson RR; Odeleye OE; Eskelson CD; Mufti SI; Department of Family and Community Medicine, University of; Arizona, Tucson 85724.
Tumor appearance can be accelerated in the immunodeficient and immunosuppressed animal. The role of lipid peroxidation and immune dysfunction induced by retrovirus and ethanol treatments on cancer promotion were investigated. Following the initiation of esophageal cancer by methylbenzylnitrosamine, ethanol consumption
Ferbas J; Rahman MA; Kingsley LA; Armstrong JA; Ho M; Zhou SY; Rinaldo CR Jr; Department of Infectious Diseases and Microbiology, University of; Pittsburgh Graduate School of Public Health, PA 15261.
OBJECTIVE: To determine the frequency of Epstein-Barr virus (EBV) oropharyngeal shedding during HIV infection in homosexual men in the Multicenter AIDS Cohort Study. DESIGN: The cohort consisted of 210 men who were HIV-seronegative at their baseline study visit, 39 of whom seroconverted to HIV at a later date, and 73
Braun MM; Kilburn JO; Smithwick RW; Coulibaly IM; Coulibaly D; Silcox VA; Gnaore E; Adjorlolo G; De Cock KM; Division of HIV/AIDS, Centers for Disease Control, Atlanta, GA; 30333.
OBJECTIVE: To determine the prevalence of Mycobacterium tuberculosis resistance to antituberculosis drugs, and to relate this resistance to HIV serologic status. DESIGN: Cross-sectional prevalence study. SETTING: The two major outpatient tuberculosis clinics in Abidjan, Cote d Ivo
Su IJ; Hsieh HC; Department of Pathology, National Taiwan University Hospital,; Taipei.
It has been recently demonstrated that the Epstein-Barr virus (EBV) can infect human thymocytes and may be involved in the T cell neoplasms, in addition to African Burkitt s lymphoma, nasopharyngeal carcinoma and Hodgkin s disease. Four distinct clinicopathologic categories of EBV-associated T cell malignancies have b
East Afr Med J. 1992 Oct;69(10):550-3. Unique Identifier : AIDSLINE MED/93114291
Keou FX; Belec L; Esunge PM; Cancre N; Gresenguet G; Department of Medical Microbiology, Broussais University; Hospital, Paris, France.
In 1985 at a World Health Organization (WHO) workshop on AIDS in Bangui, Central African Republic , a clinical case definition of Acquired Immune Deficiency Syndrome (AIDS) was developed for developing countries, such as sub-Saharan A
Katrak K; Mahon BP; Jones WC; Brautigam S; Mills KH; National Institute for Biological Standards and Control, Potters; Bar, Herts., UK.
A method is described for the separation and purification of proteins from complex mixtures of foreign antigens in a form suitable for stimulating T cells in vitro. The technique involves electrophoretic separation of proteins followed by elution, concentration and adsorption of the polypeptide subunits to latex micro
Lardelli P; Manzano D; Steinberg SM; Madariaga L; Anton I; Cisterna R; Department of Microbiology and Immunology, School of Medicine,; University of the Basque Country, Bilbao, Spain.
The existence of molecular transactivations between EBV and HIV-1, as well as reactivations of EBV latent infections in AIDS patients, have been recently documented. In order to shed more light on the putative association between EBV and HIV, and its role in the evolution to AIDS, we have determined simultaneously p24
Aslanzadeh J; Osmon DR; Wilhelm MP; Espy MJ; Smith TF; Department of Laboratory Medicine, Mayo Clinic, Rochester, MN; 55905.
Polymerase chain reaction (PCR) was prospectively performed with cerebrospinal fluid (CSF) from 51 patients whose CSF was available for analysis and was submitted for viral culture and/or herpes simplex virus (HSV) serology and 20 patients whose CSF was submitted exclusively to the Clinical Biochemistry Laboratory. Pr
A complex karyological analysis of three human cell lines (PLC-PRF-5, MT-4 and U937) was carried out that involved traditional methods of G-, C-banding and silver staining, in addition to the in situ hybridization technique using 4 alpha-satellite DNA probes: DNA specific for centromeric regions of chromosome 11, 6, 1
Becker Y; Department of Molecular Virology, Faculty of Medicine, Hebrew; University of Jerusalem, Israel.
The bestfit computer program was used to compare the amino acid sequence of the gp160 envelope glycoprotein of an apathogenic AGM and the pathogenic SIVAGM monkey lentiviruses. It was found that the gp120 envelope glycoproteins of these viruses resembled each other in their functional domains. However, an insert of 40
Pocsik E; Higuchi M; Aggarwal BB; Department of Clinical Immunology and Biological Therapy,; University of Texas M. D. Anderson Cancer, Houston 77030.
Tumor necrosis factor-alpha (TNF-alpha) induces the expression of human immunodeficiency virus type-1 (HIV-1) in vitro in chronically infected cells of T and monocytic origin. The tat protein from the HIV-1 virus has been shown to be essential for HIV replication and in the immunosuppression associated with the virus
Hirashima M; Ueno M; Higuchi S; Matsumoto T; Sakata KM; Matsumoto R; Adachi M; Department of Pathology, Kumamoto University Medical School,; Japan.
We established a T-cell line, STO-2, by human T-cell lymphoma-leukemia virus-induced transformation of normal human T cells. Partial purification with isoelectric electrophoresis revealed that STO-2 liberated several eosinophil chemotactic factors (ECF) for eosinophils from healthy individuals with different isoelectr
Dragomir D; Popescu V; Clinica de Pediatrie, Spitalul Clinic Sf. Pantelimon, Bucuresti.
The hematologic disorders that occur in HIV infected children are analysed by the authors, on the basis of some recent studies from current literature. There are emphasized the importance of the frequency of anemia, leukopenia and granulocytopenia. There are also stressed the pathogenic mechanisms of these disorders,
Shepherd AJ; Boyd JE; Hogg CL; Aw D; James K; Department of Medical Microbiology, University of Edinburgh; Medical School, UK.
Seven immortalized B cell clones, five of which secreted specific human monoclonal antibodies (MAbs) against hepatitis B, tetanus toxoid, and Rhesus D antigens, were evaluated for their susceptibility to infection by human immunodeficiency virus types 1 and 2 (HIV-1 and HIV-2). Infection was confirmed in three human M
Semin Cancer Biol. 1992 Oct;3(5):321-8. Unique Identifier : AIDSLINE MED/93120519
Weiss RA; Laboratoire de Retrovirologie Moleculaire, Institut Pasteur,; Paris, France.
Retroviruses have long been associated with cancer in many species. Human T cell leukaemia virus type I causes adult T cell leukaemia. Human immunodeficiency virus infection is associated with lymphoma and Kaposi sarcoma, but oncogenesis is largely secondary to its effect on the immune system. The incidence of Kaposi
Ger J Ophthalmol. 1992;1(2):110-3. Unique Identifier : AIDSLINE MED/93121014
Geier SA; Klauss V; Matuschke A; Kronawitter U; Goebel FD; Universitats-Augenklinik, Munchen, Federal Republic of Germany.
The case with the longest survival time (30 months) after the diagnosis of cytomegalovirus retinitis in a group of 53 patients with the acquired immune deficiency syndrome and cytomegalovirus retinitis (median survival time 8.4 months) is described. The patient developed cytomegalo
Can J Vet Res. 1992 Oct;56(4):339-48. Unique Identifier : AIDSLINE MED/93121252
Jacobs RM; Song Z; Poon H; Heeney JL; Taylor JA; Jefferson B; Vernau W; Valli VE; Department of Pathology, Ontario Veterinary College, University; of Guelph.
Twenty-seven cattle with lymphoma and 46 cows from a known bovine leukemia virus (BLV)-infected herd were tested for anti-BLV antibody by the agar gel immunodiffusion (AGID) test and an enzyme-linked immunosorbent assay (ELISA). The polymerase chain reaction (PCR) and Southern hybridization were used to detect BLV pro
Can J Vet Res. 1992 Oct;56(4):353-9. Unique Identifier : AIDSLINE MED/93121254
Jacobs RM; Smith HE; Gregory B; Valli VE; Whetstone CA; Department of Pathology, Ontario Veterinary College, University; of Guelph.
Bovine antibovine immunodeficiency-like virus (BIV) antibodies were detected by Western blot analysis (WBA) using a chemiluminescence protocol. Bovine sera with anti-BIV activity, obtained from cows in two dairy herds, had antibodies directed against a variety of BIV-specific antigens indicating chronic infections. Th
Gabrielsen B; Monath TP; Huggins JW; Kefauver DF; Pettit GR; Groszek G; Hollingshead M; Kirsi JJ; Shannon WM; Schubert EM; et al; U.S. Army Medical Research Institute of Infectious Diseases, Fort; Detrick, Frederick, Maryland 21702.
A series of 23 Amaryllidaceae isoquinoline alkaloids and related synthetic analogues were isolated or synthesized and subsequently evaluated in cell culture against the RNA-containing flaviviruses (Japanese encephalitis, yellow fever, and dengue viruses), bunyaviruses (Punta Toro, sandfly fever, and Rift Valley fever
Bruch JF; Nessmann C; Laboratoire de Biologie du Developpement et de la Reproduction,; Hopital Robert-Debre, Paris, France.
The stages of placental development are briefly described as well as the cellular and molecular mechanisms involved in the immunologic defense systems at the maternofetal interface. Methods available for morphologic studies of placentas with viral infection are reviewed. Routes of transmission of viruses from mother t
Postgrad Med J. 1992 Sep;68(803):739-41. Unique Identifier : AIDSLINE MED/93126186
Mampaso F; Bellas C; Molina A; Quereda C; Bricio T; Buzon L; Department of Pathology, Hospital Ramon y Cajal, Madrid, Spain.
We have studied by the in situ hybridization method the presence of Epstein-Barr virus (EBV) DNA genome in lymph node tissues from 11 patients with persistent generalized lymphadenopathy. Using a biotinylated EBV DNA probe, we demonstrated EBV nucleic acid in scattered germinal centre cells in eight of the 11 cases. O
Vet Microbiol. 1992 Nov;33(1-4):311-31. Unique Identifier : AIDSLINE MED/93127441
Egberink H; Horzinek MC; Institute of Virology, School of Veterinary Medicine, State; University of Utrecht, Netherlands.
Feline immunodeficiency virus (FIV) has morphological, physical and biochemical characteristics similar to human immunodeficiency virus (HIV), the cause of AIDS in man. However, it is antigenically and genetically distinct from HIV; an antigenic relatedness with equine infectious anaemia virus has been demonstrated. F
Vet Microbiol. 1992 Nov;33(1-4):333-40. Unique Identifier : AIDSLINE MED/93127442
Nilsson A; Lunqvist P; Love A; Torfason E; Gelderblom HR; Hoglund S; Department of Biochemistry, Biomedical Center, Uppsala, Sweden.
Progressive states of maturing lentivirus: maedia visna virus (MVV) and human immunodeficiency virus (HIV), respectively, have been visualized by 2-D electron microscopy and by 3-D electron microscopic tomography. A major fraction of MVV and a low percentage of HIV appear as immature particles 4 to 5 days post virus i
Piquet Y; Janvier G; Selosse P; Doutremepuich C; Jouneau J; Nicolle G; Platel D; Vezon G; Centre Regional de Transfusion Sanguine, Bordeaux, France.
In order to increase the safety of blood products, we have developed a procedure for the virus inactivation of fresh frozen plasma. Several batches have been prepared and with the first 10 batches, each of them composed of 60 litres of plasma, we have determined a set of biological parameters. Virus inactivation was r
An Esp Pediatr. 1992 Dec;37(6):499-502. Unique Identifier : AIDSLINE MED/93128690
Munell Casadesus F; Tusell Puigbert JM; Gibernau J; Carrascosa Lezcano A; Bosch Moragas A; Unidad de Hemofilia y Hospital Materno-Infantil del Valle; Hebron, Universidad Autonoma de Barcelona.
Mathes LE; Polas PJ; Hayes KA; Swenson CL; Johnson S; Kociba GJ; Department of Veterinary Pathobiology, College of Veterinary; Medicine, Columbus, Ohio.
The benefits of postexposure 3 -azido-3 -dideoxythymidine ( AZT ) prophylaxis following human immunodeficiency virus exposure are unknown. We describe a comprehensive assessment of pre- and postexposure AZT therapy in the feline leukemia virus (FeLV)-ca
Biochem Biophys Res Commun. 1992 Dec 30;189(3):1444-9. Unique Identifier : AIDSLINE MED/93129209
Hussain S; Anner RM; Anner BM; Laboratory of Experimental Therapeutics, Geneva University; Medical Center, Switzerland.
Metal-binding proteins are important components of retroviruses such as human immunodeficiency virus (HIV). Therefore, metals could be used as antiviral agents. However, most metals are toxic for humans with the exception of silver which is toxic only to prokaryotic cells and viruses. In addition, HIV infection causes
Int Arch Allergy Immunol. 1992;99(1):153-6. Unique Identifier : AIDSLINE MED/93130113
Wick G; Grubeck-Loebenstein B; Trieb K; Kalischnig G; Aguzzi A; Institute for General and Experimental Pathology, University of; Innsbruck, Medical School, Austria.
Human foamy virus (HFV) is a recently characterized member of the retrovirus subfamily Spumaretrovirinae. HFV has a complex structure: it encodes the classical three retroviral structural genes gag, pol and env, but also possesses additional regulatory, so-called bel sequences. Foamy viruses have been discussed occasi
C R Acad Sci III. 1992;315(7):287-93. Unique Identifier : AIDSLINE MED/93130373
Confort-Gouny S; Vion-Dury J; Nicoli F; Dano P; Gastaut JL; Cozzone PJ; Centre de Resonance magnetique biologique et medicale,; U.R.A.-C.N.R.S. n. 1186, Faculte de Medecine, Marseille.
Proton localized Magnetic Resonance Spectroscopy (MRS) of the brain allows the non invasive detection of intracellular cerebral metabolites. Localized MRS has been performed using short stimulated-echo times in various neurological diseases including stroke, multiple sclerosis, and AIDS-related leukoencephalopathies.
Tomelleri G; Tonin P; Spadaro M; Tilia G; Orrico D; Barelli A; Bonetti B; Monaco S; Salviati A; Morocutti C; et al; Istituto di Neurologia, Universita di Verona.
Histochemical, electron microscopy and biochemical studies were performed on muscle biopsy specimens from 11 AIDS patients treated with zidovudine. A peculiar association of structural abnormalities and mitochondrial dysfunction was found. Focal cytochrome c oxidase (COX) deficiency was evident in muscle sections from
Tenzer JA; Sugarman HM; Britton JC; Dental Medicine and Oral and Maxillofacial Surgery, Muhlenberg; Hospital Center and St. Luke's Hospital, Bethlehem, Pa. 18018.
A young woman with AIDS developed squamous cell carcinoma of the gingiva. This malignancy rarely develops in young people and may indicate an underlying condition.
In situ hybridization was used to identify the cell types infected by hepatitis C virus (HCV) in the liver. Using an antisense HCV-RNA probe from the 5 non-coding region, HCV-RNAs molecules were detected in liver sections of 4/11 patients with chronic hepatitis C. These 4 positive subjects were also infected by HIV.
Ashton P; Brown JD; Pearson PA; Blandford DL; Smith TJ; Anand R; Nightingale SD; Sanborn GE; Department of Ophthalmology, University of Kentucky, Lexington.
Cytomegalovirus ( CMV ) retinitis occurs in immunocompromised patients and can be treated by repeated intravenous or intravitreal injections of ganciclovir (GCV) or foscarnet. Due to toxicity and complications these modalities are not ideal. The development of alt
Leger JM; Clinique des maladies du systeme nerveux Paul-Castaigne,; hopital de la Salpetriere, Paris, France.
Disorders of the peripheral nervous system occur at all stages of HIV1 infection. Acute and subacute inflammatory demyelinating polyneuropathies are mainly observed in otherwise asymptomatic HIV+ patients and in patients with ARC (AIDS-related complex): clinical and electrophysiological features are similar to those o
Zdziennicki A; Kliniki Perinatologii Instytutu Ginekologii i Poloznictwa; Ak.Med, Lodzi.
After a review of the literature reports from recent years viral infections in pregnant women are presented as a fetal and neonatal risk factor. Maternal infections with rubella virus, cytomegalovirus ++, hepatitis, Coxsackie B, varicella, herpes, poliomyelitis, parvovirus B19 and H
Epstein-Barr virus (EBV)-genome containing cases of Hodgkin s disease (HD) are known to express latent membrane protein (LMP) of EBV but no EBV nuclear antigen 2 (EBNA2). We investigated 35 cases of HD for the presence of EBV genome sequences to know whether EBNA2 coding region is deleted in HD. 27 cases had general E
Acta Vet Scand. 1992;33(4):325-34. Unique Identifier : AIDSLINE MED/93142624
Sukura A; Grohn YT; Junttila J; Palolahti T; Department of Anatomy, College of Veterinary Medicine, Helsinki,; Finland.
Toward the end of 1989 the largest private veterinary laboratory in Finland (Vet/lab) began using a commercial combined ELISA test for Feline Immunodeficiency Virus (FIV) antibodies and Feline Leukemia Virus (FeLV) antigens (Cite Co
Schmid DS; Thieme ML; Ridgeway MR; Mawle AC; Centers for Disease Control, Division of Viral and Rickettsial; Diseases, Atlanta, Georgia.
The ability of human immunodeficiency virus type-1 (HIV-1) and recombinant HIV-1 gp120 to prevent target cell lysis by herpes simplex virus type 1 (HSV-1)-specific cytotoxic T lymphocytes (CTL) was assessed by limiting dilution analysis. Live and inactivated HIV-1 as well as recombinant-derived gp120 all substantially
Mientjes GH; van Ameijden EJ; Roos MT; de Leeuw NA; van den Hoek JA; Coutinho RA; Miedema FF; Municipal Health Service, Department of Public Health and; Environment, Amsterdam, The Netherlands.
OBJECTIVE: To measure diurnal variation in the CD4 cell count and T-cell reactivity of drug users. DESIGN: A prospective epidemiological study among HIV-infected and non-infected drug users attending the Municipal Health Service of Amsterdam, The Netherlands . PATIENTS: Eleven
Murakami T; Nakashima H; Ito M; Yamamoto N; Department of Microbiology, Tokyo Medical and Dental University; School of Medicine, Japan.
OBJECTIVE: To develop a useful system for evaluating novel anti-HIV drugs. DESIGN: The activity of most antiviral compounds in cell-free HIV infection systems has been evaluated. However, the inhibitory effects on both the process of HIV induction and viral dissemination to uninfected cells have not been fully investi
OBJECTIVES: To determine the optimal diagnostic procedures for identifying early signs of AIDS dementia complex (ADC) in asymptomatic HIV-1-infected individuals, in order to prevent further cognitive function impairment by early treatment. DESIGN: Study patients had been referred e
Bagdades EK; Pillay D; Squire SB; O'Neil C; Johnson MA; Griffiths PD; Department of Thoracic Medicine, Royal Free Hospital and School; of Medicine, London, UK.
OBJECTIVE: To establish the incidence of herpes simplex virus (HSV) ulceration in relation to CD4+ cell counts in HIV-infected patients. DESIGN: Swabs were taken from all ulcerated lesions in HIV-infected patients and cultured for HSV. CD4+ cell counts were performed at regular intervals. SETTING: The HIV unit at a Lo
Conant MA; Calabrese LH; Thompson SE; Poiesz BJ; Rasheed S; Hirsch RL; Meyerson LA; Kremer AB; Wang CC; Goldstein G; University of California, San Francisco.
OBJECTIVE: To assess the efficacy and safety of thymopentin in HIV-infected patients who had not yet developed AIDS. DESIGN: Patients were stratified into asymptomatic or symptomatic groups and randomized to receive either thymopentin (50 mg) or placebo, subcutaneously, double-blind for 24 or 52 weeks, three times a w
Gorter RW; Vranizan KM; Osmond DH; Moss AR; Department of Medicine, Universitat Witten/Herdecke, Germany.
OBJECTIVES: To determine differences in CD4+ and CD8+ lymphocyte values, beta 2-microglobulin (beta 2M), and HIV p24 antigenemia by sex and race among HIV-seropositive and HIV-seronegative injecting drug users (IDU), and to compare these values with those in homosexual men of equivalent status. DESIGN: Baseline values
Chevret S; Roquin H; Ganne P; Lefrere JJ; Departement de Biostatistique et Informatique Medicale,; Hopital Saint-Louis, Paris, France.
OBJECTIVE: To evaluate the prognostic value of an elevated CD8 lymphocyte count in the early stages of HIV infection. DESIGN: A prospective study ongoing since January 1986. METHODS: One hundred and fifty-two asymptomatic HIV-positive individuals with a CD4 lymphocyte count > 400 x 10(6)/l at enrollment were included.
Schloth T; Genabe I; Pilgrim W; Jorden A; Fein PA; Avram MM; Long Island College Hospital, Brooklyn, New York 11201.
The prevalence of HIV positive patients (HIV pts) with ESRD is likely to increase and many will be going on CAPD. There are, however, factors which cause one to be concerned about a possible increased risk of peritonitis in these patients. These include not only their impaired immune and nutritional status, but often
Kitze B; Turner RW; Burchhardt M; Poser S; Hunsmann G; Weber T; Neurologische Klinik und Poliklinik, Universitat Gottingen.
Two Iranian patients with chronic progressive spastic paraparesis and urinary dysfunction were referred to our hospital with the presumptive diagnosis of multiple sclerosis (MS). Routine CSF analysis and magnetic resonance imaging of the two patients were only partially characteristic of MS. Testing for antibodies to
A 71-year-old female patient with classic Kaposi sarcoma (sarcoma idiopathicum haemorrhagicum multiplex) of the lower legs and one hand was treated with intralesional recombinant interferon alpha 2b. After 6 consecutive weeks of intratumoral injection of 1-3 million IU interferon-alpha 2b (Intron A) in three marked le
Visuvanathan S; Holton J; Nye P; Miller RF; Moss MT; Department of Microbiology and Medicine, University College and; Middlesex School of Medicine, London.
Restriction fragment length polymorphism (RFLP) types of Mycobacterium avium intracellulare and Mycobacterium kansasii isolated from patients with AIDS were examined. We demonstrate that one RFLP type is much more common than others which confirms previous findings. Carriage of individual RFLP types is constant over l
Steidley KE; Thompson SH; McQuade MJ; Strong SL; Scheidt MJ; Van Dyke TE; U.S. Army, Ft. Gordon, GA.
Previous reports describe a characteristic, rapidly progressive, periodontitis that is unique to patients who are seropositive for HIV antibody (Western blot +). The purpose of this study was to compare the T4 and T8 lymphocyte subpopulations in the peripheral blood and periodontal lesions of these HIV patients with t
Hayashi K; Ohara N; Fujiwara K; Jeon HJ; Koirala TR; Takahashi K; Akagi T; Tomita N; Miyamoto K; Second Department of Pathology, Okayama University Medical; School.
In order to discriminate HTLV-II from HTLV-I, HTLV-II-specific polyclonal antibodies against a synthetic peptide of HTLV-II envelope sequence were raised in rabbits. We immunized two adult rabbits with a KLH-conjugated synthetic peptide corresponding to the amino acid sequence 171-196 of the HTLV-II envelope sequence,
We describe a simple and inexpensive chemical procedure for the selective expansion of human CD4+ lymphocytes. The method employs L-leucine methyl ester (LME) to deplete monocytes and large granular lymphocytes, as well as to inhibit growth of CD8+ lymphocytes. LME treatment eliminates granular cells, but most CD8+ ly
Ann Pharmacother. 1992 Nov;26(11):1347-51. Unique Identifier : AIDSLINE MED/93120679
Rathbun RC; Martin ES 3d; Section of Pharmacy Practice, College of Pharmacy, University of; Oklahoma, Oklahoma City, OK 73190.
OBJECTIVE: To examine the effect of didanosine (2 ,3 -dideoxyinosine, ddI) on surrogate markers of HIV infection (CD4+ lymphocyte count, p24 antigen) and to evaluate the incidence of adverse effects from ddI. DESIGN: This study was performed as a retrospective chart review of patients who were enrolled in Bristol-Myer
Magallon Martinez M; Ortega F; Pinilla J; Centro de Hemofilia, Hospital La Paz, Madrid, Spain.
435 hemophiliacs are usually being attended in the La Paz hemophilia Center (Madrid, Spain ). 257 (59%) of these patients have been infected by the human immunodeficiency virus (HIV-1) because of human plasma derivate substitution therapy. The infection has been more frequent among t
The induction of CD4+ T-helper (Th) cell responses is likely to be an important requirement of vaccine candidates designed to prevent or moderate human immunodeficiency virus-1 (HIV-1) infection. We have investigated the ability of hybrid Ty virus-like particles carrying the V3 loop region of the HIV-1 IIIB envelope g
Smith KJ; Skelton HG 3d; Frissman DM; Angritt P; Walter Reed Army Institute of Research.
BACKGROUND: Hyperkeratotic lesions caused by varicella-zoster, herpes simplex, or cytomegalovirus occur in patients infected with human immunodeficiency virus type 1 (HIV-1). We have also observed this type of lesion with molluscum contagiosum. OBJECTIVES: These cases were studied
Res Virol. 1992 Sep-Oct;143(5):329-35. Unique Identifier : AIDSLINE MED/93126663
Cotte L; Escaich S; Ritter J; Martin JL; Trepo C; Unite Hepatogastroenterologie et SIDA, Hotel-Dieu, Lyon,; France.
To assess the correlations between clinical and biological stages of HIV infection and HIV isolation, peripheral blood mononuclear cells from 389 HIV-infected patients were studied by 30-day cocultures with normal lymphocytes. HIV isolation was successful in 279/389 patients (71.7%). Positive isolation was more freque
Vet Microbiol. 1992 Nov;33(1-4):117-27. Unique Identifier : AIDSLINE MED/93127420
Canals A; Alonso F; Tomillo J; Dominguez J; Departamento de Sanidad Animal, INIA, Madrid, Spain.
The proliferative response to infective and UV-inactivated African swine fever virus was analyzed in cells from pigs surviving an experimental infection with attenuated virus. All the pigs showed strong dose-dependent proliferative responses to both infective and UV-inactivated virus. This response was also observed w
Szabo B; Toth FD; Kiss J; Fust G; Ujhelyi E; Banhegyi D; Horvath A; Hollan SR; Institute of Microbiology, Medical University, Debrecen, Hungary.
Sera obtained from 27 HIV-infected persons were investigated for complement-dependent humoral cytotoxicity. Uninfected as well as HTLV-IIIB-infected H9 cells were used as cellular targets either before or after stimulation by phytohemagglutinin (PHA) or concanavalin A (Con-A). The degree of cytotoxicity was determined
Ann Med Interne (Paris). 1992;143(5):309-14. Unique Identifier : AIDSLINE MED/93128731
Lifermann F; Lacoste D; Merlio JP; Chene G; Beylot J; Service de Medecine Interne, Hopital Saint-Andre, Bordeaux.
The characteristics of 34 HIV-associated non Hodgkin s lymphomas diagnosed and treated at Bordeaux hospitals are described. The patients represented 7% of the AIDS cases observed in the Bordeaux area. HIV-lymphomas were almost always high-grade malignancies, usually disseminated (70%) with extranodal disease at presen
Ann Med Interne (Paris). 1992;143(5):315-7. Unique Identifier : AIDSLINE MED/93128732
Letard JC; Fornet A; Bahuet F; Leen E; Maurice P; Legendri R; Service d'Hepato-Gastroenterologie, Centre Hospitalier; Regional de Fort-de-France, La Meynard, Fort-de-France,; Martinique/FWI.
One hundred and twenty-nine upper gastrointestinal endoscopies were performed between November, 1986, and November, 1990, at the Fort-de- France Hospital ( Martinique ), on 92 patients who were sero
Piazza M; Chirianni A; Liuzzi G; Tullio Cataldo P; Santoro G; Barsanti L; Batoni G; Ceccherini Nelli L; Istituto di Malattie Infettive, II Facolta di Medicina,; Universita di Napoli.
In order to understand the significance of presence of HIV-1 in saliva, we searched for by PCR HIV-1 proviral sequences in the saliva cells of 49 HIV-1 infected patients. Seven out 49 specimens resulted positive, 4 of which were from patients with PGL, 1 with ARC and 2 with AIDS. Four patients had a CD4+ lymphocyte co
Blanshard C; Jackson AM; Shanson DC; Francis N; Gazzard BG; HIV/GUM Unit, Westminster Hospital, London.
The incidence of cryptosporidiosis in our unit has increased over the last 6 years, being diagnosed in approximately 5 per cent of all patients with HIV infection and in 21 per cent of those with AIDS, but a marked seasonal variation occurs. We have studied the course of the infection in 128 patients and identified fo
Stein MD; O'Sullivan P; Rubenstein L; Weller P; Wachtel T; Division of General Internal Medicine, Rhode Island Hospital,; Providence 02903.
OBJECTIVE: To describe the use of various counseling practices, examinations, and laboratory tests used by general internists in the primary care of HIV-infected persons. DESIGN: Mailed questionnaire survey. SUBJECTS: Random sampling of members of the Society of General Internal Medicine. RESULTS: Based on a 64% respo
Am J Epidemiol. 1992 Dec 1;136(11):1338-48. Unique Identifier : AIDSLINE MED/93142774
Concha M; Graham NM; Munoz A; Vlahov D; Royal W 3d; Updike M; Nance-Sproson T; Selnes OA; McArthur JC; Department of Neurology, School of Medicine, Johns Hopkins; University, Baltimore, MD.
Limited data are available on cognitive performance in populations of intravenous drug users during the early, asymptomatic stages of human immunodeficiency virus type 1 (HIV-1) infection. Between 1988 and 1990, 151 participants from the AIDS Link to Intravenous Experience (ALIVE) Study in Baltimore, Maryland, were ev
Chaisson RE; Moore RD; Richman DD; Keruly J; Creagh T; Department of Medicine, Johns Hopkins University School of; Medicine, Baltimore, MD 21205.
To determine the incidence and natural history of Mycobacterium avium-complex infections in persons with advanced human immunodeficiency virus (HIV) infection, we studied a multicenter cohort of 1,020 persons with acquired immunodeficiency syndrome (AIDS) or the AIDS-related complex (ARC) and CD4 cell count
Nonoxinol 9 effectively inactivates high titres of HIV in vitro, which suggest its use for reducing HIV-transmission via sexual intercourse. Therefore, the suggestion has been made for the treatment of sexual assault victims with a topical anti-HIV agent such as nonoxinol 9 as soon as possible after a sexual assault h
Dalgleish AG; Department of Cellular and Molecular Sciences, St George's; Hospital Medical School, London, UK.
The immunotherapy of AIDS encompasses a broad range of therapeutic possibilities. A number of stimulating and immunomodulating agents have been tried without any overt success. More recently, passive immunotherapy of AIDS using donated plasma and active therapeutic vaccine procedures have been reported. A number of cl
Since the discovery of human immunodeficiency virus (HIV) as the cause of AIDS the study of other members of the virus group lentivirinal has intensified. A major outcome of this research have been the development of state of the art diagnostic tests. While it has long been realised that these viruses were important c
Hellen CU; Wimmer E; Department of Microbiology, State University of New York, Stony; Brook 11794-8621.
Many viruses encode proteinases that are essential for infectivity, and are consequently attractive chemotherapeutic targets. The biochemistry and structure of the human immunodeficiency virus proteinase have been characterized extensively, and potent peptide-mimetic inhibitors have been developed. Techniques and stra
The immune responsiveness to the immunodominant B-cell epitopes of human T-lymphotropic virus type I (HTLV-I), derived from the external envelope glycoprotein (recombinant MTA-1(162-209), synthetic Env-1(194-214), and Env-5(242-257)) and the gag-encoded matrix protein (Gag-1a(102-117)), was analyzed in 19 HTLV-I-serop
Ziegner UH; Frank I; Bernatowicz A; Starr SE; Streckert HJ; Division of Infectious Diseases and Immunology, Children's; Hospital of Philadelphia, Pennsylvania.
In this study, epitopes of HIV envelope proteins that are involved in ADCC were identified. Peripheral blood mononuclear cells (PBMC) were obtained from adults with asymptomatic HIV infection or early symptoms of AIDS. These PBMC, which were reported to be armed in vivo with HIV-specific antibodies, were used as effec
Boucher CA; Lange JM; Miedema FF; Weverling GJ; Koot M; Mulder JW; Goudsmit J; Kellam P; Larder BA; Tersmette M; Department of Virology, University of Amsterdam, The Netherlands.
OBJECTIVE: To determine which parameters are associated with clinical progression during zidovudine treatment of asymptomatic HIV-1-infected individuals. METHODS: Twenty-four initially asymptomatic HIV-1-infected individuals were treated with zidovudine and followed until the development of AIDS or for approximately 3
Bohan CA; Kashanchi F; Ensoli B; Buonaguro L; Boris-Lawrie KA; Brady JN; Laboratory of Molecular Virology, National Cancer Institute,; National Institutes of Health, Bethesda, Maryland 20892.
The HIV Tat protein is a potent transactivator of HIV transcription, increasing both RNA initiation and elongation. We now demonstrate that purified, full-length 86 amino acid Tat protein specifically transactivates the HIV LTR in vitro to a high level (25- to 60-fold). Tat transactivation was specifically blocked by
The polymer of ethylenesulfonic acid (U-9843) is a potent inhibitor of HIV-1 RT (reverse transcriptase) and the drug possesses excellent antiviral activity at nontoxic doses in HIV-infected lymphocytes grown in tissue culture. The drug also inhibits RTs isolated from other species such as AMV and MLV retroviruses. Enz
Seshamma T; Bagasra O; Oakes JW; Pomerantz RJ; Department of Medicine, Jefferson Medical College, Thomas; Jefferson University, Philadelphia, PA 19107.
The ability to evaluate the patterns and levels of human immunodeficiency virus type I (HIV-1)-specific RNA in latently and productively-infected cell lines, and primary human cells, is critical to the understanding of HIV-1 expression in cell cultures and possibly in vivo. We have developed a quantitative reverse tra
Eberle J; Seibl R; Max von Pettenkofer-Institut, Ludwig-Maximilians-University of; Munchen, Germany.
A new and sensitive assay of reverse transcriptase (RT) activity of retroviruses measures the incorporation of digoxigenin-labelled dUTP in newly synthesized DNA instead of radioactively labelled (3H- or 32P-)dTTP. To avoid difficulties associated with separation of non-incorporated nucleotides from the newly synthesi
The use of exclusionary techniques in the procurement of donors for bone allografts greatly reduces chances for disease transmission. Furthermore, treatment of HIV with either chemical agents or strong acids will effectively inactivate the AIDS virus. These data are taken as indirect proof that the risk of obtaining A
Lazcano A; Valverde V; Hernandez G; Gariglio P; Fox GE; Oro J; Departamento de Biologia, Facultad de Ciencias-UNAM, Mexico,; D.F.
Reverse transcriptase (RT) was first discovered as an essential catalyst in the biological cycle of retroviruses. However, in the past years evidence has accumulated showing that RTs are involved in a surprisingly large number of RNA-mediated transpositional events that include both viral and nonviral genetic entities
Med Hypotheses. 1992 Nov;39(3):212-24. Unique Identifier : AIDSLINE MED/93116655
Glinsky GV; Cancer Research Center, Columbia, MO 65201.
This overview will focus on the functional and pathophysiological aspects of blood group antigen (BGA)-related glycodeterminants with regard to immunogenesis and AIDS pathogenesis. It has been postulated that in a broad range of histogenetically different tissues and organs, BGA-related glycoepitopes are expressed on
Med Microbiol Immunol (Berl). 1992;181(5):267-81. Unique Identifier : AIDSLINE MED/93116678
Rossol S; Gianni G; Rossol-Voth R; Gallati H; Muller WE; Meyer zum Buschenfelde KH; I. Medizinische Klinik und Poliklinik,; Johannes-Gutenberg-Universitat, Mainz, Federal Republic of; Germany.
Monocyte/macrophage-mediated tumor cytotoxicity was studied in patients infected with human immunodeficiency virus-1 (HIV-1) at various stages [Center for disease control (CDC) classification] of the disease. using the P-815 tumor cell line as target cells, the results demonstrated reduced monocyte/macrophage cytotoxi
Marazziti D; Ambrogi F; Vanacore R; Mignani V; Savino M; Palego L; Cassano GB; Akiskal HS; Department of Psychiatry, University of Pisa, Italy.
We investigated subsets of peripheral immunologic cells in 12 drug-free patients affected by major depression according to DSM-III-R criteria, and who had recent evidence of somatic diseases. They were compared with 10 drug-free depressives, with 10 patients with panic disorder, and with 12 healthy volunteers, all wit
P R Health Sci J. 1992 Dec;11(3):129-34. Unique Identifier : AIDSLINE MED/93117327
Diaz AM; Frontera R; Kraiselburd E; Department of Microbiology and Medical Zoology, School of; Medicine, University of Puerto Rico, San Juan 00936-5067.
The ROD strain of the human immunodeficiency virus type 2 (HIV-2) was used to produce monoclonal antibodies. Virus grown in CEM cells was partially purified by ultracentrifugation and solubilized in a buffer containing Triton X-100. BALB/c mice were inoculated intraperitoneally with 50 micrograms of solubilized virus
Reverse transcriptase activity was measured by incorporation of dUMP linked to digoxigenin into a suitable template-primer molecule. Incorporation was monitored by using peroxidase-conjugated Fab fragments directed against digoxigenin. The standard assay measuring incorporation of radiolabeled nucleotides into acid-pr
Malkovsky M; Fisch P; Mackenzie D; Bartz SR; Radtke BE; Wallace M; Manning J; Colizzi V; Pauza CD; Department of Medical Microbiology, University of Wisconsin; Medical School, Madison.
Immunol Lett. 1992 Sep;34(1):85-90. Unique Identifier : AIDSLINE MED/93122858
Fantini J; Bolmont C; Yahi N; INSERM U322, Marseille, France.
The human colon epithelial cell line HT29 can be infected by selected strains of the human immunodeficiency virus (HIV) [9]. In the present study, it is shown that tumor necrosis factor-alpha (TNF-alpha) is a potent stimulator of HIV replication in chronically infected differentiated HT29 cells, but not in undifferent
J Med Chem. 1992 Dec 25;35(26):4846-53. Unique Identifier : AIDSLINE MED/93124455
Tan GT; Wickramasinghe A; Verma S; Singh R; Hughes SH; Pezzuto JM; Baba M; Mohan P; Department of Medicinal Chemistry and Pharmacognosy, College of; Pharmacy, Chicago, Illinois.
Several naphthalenedi- and trisulfonic acids have been synthesized and evaluated for inhibitory potential against cytopathogenesis and purified recombinant human immunodeficiency virus type 1 (HIV-1) and type 2 (HIV-2) reverse transcriptase (RT). The most potent derivative that emerged from the anti-RT study was a sma
Yamamoto N; Schols D; De Clercq E; Debyser Z; Pauwels R; Balzarini J; Nakashima H; Baba M; Hosoya M; Snoeck R; et al; Rega Institute for Medical Research, Katholieke Universiteit; Leuven, Belgium.
Various polyoxometalates proved inhibitory to the replication of a number of enveloped DNA and RNA viruses, i.e., herpesviruses (herpes simplex and cytomegalo), togaviruses (Sindbis), paramyxoviruses (respiratory syncytial), rhabdoviruses (vesicular stomatitis), arenaviruses (Junin and Tacaribe), and retroviruses [hum
Iwai S; Pritchard C; Mann DA; Karn J; Gait MJ; MRC Laboratory of Molecular Biology, Cambridge, UK.
The Human Immunodeficiency Virus type-1 rev protein binds with high affinity to a bubble structure located within the rev-response element (RRE) RNA in stemloop II. After this initial interaction, additional rev molecules bind to the RRE RNA in an ordered assembly process which requires a functional bubble structure,
Kovac J; Zachar V; Bruckova M; Ujhelyi E; Fust G; Mayer V; Zajac V; Institute of Virology, Bratislava, Czecho-Slovakia.
Recombinant proteins derived from immunodominant conserved domains of HIV-1 env and gag genes were synthesized in E. coli. An immunoblot system using total cell lysates was employed for the analysis of recombinant bacterial clones. Together 427 serum samples obtained from asymptomatic anti-HIV seropositive individuals
Witvrouw M; Pauwels R; Vandamme AM; Schols D; Reymen D; Yamamoto N; Desmyter J; De Clercq E; Rega Institute for Medical Research, Katholieke Universiteit; Leuven, Belgium.
The drug Ro5-3335 [7-chloro-5-(2-pyrryl)-3H-1,4-benzodiazepin-2(H)-one] inhibits human immunodeficiency virus type 1 (HIV-1) gene expression at the transcriptional level through interference with Tat-mediated transactivation (M.-C. Hsu, A. D. Schutt, M. Holly, L. W. Slice, M. I. Sherman, D. D. Richman, M. J. Potash, a
Larder BA; Department of Molecular Sciences, Wellcome Research Laboratories,; Beckenham, Kent, United Kingdom.
Nonnucleoside reverse transcriptase (NNRT) inhibitors (R82913; (+)-S-4,5,6,7-tetrahydro-9-chloro-5-methyl-6-(3-methyl-2-butenyl)- imidazo[4,5,1-jk][1,4]-benzodiazepin-2(1H)-thione; Cl-TIBO; and BI-RG-587, nevirapine ) were used to select resistant huma
Ikeda S; Tsutsui K; Hatsushika M; Watanabe S; Oda T; Department of Biochemistry, Faculty of Science, Okayama; University of Science, Japan.
We found a type D retrovirus in a human lymphoblastoid cell line of B-cell lineage. Molecular cloning and nucleotide sequencing of the provirus genome revealed that this virus was closely related to squirrel monkey retrovirus (SMRV), and we designated this virus as SMRV-H. To investigate the relationship between these
van den Berg LH; Sadiq SA; Lederman S; Latov N; Department of Neurology, Columbia University, New York NY 10032.
We investigated the binding of the gp120 glycoprotein of the human immunodeficiency virus (HIV-1) to neural glycolipids and glycoproteins by ELISA. The gp120 protein bound to sulfatide (GalS), a sulfated glycolipid autoantigen implicated in sensory neuritis, and to the myelin associated glycoprotein (MAG), an autoanti
Tidsskr Nor Laegeforen. 1992 Dec 10;112(30):3824-6. Unique Identifier : AIDSLINE MED/93134559
Bland JD; Barneavdelingen, Sentralsjukehuset i Rogaland, Stavanger.
In today s health service, doctors cannot avoid teaching or lectures. Visual aids are an important part of any successful presentation. Adequate overheads and slides can be easily made using ordinary office equipment and simple cameras. Modern computers and laser printers are also an exciting medium for producing visu
Protein Expr Purif. 1992 Dec;3(6):479-87. Unique Identifier : AIDSLINE MED/93136707
Warren TC; Miglietta JJ; Shrutkowski A; Rose JM; Rogers SL; Lubbe K; Shih CK; Caviness GO; Ingraham R; Palladino DE; et al; Department of Biochemistry, Boehringer Ingelheim Pharmaceuticals,; Inc., Ridgefield, Connecticut 06877.
A procedure for producing and purifying recombinant HIV-1 and HIV-2 reverse transcriptase (RT) is described. These enzymes are produced by Escherichia coli-transformed with a plasmid containing the gene encoding for either the human immunodeficiency virus type 1 (HIV-1) or HIV-2 RT protein. Both proteins are partially
Verastegui E; Ortega V; Soler C; Lazo de la Vega S; Ocadiz R; Meneses A; Reynoso E; Alfaro G; Departamento de Medicina Interna, Instituto Nacional de; Cancerologia, Mexico, D.F.
This report describes a clinical case of a large cell, immunoblastic plasmacytoid malignant B-cell lymphoma of the rectum in an AIDS patient coinfected with HTLV-I. The malignant cells showed clonal genetic rearrangement of the HC (JH) and LCK genes. Infection by EBV was demonstrated serologically and with slot blots
In a series of 33 cynomolgus monkeys (Macaca fascicularis) experimentally infected with Simian Immunodeficiency virus (SIV), strain smm3, 13 animals developed malignant Non-Hodgkin lymphomas. These lymphomas presented with unusual primary manifestations like in the orbita, testes, and brain. The morphological features
Paulus W; Jellinger K; Hallas C; Gartner C; Kretschmer C; Ott G; Muller-Hermelink HK; Pathologisches Institut, Universitat Wurzburg.
Fourty-three primary cerebral lymphomas (PCL) were histologically classified and examined for genome expression of Epstein Barr Virus (EBV) and human herpes virus 6 (HHV6) using dot blotting, polymerase chain reaction, and Southern blotting. Only 20 tumors (16 high grade and 4 low grade lymphomas) could be suitably pl
Schinazi RF; McMillan A; Cannon D; Mathis R; Lloyd RM; Peck A; Sommadossi JP; St Clair M; Wilson J; Furman PA; et al; Veterans Affairs Medical Center, Decatur, Georgia 30033.
2 ,3 -Dideoxy-5-fluoro-3 -thiacytidine (FTC) has been shown to be a potent and selective compound against human immunodeficiency virus type 1 in acutely infected primary human lymphocytes. FTC is also active against human immunodeficiency virus type 2, simian immunodeficiency virus, and feline immunodeficiency virus i
Blood. 1993 Jan 1;81(1):95-100. Unique Identifier : AIDSLINE MED/93112981
Tschachler E; Bohnlein E; Felzmann S; Reitz MS Jr; Department of Dermatology, University of Vienna Medical School,; Austria.
Human T-lymphotropic virus type-I (HTLV-I)-infected T-cell lines constitutively produce high levels of lymphotoxin (LT). To analyze the mechanisms that lead to the expression of LT in HTLV-I-infected cell lines, we studied regulatory regions of the human LT promoter involved in the activation of the human LT gene. As
Begbie S; Burgess KR; Department of Internal Medicine, Manly Hospital, Sydney, NSW,; Australia.
A 47-year-old woman developed pulmonary eosinophilia from the use of maloprim as malaria prophylaxis. The diagnosis was confirmed by bronchoalveolar lavage (BAL) and transbronchial lung biopsy. Her condition improved with drug withdrawal and steroid therapy. With the increased use of pyrimethamine and dapsone in the t
Drabick JJ; Gasser RA Jr; Saunders NB; Hadfield TL; Rogers LC; Berg BW; Drabick CJ; Department of Bacterial Diseases, Walter Reed Army Institute of; Research, Washington, DC 20307-5100.
A case of acute pneumonia due to Pasteurella multocida ssp multocida occurred in a young man with AIDS and chronic sinusitis. The pneumonia was diagnosed by bronchoscopy and responded to treatment with aztreonam. Epidemiologic investigation revealed the case was temporally related to nontraumatic exposure to cat secre
Orme IM; Furney SK; Skinner PS; Roberts AD; Brennan PJ; Russell DG; Shiratsuchi H; Ellner JJ; Weiser WY; Department of Microbiology, Colorado State University, Fort; Collins 80523.
Infections caused by Mycobacterium avium, the most common form of diseminated bacterial disease in AIDS patients, are difficult to treat because of their resistance to many antimycobacterial drugs. The results of the present study show that recombinant migration inhibitory factor, a 12-kDa molecule recently isolated b
J Cancer Res Clin Oncol. 1993;119(3):137-41. Unique Identifier : AIDSLINE MED/93115197
Hayashi K; Ohara N; Fujiwara K; Aoki H; Jeon HJ; Takahashi K; Tomita N; Miyamoto K; Akagi T; Second Department of Pathology, Okayama University Medical; School, Japan.
A new interleukin-2( IL-2 )-dependent T cell line, designated CS-IIA, was established by co-cultivating normal human cord leukocytes and a lethally X-irradiated HTLV-II-producing simian leukocyte cell line (Si-IIA). CS-IIA showed CD4 dominance during the early culture. H
Moudgil T; Daar ES; Department of Medicine, Cedars-Sinai Medical Center, University; of California, School of Medicine, Los Angeles 90048.
AIDS is caused by the human immunodeficiency virus type 1 (HIV-1). Recent methods have been developed to estimate infectious titer in various bodily fluids, including blood. However, lack of information about HIV-1 stability in blood has restricted the use of these techniques to fresh samples in immediately accessible
Furtado MR; Murphy R; Wolinsky SM; Department of Medicine, Northwestern University Medical School,; Chicago, Illinois 60611.
To evaluate the use of human immunodeficiency virus type 1 (HIV-1) tat mRNA quantification as a marker for antiretroviral therapy, 10 zidovudine-naive, p24 antibody-positive subjects (Centers for Disease Control classes III and IV) were studied at the start of zidovudine treatment. HIV-1 proviral DNA content and tat m
Molina JM; Sarfati C; Beauvais B; Lemann M; Lesourd A; Ferchal F; Casin I; Lagrange P; Modigliani R; Derouin F; et al; Division of Infectious Diseases, Hopital Saint-Louis, Paris,; France.
Eighteen patients infected with human immunodeficiency virus and with chronic unexplained diarrhea were prospectively studied to investigate the prevalence and clinical and biologic features of intestinal microsporidiosis . All patients underwent extensive evaluation fo
Shepp DH; Ashraf A; Department of Medicine, North Shore University Hospital-Cornell; University Medical College, Manhasset, New York 11030.
To determine if suppression of human immunodeficiency virus (HIV) replication during antiretroviral therapy correlates with clinical outcome, serial quantitative serum cultures and HIV p24 antigen measurements were made in patients with advanced HIV disease treated with didanosine. Twenty-one (78%) of 27 had viremia d
Dallabetta GA; Miotti PG; Chiphangwi JD; Saah AJ; Liomba G; Odaka N; Sungani F; Hoover DR; Department of Epidemiology, Johns Hopkins University School of; Hygiene and Public Health, Baltimore, Maryland.
A total of 6600 pregnant urban women attending an antenatal clinic of a major hospital in Malawi were evaluated for risk factors for human immunodeficiency virus type 1 (HIV-1) infection. HIV-1 seroprevalence was 23% and significantly (P
Wallis RS; Vjecha M; Amir-Tahmasseb M; Okwera A; Byekwaso F; Nyole S; Kabengera S; Mugerwa RD; Ellner JJ; Department of Medicine, Case Western Reserve University,; Cleveland, Ohio.
Tuberculosis results in activation of T cells and macrophages that may harbor latent human immunodeficiency virus (HIV-1). Although such activation is beneficial to the host in terms of mycobacterial disease, it may be deleterious in terms of HIV-1. In Ugandan HIV-1-seropositive patients with pulmonary tuberculosis, a
Stuver SO; Tachibana N; Okayama A; Shioiri S; Tsunetoshi Y; Tsuda K; Mueller NE; Department of Epidemiology, Harvard School of Public Health,; Boston, Massachusetts 02115.
To identify factors that may modify the heterosexual transmission of human T cell leukemia/lymphoma virus type I (HTLV-I), 534 married couples enrolled in the Miyazaki Cohort Study between November 1984 and April 1989 were studied: 95 husband HTLV-I-seropositive (H+)/wife seropositive (W+), 33 H+/W-, 64 H-/W+, and 342
JAMA. 1993 Jan 20;269(3):361-5. Unique Identifier : AIDSLINE MED/93116208
Osmond DH; Padian NS; Sheppard HW; Glass S; Shiboski SC; Reingold A; Department of Epidemiology and Biostatics, University of; California, San Francisco.
OBJECTIVES. To determine the risk of heterosexual transmission of hepatitis C virus (HCV) and to identify other risk factors for HCV seropositivity in heterosexual couples. DESIGN. Retrospective cross-sectional study comparing HCV-seropositive and HCV-seronegative heterosexual men and women. SETTING. Couples recruited
Safer sex practices intended to reduce the risk for human immunodeficiency virus (HIV) infection have been vigorously promoted among men who are homosexual or bisexual (i.e., men who have sex with men). Such efforts have emphasized personal responsibility and protection of partners, and many of these men appear to hav
Katz MH; Mastrucci MT; Leggott PJ; Westenhouse J; Greenspan JS; Scott GB; Oral AIDS Center, Department of Stomatology, University of; California, San Francisco.
OBJECTIVE--To assess the prevalence and prognostic significance of oral lesions in children with human immunodeficiency virus infection. DESIGN--Clinical cohort study. SETTING--Children s Hospital Center at Jackson Memorial Hospital, Miami, Fla. PARTICIPANTS--Ninety-nine children with perinatally acquired human immuno
Breyer JA; Harbison MA; Department of Medicine, Vanderbilt University Medical Center,; Nashville, TN 37232.
Human immunodeficiency virus (HIV)-seropositive individuals represent a growing population of peritoneal dialysis (PD) patients. An important health care issue in these patients is the potential for their PD fluid to transmit virus. Some body fluids, such as urine, have been demonstrated to be negative for HIV and the
Vergilio JA; Roberts RB; Davis JM; Department of Surgery, Cornell University Medical College, New; York, NY 10021.
The exposure of third-year medical students to blood and blood products in the operating room was assessed with a questionnaire distributed at the end of their clerkship in surgery. Sixty-six (68%) of ninety-seven students reported having been exposed to blood in the operating room during their 3-month rotation in sur
Bray DH; Squire SB; Kawana A; Johnson MA; Poulter LW; Department of Clinical Immunology, Royal Free Hospital and School; of Medicine, London, UK.
MoAbs and immunoperoxidase methods were used to identify antigen-presenting and phagocytic cells and to assess expression of HLA-DR molecules on cells obtained by bronchoalveolar lavage (BAL) from 33 AIDS patients and nine normal volunteers. In 17 patients, not receiving antiretroviral therapy, the expression of HLA-D
Da Costa CT; Khanolkar-Young S; Elliott AM; Wasunna KM; McAdam KP; Department of Clinical Sciences, London School of Hygiene &; Tropical Medicine, UK.
Immunoglobulin G subclass responses to lipoarabinomannan (LAM) of Mycobacterium tuberculosis were determined by ELISA in both HIV-1 antibody positive (n = 31) and negative (n = 43) patients with tuberculosis (TB). Responses were also studied in a group of healthy controls (n = 16) and HIV-1 antibody positive (n = 60)
Steffen M; Reinecker HC; Petersen J; Doehn C; Pfluger I; Voss A; Raedler A; Department of Internal Medicine, University Hospital Eppendorf,; Hamburg, Germany.
Mononuclear cells of the lamina propria (LpMNC), isolated from endoscopically taken biopsies of the large bowel from AIDS patients, were analysed for their ability to secrete tumour necrosis factor-alpha (TNF-alpha), IL-1 beta and IL-6. Stimulation of LpMNC from normal controls with pokeweed mitogen (PWM) led to a tim
Ayehunie S; Sonnerborg A; Yemane-Berhan T; Zewdie DW; Britton S; Strannegard O; Department of Biology, Addis Ababa University, Ethiopia.
Serum levels of tumour necrosis factor-alpha (TNF-alpha), neopterin and interferon-alpha (IFN-alpha) were determined by immunoradiometric assays in 60 HIV-1+ and 20 HIV-1- subjects from Ethiopia . Swedish samples were used as reference material. The Ethiopian HIV-1+ subjects were
Favero J; Corbeau P; Nicolas M; Benkirane M; Trave G; Dixon JF; Aucouturier P; Rasheed S; Parker JW; Liautard JP; et al; INSERM U65, Universite Montpellier II, France.
Jacalin is a plant lectin known to specifically induce the proliferation of CD4+ T lymphocytes in human. We demonstrate here that jacalin completely blocks human immunodeficiency virus type 1 (HIV-1) in vitro infection of lymphoid cells. Jacalin does not bind the viral envelope glycoprotein gp120. Besides other T cell
Wolff SD; Kuhlman JE; Fishman EK; Russell H. Morgan Department of Radiology and Radiologic; Sciences, Johns Hopkins Medical Institutions, Baltimore, MD.
Cases of acquired immunodeficiency syndrome (AIDS) related Kaposi sarcoma (KS) were reviewed to characterize the spectrum of thoracic findings seen with chest CT. Of 15 patients with AIDs-related KS involving the chest, 13 (87%) demonstrated pulmonary parenchymal disease characterized by multiple, bilateral flame-shap
Caring for persons with AIDS and HIV-related illness is extremely rare within long-term care facilities. A survey of 54 Illinois nursing facilities indicated that homes were reluctant to care for persons with AIDS due to concerns about cost, staff capabilities or resistance, and concerns about mix with other residents
J Immunol. 1993 Jan 15;150(2):361-6. Unique Identifier : AIDSLINE MED/93123735
De Wit D; Van Mechelen M; Zanin C; Doutrelepont JM; Velu T; Gerard C; Abramowicz D; Scheerlinck JP; De Baetselier P; Urbain J; et al; Departement de Biologie Moleculaire, Universite Libre de; Bruxelles, Belgium.
The injection of DBA/2 parental lymphocytes into adult, immunologically intact (C57BL/6 x DBA/2) F1 hybrid mice results in a chronic graft-vs-host reaction (GVHR) characterized by a deficiency in CD4+ T cell functions and a B cell activation leading to autoantibody production. The discovery that distinct subpopulation
J Nerv Ment Dis. 1993 Jan;181(1):4-12. Unique Identifier : AIDSLINE MED/93124001
Lackner JB; Joseph JG; Ostrow DG; Kessler RC; Eshleman S; Wortman CB; O'Brien K; Phair JP; Chmiel J; Department of Epidemiology, School of Public Health, University; of Michigan, Ann Arbor 48109.
This study presents analyses on questionnaire data collected from a panel of 520 gay men at risk for acquired immune deficiency syndrome, enrolled in the Coping and Change Study (1985-1987). The data were assessed to determine the association of social support and coping styles with subsequent depression and global di
Hayward RA; Weissfeld JL; Division of General Internal Medicine, School of Medicine,; University of Michigan Medical Center, Ann Arbor 48109-0376.
PURPOSE: To examine factors associated with residents willingness to provide care to persons with AIDS. PATIENTS AND METHODS: Survey of all senior residents in internal medicine and family medicine in ten geographically representative states in early 1989. RESULTS: Preferring not to care for persons with AIDS was les
Boucher FD; Modlin JF; Weller S; Ruff A; Mirochnick M; Pelton S; Wilfert C; McKinney R Jr; Crain MJ; Elkins MM; et al; Department of Pediatrics, Stanford University School of Medicine,; California.
This study evaluated the safety, tolerability, and pharmacokinetics of zidovudine administered intravenously and orally to infants born to women infected with the human immunodeficiency virus. Thirty-two symptom-free infants were enrolled before 3 months of age. The pharmacokinetics of zidovudine were evaluated in eac
Moniaci D; Cavallari M; Greco D; Bruatto M; Raiteri R; Palomba E; Tovo PA; Sinicco A; Institute of Odontology, University of Turin, Italy.
A cohort of 69 children born to HIV-1 positive women was studied to evaluate types, prevalences and relationships to clinical stages of HIV-1-related oral lesions. In addition, relationships among C. albicans biotypes, clinical features of oral candidiasis and HIV-1 disease were investigated. C. albicans biotypes did
Barnett SW; Quiroga M; Werner A; Dina D; Levy JA; Cancer Research Institute, School of Medicine, University of; California, San Francisco 94143-0128.
A full-length infectious molecular clone was derived from the noncytopathic human immunodeficiency virus type 2 UC1 strain (HIV-2UC1) that was originally recoverd from an individual from the Ivory Coast . Like the parental isolate, the molecularly cloned virus (HIV-2UC1mc or UC
Gessain A; Boeri E; Yanagihara R; Gallo RC; Franchini G; Laboratory of Tumor Cell Biology, National Cancer Institute,; Bethesda, Maryland 20892.
The high prevalences of antibodies against human T-cell leukemia (lymphotropic) virus type I (HTLV-I) reported for remote populations in Papua New Guinea and the
Popik W; Pitha PM; Oncology Center, Johns Hopkins University School of Medicine,; Baltimore, Maryland 21231.
Transcription of human immunodeficiency virus type 1 (HIV-1) depends on the function of the virus-encoded regulatory protein Tat, which interacts with the specific Tat response (TAR) element present in the leader sequence of all HIV-1 RNAs. In this study, we examined whether tumor necrosis factor alpha (TNF-alpha) can
Rhim H; Rice AP; Division of Molecular Virology, Baylor College of Medicine,; Houston, Texas 77030-3498.
Using gel shift assays, we found that the human immunodeficiency virus type 1 (HIV-1) Tat protein (Tat-1) bound both HIV-1 and HIV-2 TAR RNAs with similar high affinities. In contrast, the HIV-2 Tat protein (Tat-2) bound only TAR-2 RNA with high affinity. We conclude that the weak in vivo activity of Tat-2 on the HIV-
Hong T; Murphy E; Groarke J; Drlica K; Public Health Research Institute, New York, New York 10016.
The target specificity of DNA strand transfer mediated by human immunodeficiency virus type 1 integrase was examined in vitro with synthetic oligonucleotides. Although insertion occurred at most locations in the target, some sites were preferred over others by at least 15-fold. Changing the nucleotide sequence of the
Chang LJ; McNulty E; Martin M; Laboratory of Molecular Microbiology, National Institute of; Allergy and Infectious Diseases, Bethesda, Maryland 20892.
The human immunodeficiency virus (HIV) type 1 long terminal repeat (LTR) contains binding sites for nuclear factor kappa B (NF-kappa B) and the constitutively expressed transcription factor Sp1, both of which are highly conserved in HIV and simian immunodeficiency virus isolates. To delineate the effects of these moti
Beisel CE; Edwards JF; Dunn LL; Rice NR; Laboratory of Molecular Virology and Carcinogenesis,; NCI-Frederick Cancer Research and Development Center, Maryland; 21702.
Transcription of pathogenic equine infectious anemia virus (EIAV) in an acutely infected horse was examined by using the polymerase chain reaction and nucleotide sequencing. Four spliced transcripts were identified in liver tissue, in contrast to the multiplicity of alternatively spliced messages reported for in vitro
Broder CC; Berger EA; Laboratory of Viral Diseases, National Institute of Allergy and; Infectious Diseases, Bethesda, Maryland 20892.
The third complementarity-determining region (CDR3) within domain 1 of the human CD4 molecule has been suggested to play a critical role in membrane fusion mediated by the interaction of CD4 with the human immunodeficiency virus type 1 (HIV-1) envelope glycoprotein. To analyze in detail the role of CDR3 and adjacent r
Shilatifard A; Merkle RK; Helland DE; Welles JL; Haseltine WA; Cummings RD; Department of Biochemistry and Molecular Biology, University of; Oklahoma Health Science Center, Oklahoma City 73104.
The major envelope glycoproteins gp120 and gp41 of human immunodeficiency virus type 1, the causative agent for human AIDS, contain numerous N-linked oligosaccharides. We report here our discovery that N-acetylglucosamine residues within the complex-type N-linked oligosaccharides of both gp120 and its precursor, gp160
Med J Aust. 1993 Jan 18;158(2):101-3. Unique Identifier : AIDSLINE MED/93125278
Pigott P; Smith A; Mills J; Department of Thoracic Medicine, Royal North Shore Hospital, St; Leonards, NSW.
The lungs are a primary target for the opportunistic infections and malignancies affecting those with HIV infection. In the patient whose HIV infection is undiagnosed, PCP is the commonest clue to its presence. Early diagnosis prevents morbidity and mortality. Less commonly, interstitial lung disease and tuberculosis,
Med J Aust. 1993 Jan 18;158(2):109-10. Unique Identifier : AIDSLINE MED/93125280
Foltyn P; Dental Department, St Vincent's Hospital, Darlinghurst, NSW.
Oral lesions are frequently an early sign of HIV infection. However, without careful examination their significance can be missed, as they are often painless and discrete and may be the only sign of HIV infection.
Med J Aust. 1993 Jan 18;158(2):114-6. Unique Identifier : AIDSLINE MED/93125282
Bertouch JV; Gala S; Department of Rheumatology, Prince Henry and Prince of Wales; Hospital, Randwick, NSW.
Among the less well-known manifestations of HIV infection are the musculoskeletal disorders. Since most of these occur in patients who are otherwise well, they represent an important opportunity for the detection of unsuspected HIV infection.
Nath A; Hobson DE; Russell A; Department of Internal Medicine, University of Manitoba,; Winnipeg, Canada.
Movement disorders occur in some patients with cerebral toxoplasmosis with HIV-1 infection. Such movement disorders have not been described in patients with cerebral toxoplasmosis without HIV-1 infection. This report discusses their diagnostic features, aspects of management, and possible mechanisms underlying the pat
Singer C; Berger JR; Bowen BC; Bruce JH; Weiner WJ; Department of Neurology, University of Miami School of Medicine,; Florida.
A 13-year-old HIV-infected girl presented with a rapidly progressive akinetic-rigid syndrome. Cranial magnetic resonance imaging revealed bilateral centrum semiovale lesions extending into the basal ganglia. Detailed histopathological study of a biopsy specimen from the involved regions resulted in a diagnosis of prog
N Engl J Med. 1993 Feb 4;328(5):297-302. Unique Identifier : AIDSLINE MED/93125623
Miles SA; Balden E; Magpantay L; Wei L; Leiblein A; Hofheinz D; Toedter G; Stiehm ER; Bryson Y; Center for AIDS Research and Education, University of California,; Los Angeles 90024-1793.
BACKGROUND. Serologic detection of human immunodeficiency virus (HIV) infection in neonates is complicated by the presence of immune complexes, consisting of passively transferred maternal antibodies and HIV antigens. A new, rapid assay has been designed to disrupt these immune complexes in order to permit the detecti
Proc Natl Acad Sci U S A. 1993 Jan 1;90(1):138-42. Unique Identifier : AIDSLINE MED/93126329
Ohana B; Moore PA; Ruben SM; Southgate CD; Green MR; Rosen CA; Department of Gene Regulation, Roche Institute of Molecular; Biology, Nutley, NJ 07110.
The type 1 human immunodeficiency virus Tat protein is a powerful transcriptional activator when bound to an RNA structure (TAR) present at the extreme 5 terminus of viral mRNA. Since transcriptional activation requires binding of Tat to RNA, it has been suggested that Tat enhances initiation or elongation through a
Proc Natl Acad Sci U S A. 1993 Jan 1;90(1):332-6. Unique Identifier : AIDSLINE MED/93126370
Pincus SH; McClure J; Laboratory of Microbial Structure and Function, National; Institute of Allergy and Infectious Diseases, Rocky Mountain; Laboratories, Hamilton, MT 59840.
Monoclonal antibodies specific for the gp120 or gp41 portions of the human immunodeficiency virus (HIV) envelope protein gp160 were conjugated to ricin A chain, and their immunotoxic activities against HIV-infected cells were evaluated in the presence or absence of soluble CD4 (sCD4). Immunotoxin activity was measured
Proc Natl Acad Sci U S A. 1993 Jan 1;90(1):357-61. Unique Identifier : AIDSLINE MED/93126376
Embretson J; Zupancic M; Beneke J; Till M; Wolinsky S; Ribas JL; Burke A; Haase AT; Department of Microbiology, University of Minnesota Medical; School, Minneapolis 55455.
Latent and productive viral infections are at the extremes of the spectrum of virus-cell interactions that are thought to play a major role in the ability of such important human pathogens as human immunodeficiency virus (HIV) to elude host defenses and cause disease. The recent development of PCR-based methods to amp
Holliday RA; Department of Radiology, New York University School of Medicine,; New York.
The primary role of sectional imaging of the oromaxillofacial region in patients who have AIDS is to assess the extent of disease already identified by the clinician. In patients in whom the clinical presentation is complex or confusing, radiographic detection of otherwise occult manifestations of HIV infection plays
Chen RH; Ivens KW; Alpert S; Billingham ME; Fathman CG; Flavin TF; Shizuru JA; Starnes VA; Weissman IL; Griffiths GM; Howard Hughes Medical Institute, Stanford University School of; Medicine, California 94305.
Granzyme A is a serine protease expressed by populations of human and mouse natural killer cells and activated CD4+ and CD8+ cytotoxic lymphocytes; its expression marks a subset of inflammatory cells in allografts, autoimmune diabetes, and a number of other inflammatory lesions. In order to describe more completely th
Two women and two men were infected with the human immunodeficiency virus type 1 (HIV-1) transmitted by renal transplantation from i.v. drug-addicted donors in 1984. The four recipients were treated with cyclosporine and methylprednisolone (one patient only for three months because of early graft failure). Two patient
Am J Med. 1993 Jan;94(1):100-3. Unique Identifier : AIDSLINE MED/93128260
Tunkel AR; Thomas CY; Wispelwey B; Division of Infectious Diseases, Medical College of Pennsylvania,; Philadelphia 19129.
Prosthetic arthritis due to Candida species is uncommon, with only 15 cases reported in the literature. We recently cared for a human immunodeficiency virus-infected patient who developed Candida parapsilosis prosthetic arthritis unresponsive to resection arthroplasty, intravenous amphotericin B, and suppressive ketoc
Am J Med. 1993 Jan;94(1):35-40. Unique Identifier : AIDSLINE MED/93128274
Pretet S; Salmon D; Rousseau F; Guillon JM; Taki BE; Roux ME; Belguendouz A; Deleuze J; Morini JP; Gorin I; et al; Department of Chest Medicine, Hopital Cochin, Paris, France.
PURPOSE: To evaluate the long-term efficacy and safety of inhaled pentamidine as primary prophylaxis against Pneumocystis carinii pneumonia (PCP) in patients infected with human immunodeficiency virus (HIV). PATIENTS: Two hundred thirty-two HIV-infected patients with a CD4 cell count below 20% of the total lymphocyte
Ann Intern Med. 1993 Feb 15;118(4):241-5. Unique Identifier : AIDSLINE MED/93128700
Khan AS; Heneine WM; Chapman LE; Gary HE Jr; Woods TC; Folks TM; Schonberger LB; Centers for Disease Control and Prevention, Atlanta, Georgia.
OBJECTIVE: To assess whether the human T-lymphotropic virus type II (HTLV-II) gag gene sequence, a purportedly new laboratory marker of the chronic fatigue syndrome (CFS), and other possible risk factors for CFS, particularly those associated with retroviral transmission, are associated with well-characterized CFS. DE
Allard R; Boivin JF; Department of Community Health, Saint-Luc Hospital, Montreal,; Quebec, Canada.
The sufficient causes model of disease occurrence leads to a specific conception of how the risk of disease resulting from exposure to an agent combines with background risks. From this conception, one can derive a method for quantifying in populations the respective effects of the agent and background, using either r
Hunter DJ; Department of Epidemiology, Harvard School of Public Health,; Boston, MA 02115.
As the epidemic of the acquired immunodeficiency syndrome (AIDS) in sub-Saharan Africa enters its second decade, much has been learned about the distribution and determinants of the disease and its causative agent, the human immunodeficiency virus (HIV). Over 6 million people, or 2.5% of the adult population, are thou
Can Med Assoc J. 1993 Jan 15;148(2):175-83. Unique Identifier : AIDSLINE MED/93130439
Baris E; McGregor M; Departement d'Administration de la sante, Universite de; Montreal, Que.
OBJECTIVE: To evaluate the safety and potential cost savings of hemodialyzer reuse. DATA SOURCES: All English and French articles published from 1960 to 1991 related to hemodialyzer reuse (retrieved through an Index Medicus and MEDLINE search [corrected]), the indexes of eight North American journals from 1960 onward,
Leavitt AD; Shiue L; Varmus HE; Department of Immunology and Microbiology, University of; California, San Francisco 94143-0502.
The retroviral integrase (IN) protein is essential for integration of retroviral DNA into the host cell genome. To identify functional domains within the protein and to assess the importance of conserved residues, we performed site-directed mutagenesis of HIV-1 IN and analyzed the mutants in vitro for IN-mediated acti
Lilienbaum A; Paulin D; Laboratoire de Biologie Moleculaire de la Differentiation de; l'Universite Paris 7, France.
The molecular basis for transactivation of the human vimentin gene by the Tax protein from the human T-cell leukemia virus (HTLV-1) is analyzed in this report. We first demonstrate that the factor NF-kappa B binds to the vimentin promoter. Using gel retardation assays, we found the putative NF-kappa B protein. Specifi
Kotler DP; Reka S; Chow K; Orenstein JM; Department of Medicine, St. Luke's-Roosevelt Hospital Center,; College of Physicians and Surgeons, Columbia University, New; York, New York 10025.
We compared, retrospectively, the effects of infection in jejunal mucosa with the protozoa cryptosporidia or microsporidia and with the human immunodeficiency virus (HIV) upon mucosal structure and absorptive function in 29 AIDS patients. The presence or absence of protozoal infection was confirmed by transmission ele
Small CB; Kaufman A; Armenaka M; Rosenstreich DL; Department of Medicine, North Central Bronx Hospital, New York.
Sinusitis is increased in patients with human immunodeficiency virus (HIV) infection. To determine the underlying mechanism(s), 37 HIV-positive patients were evaluated. HIV-negative controls included 21 with rhinosinusitis, 32 with atopy, and 16 without sinusitis. Twenty-two HIV-positive patients (59%) had sinusitis;
Teppler H; Kaplan G; Smith K; Cameron P; Montana A; Meyn P; Cohn Z; Laboratory of Cellular Physiology and Immunology, Rockefeller; University, New York, New York.
Interleukin-2 ( IL-2 ) is a key cytokine in cellular immunity. Human immunodeficiency virus type 1 (HIV-1)-infected individuals lack IL-2 because of low CD4+ T lymphocyte numbers. In an attempt to enhance cellular immunity, low-dose recombinant human (rh) IL-2 at 10 micr
Twu SJ; Detels R; Nelson K; Visscher BR; Kaslow R; Palenicek J; Phair J; University of California, Los Angeles, School of Public Health; 90024-1772.
The Multicenter AIDS Cohort Study (MACS) was designed to study the natural history of human immunodeficiency virus type 1 (HIV-1) infection, including the relationship between hepatitis B virus (HBV) and HIV-1 infection. In total, 4954 homosexual men were recruited from April 1984 through March 1985 and have been foll
Palasanthiran P; Ziegler JB; Stewart GJ; Stuckey M; Armstrong JA; Cooper DA; Penny R; Gold J; Department of Immunology/Allergy, Prince of Wales Children's; Hospital, Randwick, NSW, Australia.
Examination of breast-fed infants of the complete cohort of Australian women whose primary human immunodeficiency virus (HIV) infection occurred postpartum allows for an estimate of risk of transmission of HIV. Ten women with no other risk factors were infected via blood transfusion postpartum. They breast-fed for up
Tyndall M; Malisa M; Plummer FA; Ombetti J; Ndinya-Achola JO; Ronald AR; Department of Medicine, University of Manitoba, Winnipeg, Canada.
Ceftriaxone in a dose of 250 mg given intramuscularly is currently recommended for the treatment of chancroid. Among 133 men in Nairobi, Kenya , with culture-proven chancroid, who were treated with ceftriaxone, treatment failed in 35%. Poor outcome was associated with human immunodef
Araujo FG; Lin T; Remington JS; Research Institute, Palo Alto Medical Foundation, CA 94301.
The activity of atovaquone in the treatment of murine toxoplasmosis was greatly enhanced when administered in combination with pyrimethamine or sulfadiazine. Mice infected with lethal inocula of tachyzoites or cysts of Toxoplasma gondii and treated with doses of atovaquone, pyrimethamine, or sulfadiazine that were ine
Acquired immunodeficiency syndrome (AIDS) is a devastating disease the incidence of which is increasing in the black heterosexual community. Only 12% of the nation s population is black, yet 28% of the people with AIDS are black. AIDS currently threatens black adolescents because of their high risk sexual behavior. No
Solano L; Costa M; Salvati S; Coda R; Aiuti F; Mezzaroma I; Bertini M; Dipartimento di Psicologia, Universita di Roma La Sapienza,; Italy.
The aim of the study was to assess the relationship between the initial psychosocial situation and the probability of later symptom development in HIV-1 infection. One hundred HIV-1 seropositive subjects, 79 in Stage III (LAS) and 21 in Stage II (asymptomatic), were examined both immunologically (CD4+, Skin Test) and
J Med Chem. 1993 Jan 8;36(1):30-7. Unique Identifier : AIDSLINE MED/93132757
Kim HO; Schinazi RF; Nampalli S; Shanmuganathan K; Cannon DL; Alves AJ; Jeong LS; Beach JW; Chu CK; Department of Medicinal Chemistry, College of Pharmacy,; University of Georgia, Athens 30602.
In order to study the structure-activity relationships of dioxolane nucleosides as potential anti-HIV-1 agents, various enantiomers of pure dioxolanylpurine nucleosides were synthesized and evaluated against HIV-1 in human peripheral blood mononuclear cells. The enantiomerically pure key intermediate 1, which was synt
Surovoy A; Dannull J; Moelling K; Jung G; Shemyakin Institute of Bioorganic Chemistry, Moscow, Russia.
A 55 residue peptide corresponding to the nucleocapsid protein of HIV-1 (NCp7) containing two zinc binding domains as well as three truncated peptides were synthesized by Fmoc-based solid phase synthesis using the fragment condensation approach. Circular dichroism (CD) data support a conformational model in trifluoroe
Williams MF; Eisele DW; Wyatt SH; Department of Otolaryngology--Head and Neck Surgery, Johns; Hopkins Medical Institutions, Baltimore, MD 21203-6402.
Intravenous drug abusers often resort to deep cervical venous access if peripheral access is problematic. Deep cervical injection can occasionally result in needle breakage and needle foreign body. The records of 50 patients with neck needle foreign bodies related to intravenous drug abuse treated at The Johns Hopkins
Akan OA; Hacettepe Universitesi, Tip Fakultesi, Mikrobiyoloji Anabilim; Dali.
Infection constitutes an important professional hazard for health care workers. Since the past decades infections acquired during laboratory work have caused morbidity and even mortality among laboratory employees. In this article the importance of laboratory acquired infections and some guidelines for protection are
Sacilik SC; Ankara Universitesi, Fen Fakultesi, Biyoloji Bolumu.
In the serodiagnosis of tuberculosis, we are in a period used molecular biological techniques instead of classical methods. PCR (Polymerase Chain Reaction), ELISA (enzyme-linked immunosorbent assay), gas chromatography and mass spectrophotometry are routinely used for this propose in some countries. In this review, th
During the human immunodeficiency virus (HIV) epidemic, media and public interest have been captured periodically by accounts of persons infected with HIV. However, the effect of these stories on HIV/acquired immunodeficiency syndrome (AIDS) awareness and sexual behaviors is largely unknown. On November 7, 1991, Earvi
Human immunodeficiency virus (HIV) counseling and testing is a major component of the public health effort to contain the HIV/acquired immunodeficiency syndrome (AIDS) epidemic. However, persons may avoid HIV testing in part because they fear discrimination and legal sanctions if their drug use, sexual behavior, or te
Timmerman PR; Good Samaritan Hospital, Downers Grove, IL.
Intravenous immunoglobulin (IVIG) is a concentrated form of IgG, also known as gamma globulin, that is derived from the pooled serum of a large number of donors. IVIG contains many types of antibacterial and antiviral antibodies. While its use in certain clinical conditions (e.g., severe combined immunodeficiency) is
alpha-Trichosanthin, a eukaryotic ribosome-inactivating protein from Trichosanthes kirilowii, inhibits the replication of the human immunodeficiency virus (HIV) in vitro. The alpha-trichosanthin gene was placed under the transcriptional control of a tobamovirus subgenomic promoter in a plant RNA viral vector. Two week
Proc Natl Acad Sci U S A. 1993 Jan 15;90(2):610-4. Unique Identifier : AIDSLINE MED/93133836
Suzuki T; Fujisawa JI; Toita M; Yoshida M; Department of Cellular and Molecular Biology, University of; Tokyo, Japan.
The trans-activator protein Tax of human T-cell leukemia virus type 1 (HTLV-1) activates the viral 21-base-pair (bp) enhancer in the long terminal repeat and has been suggested to associate indirectly with the enhancer DNA. To demonstrate this, we used DNA-affinity precipitation assay and detected the Tax protein in 2
Ramalingaswami V; All India Institute of Medical Sciences, New Delhi.
This paper reinforces the idea of integrating more closely the social and medical sciences with an emphasis on people. The nexus between health and development is examined together with national research capability building as part of essential national health research progress. Suggestions are made identifying the mo
The present evolution of geography of health is highlighted through a selection of recent publications. Some current research trends are listed, such as disease ecology in a changing environment, geography of AIDS, urbanization, epidemiological transition, health care delivery. The most salient future perspectives are
Ahmad A; Ladha A; Cohen EA; Menezes J; Laboratory of Immunovirology, Sainte-Justine Hospital, Montreal,; Qc., Canada.
The env gene of human immunodeficiency virus type 1 (HIV-1) encodes gp 120/41 which plays an important role in the viral infection process and pathogenesis. The surface glycoprotein gp120 is a candidate molecule for the development of a subunit vaccine against HIV-1-induced acquired immunodeficiency syndrome (AIDS). H
Cell lines stably releasing noninfectious virus-like particles containing wild type or mutant gene products represent useful tools for a biochemical, immunological, and structural analysis of virus assembly. Human immunodeficiency virus (HIV) type 1 gag and env gene products were transiently and stably expressed in ma
Okada T; Patterson BK; Ye SQ; Gurney ME; Department of Cell Biology, Northwestern University Medical; School, Chicago, Illinois 60611.
Aurothioglucose and aurothiomalate have anti-HIV-1 activity in vitro. Antiviral activity requires the formation of a reactive intermediate with a molar equivalent amount of a thiol ligand. This activates gold(I) ligand exchange between the reactive species bis(thiolato)gold(I) and acidic thiol groups exposed on the su
Schwartzberg PL; Roth MJ; Tanese N; Goff SP; Department of Biochemistry, Columbia University College of; Physicians and Surgeons, New York, New York 10032.
We have previously described a series of mutations in the 3 terminus of the pol gene of Moloney murine leukemia virus which adversely affect the establishment of an integrated provirus (Roth, M. J., Schwartzberg, P., Tanese, N., and Goff, S. P., J. Virol. 64, 4709-4717, 1990). While most of the mutations were uncondi
Masuda T; Harada S; Department of Biodefence and Medical Virology, Kumamoto; University School of Medicine, Japan.
The trans-activation-responsive (TAR) element located within the 5 untranslated region of HIV-1 mRNA is the cis-responsive element for Tat, the viral trans-activator protein. Several TAR RNA binding proteins (TRBPs) have been identified in the nuclear extract from HeLa cells as cellular factors required for a full Ta
Fisher L; Goldschmidt RH; Hays RB; Catania JA; Center for the Study of Family and Health, San Francisco General; Hospital, CA.
BACKGROUND: The number of homosexual men (gay) with the human immunodeficiency virus (HIV) who will become ill in the next few years is expected to rise dramatically. Many will need and desire support from their families of origin. Understanding the history of family relationships can be crucial for the optimal care o
Patterson BK; Ehrenpreis ED; Yokoo H; Department of Pathology, Northwestern University Medical School,; Chicago, Illinois.
Vacuolization of duodenal enterocytes was found by light microscopic examination in five patients meeting the Centers for Disease Control criteria for the acquired immunodeficiency wasting syndrome. Four of these patients had chronic diarrhea and malabsorption as documented by an abnormal D-xylose test, whereas one pa
Snower DP; Weil SC; Department of Pathology, Northwestern University Medical School,; Chicago, Illinois.
Macrocytosis is most commonly associated with vitamin B12 and folate deficiencies, followed by alcoholism, liver disease, and malignant neoplasms. Many laboratories have observed that in recent years macrocytosis increasingly has been associated with zidovudine treatment of acquired immune deficiency syndrome. One hun
Am J Psychiatry. 1993 Feb;150(2):309-15. Unique Identifier : AIDSLINE MED/93135274
Perkins DO; Davidson EJ; Leserman J; Liao D; Evans DL; Department of Psychiatry, University of North Carolina School of; Medicine.
OBJECTIVE: Previous studies of psychiatric illness in populations infected with or at risk for HIV have not included systematic evaluation for personality disorders. The authors present the first controlled study of 1) personality disorders in HIV-positive and HIV-negative homosexual men and 2) the impact of personali
Am J Psychiatry. 1993 Feb;150(2):324-5. Unique Identifier : AIDSLINE MED/93135277
DiClemente RJ; Ponton LE; Center for AIDS Prevention Studies, Department of Psychiatry,; University of California School of Medicine, San Francisco.
The authors compared the responses of 76 adolescents on an inpatient psychiatric service with those of 802 school-based adolescents in the same city regarding HIV risk behaviors. The psychiatrically hospitalized adolescents reported a significantly higher rate of sexual and drug-related behaviors that involve a risk f
Am J Psychiatry. 1993 Feb;150(2):326-7. Unique Identifier : AIDSLINE MED/93135278
Lyketsos CG; Hanson AL; Fishman M; Rosenblatt A; McHugh PR; Treisman GJ; Department of Psychiatry and Behavioral Sciences, Johns Hopkins; University and Hospital, Baltimore, MD.
In a chart review at a hospital s infectious disease AIDS clinic, manic syndromes affected 8% of patients who had AIDS. Of the 14 patients with manic episodes, those without a family or personal history of mood disorder presented later in the course of HIV infection and had a higher prevalence of comorbid
Eidbo J; Sanchez RL; Tschen JA; Ellner KM; Department of Pathology, University of Texas Medical Branch,; Galveston 77555-0588.
The clinical and histologic features of cutaneous histoplasmosis in three patients with acquired immunodeficiency syndrome (AIDS) are described. The patients presented with multiple discrete papules on the extremities, trunk, and face, some of which were follicular. Histologically, the skin biopsies were characterized
Rietmeijer CA; Davidson AJ; Foster CT; Cohn DL; Denver Disease Control Service, CO 80204-4507.
BACKGROUND: The increasing impact of human immunodeficiency virus (HIV) infection on the health care delivery system requires surveillance of current patterns of HIV-related health care utilization to adequately plan for future needs. Most studies to date have concentrated on inpatient care for patients with the acqui
Biochemistry. 1993 Jan 19;32(2):395-400. Unique Identifier : AIDSLINE MED/93136130
Michnicka MJ; Harper JW; King GC; W.M. Keck Center for Computational Biology, Department of; Biochemistry and Cell Biology, Rice University, Houston, Texas; 77005.
The introduction of isotopically enriched nucleotides into NMR quantities of a synthetic 29-mer RNA derived from the HIV-1 TAR element is described. RNA enriched in 13C and/or 15N is produced by a procedure which involves isolation of whole cellular RNA from Escherichia coli, nucleolysis, separation of mononucleotides
Biochemistry. 1993 Jan 26;32(3):937-47. Unique Identifier : AIDSLINE MED/93136197
Dreyer GB; Boehm JC; Chenera B; DesJarlais RL; Hassell AM; Meek TD; Tomaszek TA Jr; Lewis M; Department of Medicinal Chemistry, SmithKline Beecham; Pharmaceuticals, King of Prussia, Pennsylvania 19406.
Potential advantages of C2-symmetric inhibitors designed for the symmetric HIV-1 protease include high selectivity, potency, stability, and bioavailability. Pseudo-C2-symmetric monools and C2-symmetric diols, containing central hydroxymethylene and (R,R)-dihydroxyethylene moieties flanked by a variety of hydrophobic P
Martin I; Defrise-Quertain F; Decroly E; Vandenbranden M; Brasseur R; Ruysschaert JM; Laboratoire de Chimie-Physique des Macromolecules aux Interfaces; CP206/2, Universite Libre de Bruxelles, Belgium.
For several retroviruses, the N-terminal hydrophobic sequence of the viral envelope glycoprotein has been shown to play a crucial role in the interaction between the virus and the host cell membrane. We report here on the interaction of a synthetic 16 residues peptide corresponding to the gp41 NH2-terminal sequence of
Mely Y; de Rocquigny H; Piemont E; Demene H; Jullian N; Fournie-Zaluski MC; Roques B; Gerard D; Laboratoire de Biophysique de la Faculte de Pharmacie, CNRS UA; 491, Universite Louis Pasteur, Strasbourg, Illkirch, France.
The nucleocapsid protein NCp10 of the Moloney murine leukaemia virus is a small basic protein characterized by a central Cys26-X2-Cys29-X4-His34-X4-Cys39 zinc-finger domain. Mutants with deletion of either the N- or C-terminal chain (or both) surrounding the central zinc-finger domain were synthesized by a solid-phase
Blood. 1993 Jan 15;81(2):437-45. Unique Identifier : AIDSLINE MED/93136432
Cannon PM; Tenen DG; Feinberg MB; Shin HS; Kim S; New England Deaconess Hospital, Boston, MA.
As a model system to study the infection of early myeloid cells by human immunodeficiency virus-1 (HIV-1), we have infected the human promyelocytic cell line, HL-60, with a recombinant selectable HIV-1 clone. A fully infected population showed a relatively high frequency of low-level infection, with 40% of subcloned c
Brain Res. 1993 Jan 8;600(1):161-5. Unique Identifier : AIDSLINE MED/93137053
da Cunha A; Jefferson JJ; Tyor WR; Glass JD; Jannotta FS; Vitkovic L; Laboratory of Immunoregulation, National Institute of Allergy and; Infectious Diseases, National Institutes of Health, Bethesda, MD; 20892.
Gliosis is the most frequent and therefore important neurocellular reaction to brain insult occurring in diseases ranging from AIDS to infarction. Neuropathological diagnosis of gliosis is based on morphological changes of brain glial cells. Changes commonly agreed to reflect gliosis are qualitative increases in size,
Crit Care Clin. 1993 Jan;9(1):1-11. Unique Identifier : AIDSLINE MED/93137116
Greenbaum DM; Section of Critical Care Medicine, St. Vincent's Hospital, New; York, New York.
This article provides a background so that the intensivist can appreciate the social and cultural context in which the AIDS epidemic developed. The upheaval that AIDS has caused in the gay community is described along with some of the economic effects AIDS has had on that population and on the practice of medicine, bo
Crit Care Clin. 1993 Jan;9(1):107-14. Unique Identifier : AIDSLINE MED/93137117
Rosen MJ; De Palo VA; Department of Medicine, Beth Israel Medical Center, New York, New; York.
Data on the outcome of intensive care for patients with AIDS have been reported since 1984. Most published statistics focus on the outcome of respiratory failure due to Pneumocystis carinii pneumonia, the most frequent reason for admission to the ICU. Survival appears to be improving in recent years, partly due to the
Crit Care Clin. 1993 Jan;9(1):115-23. Unique Identifier : AIDSLINE MED/93137118
Brown J; Sprung CL; Terem Immediate Medical Care, Hadassah Hebrew University Medical; Center, Jerusalem, Israel.
The treatment of patients with AIDS in the ICU presents the clinician with special challenges. The admission policies of ICUs are examined, and the authors suggest ways in which ethical difficulties may be minimized. A new concept of futility is suggested, which considers both the patient s holistic needs together wit
Crit Care Clin. 1993 Jan;9(1):125-36. Unique Identifier : AIDSLINE MED/93137119
Wachter RM; Lo B; Department of Medicine, University of California, San Francisco.
A consensus has emerged in recent years that decisions about life-sustaining treatment made by informed, competent patients should be respected. Advance directives are expressions of a patient s preferences regarding life-sustaining treatments made while the patient is still competent, to be used if the patient loses
Crit Care Clin. 1993 Jan;9(1):137-51. Unique Identifier : AIDSLINE MED/93137120
DeVita MA; Friedman Y; Petrella V; Department of Anesthesiology/CCM, University of Pittsburgh,; Pennsylvania.
FMCPAP and NCPAP therapy is an effective modality for treating patients with PCP, hypoxia, and respiratory insufficiency. The therapy decreases intrapulmonary shunting and improves oxygenation. It is safe and, in some cases, can be provided outside of an intensive care unit. The major benefit of MCPAP is that it postp
Crit Care Clin. 1993 Jan;9(1):31-48. Unique Identifier : AIDSLINE MED/93137122
Brooks KR; Ong R; Spector RS; Greenbaum DM; Department of Medicine, St. Vincent's Hospital and Medical; Center, New York, New York.
Pneumonia caused by Pneumocystis carinii is the most frequent indication for admission of AIDS patients to intensive care units. In this article, an approach to the diagnosis and management of this condition will be presented along with prognostic information. Differential diagnosis will be discussed, and characterist
Crit Care Clin. 1993 Jan;9(1):49-72. Unique Identifier : AIDSLINE MED/93137123
Levy RM; Berger JR; Department of Surgery (Neurosurgery), Northwestern University; Medical School, Chicago, Illinois.
Neurologic illness related to HIV-1 infection can involve the entire neuraxis and result in a wide range of neurologic syndromes. This article reviews intracerebral mass lesions, meningitis, myelopathy, peripheral neuropathy , and occupational exposure to HIV-1.
Crit Care Clin. 1993 Jan;9(1):73-88. Unique Identifier : AIDSLINE MED/93137124
Wilcox CM; Division of Digestive Diseases, Emory University School of; Medicine, Atlanta, Georgia.
Disorders of the gastrointestinal tract are a frequent complication of AIDS. Although the majority of these processes are not life threatening, some diseases will require ICU monitoring. With the increasing longevity of the HIV-infected patient, many more patients may be admitted to the ICU for a variety of other comp
Crit Care Clin. 1993 Jan;9(1):89-105. Unique Identifier : AIDSLINE MED/93137125
Chu DY; Department of Medicine, St. Vincent's Hospital and Medical; Center, New York, New York.
This article describes the APACHE II classification system as a measure of severity of illness applied to AIDS patients with respiratory insufficiency. Among 82 patients, observed mortality in patients with high APACHE II scores (greater than 30) and those with low scores (less than 18) was significantly higher than p
Cancer. 1993 Jan 15;71(2):481-5. Unique Identifier : AIDSLINE MED/93137197
Varthalitis I; Aoun M; Daneau D; Meunier F; Service de Medecine Interne, Institut Jules Bordet, Centre des; Tumeurs de l'Universite Libre de Bruxelles, Belgium.
BACKGROUND. The incidence of Pneumocystis carinii pneumonia (PCP) is increasing in patients with cancer. Possible nosocomial transmission from patients with acquired immune deficiency syndrome to those with cancer has been advocated. METHODS. Retrospectively, 17 patients with cancer were reviewed who had 20 PCP episod
FASEB J. 1993 Jan;7(1):181-7. Unique Identifier : AIDSLINE MED/93138305
Berkhout B; Essink BB; Schoneveld I; Department of Virology, University of Amsterdam, The Netherlands.
Retroviral particles contain a dimeric genome consisting of two full-length, noncovalently linked RNA molecules. Linkage of the two genomes is thought to be critical for a productive reverse transcription reaction and may increase genetic recombination rates. The molecular nature of the dimer linkage structure (DLS) i
FASEB J. 1993 Jan;7(1):214-22. Unique Identifier : AIDSLINE MED/93138310
Braddock M; Powell R; Blanchard AD; Kingsman AJ; Kingsman SM; Department of Biochemistry, Oxford University, England.
Human immunodeficiency virus (HIV-1) gene expression is activated by the viral TAT protein that interacts with an RNA sequence, TAR, located at the 5 end of all viral mRNAs. TAT functions primarily as a transcriptional activator in mammalian cells. However, in Xenopus oocytes TAT functions primarily as a translationa
Rose PG; Cheeseman SH; Department of Obstetrics and Gynecology, University of; Massachusetts Medical Center, Worcester 01655.
This is the first report of ovarian cancer developing in a patient with HIV infection. The patient had Stage IIIC, grade 2, serous ovarian carcinoma. Aggressive therapy consisting of primary cytoreduction, high-dose platinum-based chemotherapy, and second-look laparotomy was well tolerated. The patient s CA-125 level
Dickson DW; Lee SC; Mattiace LA; Yen SH; Brosnan C; Department of Pathology (Neuropathology), Albert Einstein College; of Medicine, Bronx, New York 10461.
Microglia are associated with central nervous system (CNS) pathology of both Alzheimer s disease (AD) and the acquired immunodeficiency syndrome (AIDS). In AD, microglia, especially those associated with amyloid deposits, have a phenotype that is consistent with a state of activation, including immunoreactivity with a
Peterson EM; Cheng X; Pal S; de la Maza LM; Department of Pathology, University of California, Irvine 92717.
Monoclonal antibodies (MAbs) E-4, E-21, and DIII A3, which recognize the same or similar overlapping peptides in the variable domain IV of the major outer membrane protein of Chlamydia trachomatis but differ in isotype, were used in a complement-independent (CI) in vitro neutralization assay. These MAbs had previously
Verdier M; Bonis J; Leonard G; Dumas M; Denis F; Laboratoire de Bacteriologie-Virologie, CHU Dupuytren, Limoges,; France.
The humoral immune responses in 44 sera from HTLV-1 seropositive African subjects were compared. The sample population was composed of 12 patients with HTLV-1 associated myelopathy/tropical spastic paraparesis (HAM/TSP), 12 patients with other neurological conditions and 20 asymptomatic carriers. Samples HTLV-1 antige
Plummer FA; Chubb H; Simonsen JN; Bosire M; Slaney L; Maclean I; Ndinya-Achola JO; Waiyaki P; Brunham RC; Department of Medical Microbiology, University of Manitoba,; Winnipeg, Canada.
The severe adverse effects of gonococcal infection on human fertility suggests that Neisseria gonorrhoeae would exert powerful selection for the development of a protective immune response in humans. N. gonorrhoeae is an obligate human pathogen and must persist in humans to survive. Since it is an ecologically success
Sanders LA; Rijkers GT; Kuis W; Tenbergen-Meekes AJ; de Graeff-Meeder BR; Hiemstra I; Zegers BJ; Department of Immunology, University Hospital for Children and; Youth, Het Wilhelmina Kinderziekenhuis, Utrecht, The Netherlands.
BACKGROUND: Recurrent pyogenic infections are known to occur in patients with an impaired response to polysaccharide antigens. We investigated the occurrence of deficient responses to pneumococcal capsular polysaccharides in patients with recurrent respiratory tract and recurrent systemic infections. METHODS: Forty-fi
J Immunol. 1993 Feb 1;150(3):1065-73. Unique Identifier : AIDSLINE MED/93139496
Joling P; Bakker LJ; Van Strijp JA; Meerloo T; de Graaf L; Dekker ME; Goudsmit J; Verhoef J; Schuurman HJ; Department of Pathology, University Hospital, Utrecht, The; Netherlands.
The authors studied the binding in vitro of HIV-1 virus particles, conjugated to fluorescein isothiocyanate, to follicular dendritic cells (FDC) isolated from human tonsils. Analysis was done using flow cytometry, fluorescence microscopy, and immunogold electron microscopy. The focus of study was on the effect of seru
Indraccolo S; Zamarchi R; Veronese ML; Mazza MR; Mion M; Veronesi A; Panozzo M; Colombatti M; Barelli A; Rocchetto P; et al; Institute of Oncology, Interuniversity Center for Research on; Cancer, University of Padua, Italy.
Optimal conditions for in vitro anti-human immunodeficiency virus type 1 (HIV-1) antibody (Ab) synthesis and detection were re-appraised. Western blot (WB) and radioimmunoassay (RIA) could detect about 1 and 10 ng, respectively, of HIV-1-specific Ab (HIV-Ab), while the sensitivity of an enzyme-linked immunosorbent ass
Kok T; Li P; Burrell C; National Centre for HIV Virology Research, Institute of Medical; and Veterinary Science, Adelaide, South Australia.
A cell clone persistently infected with human T cell-lymphotrophic virus type IIIB (H3B cells) contained mainly the multiply spliced (2 kb) and singly spliced (4.3 kb) species of human immunodeficiency virus (HIV) RNA. When H3B cells were co-cultured with susceptible HUT78 cells, cell fusion occurred within 4 h of cel
J Med Virol. 1993 Jan;39(1):75-9. Unique Identifier : AIDSLINE MED/93139802
Yamade I; Isono T; Ishiguro T; Yoshida Y; Department of Obstetrics and Gynecology, Shiga University of; Medical Science, Otsu, Japan.
Infection of human and rabbit cells with cell-free HTLV-I was studied by PCR analysis. Both human and rabbit PBL were infected similarly by cell-free virus of both human and rabbit cell origin. Cells were infected with the cell-free virus without prior treatment and regardless of the concentration of the culture super
Gallo JM; Swagler AR; Mehta M; Qian M; Department of Pharmaceutics, College of Pharmacy, University of; Georgia, Athens.
Coadministration of zidovudine ( AZT ) and nimodipine, a calcium-channel blocker, is a potential therapeutic regimen in acquired immunodeficiency syndrome patients based on the report that nimodipine can prevent human immunodeficiency virus-induced neur
J Med Chem. 1993 Jan 22;36(2):181-95. Unique Identifier : AIDSLINE MED/93140120
Jeong LS; Schinazi RF; Beach JW; Kim HO; Nampalli S; Shanmuganathan K; Alves AJ; McMillan A; Chu CK; Mathis R; Department of Medicinal Chemistry, College of Pharmacy,; University of Georgia, Athens 30602.
In order to study the structure-activity relationships of L-oxathiolanyl nucleosides as potential anti-HIV agents, a series of enantiomerically pure L-oxathiolanyl pyrimidine and purine nucleosides were synthesized and evaluated for anti-HIV-1 activity in human peripheral blood mononuclear (PBM) cells. The key interme
J Med Chem. 1993 Jan 22;36(2):280-7. Unique Identifier : AIDSLINE MED/93140132
Morvan F; Porumb H; Degols G; Lefebvre I; Pompon A; Sproat BS; Rayner B; Malvy C; Lebleu B; Imbach JL; Laboratoire de Chimie Bio-Organique, URA 488 du CNRS, Universite; de Montpellier II, France.
12-Mer analogues, representative of seven different classes of structurally modified oligonucleotides and complementary to the same target, have been compared for their binding affinity for both single-stranded DNA and RNA, resistance to hydrolysis by nucleases in culture medium (RPMI 1640 + 10% inactivated fetal calf
JAMA. 1993 Feb 10;269(6):770-5. Unique Identifier : AIDSLINE MED/93140231
Tappero JW; Mohle-Boetani J; Koehler JE; Swaminathan B; Berger TG; LeBoit PE; Smith LL; Wenger JD; Pinner RW; Kemper CA; et al; Department of Dermatology, University of California, San; Francisco.
OBJECTIVE--To determine environmental risk factors for bacillary angiomatosis-bacillary peliosis (BAP), and to confirm infection with Rochalimaea species. DESIGN--Case-control study. SETTING--Community and university hospitals and clinics. PATIENTS--Case patients (N = 48) had biopsy-confirmed BAP. Controls (N = 94) we
Sheldon M; Ratnasabapathy R; Hernandez N; Cold Spring Harbor Laboratory, New York 11724.
The inducer of short transcripts, or IST, is an unusual transcriptional element located downstream of the human immunodeficiency virus type 1 (HIV-1) promoter. IST activates HIV-1 transcription, but the resulting RNAs are short and end at approximately position +59. IST, therefore, appears to promote the formation of
Dominguez I; Sanz L; Arenzana-Seisdedos F; Diaz-Meco MT; Virelizier JL; Moscat J; Centro de Biologia Molecular UAM-CSIC, Madrid, Spain.
Nuclear factor kappa B (NF-kappa B) plays a critical role in the regulation of a large variety of cellular genes. However, the mechanism whereby this nuclear factor is activated remains to be determined. In this report, we present evidence that in oocytes from Xenopus laevis, (i) ras p21- and phospholipase C (PLC)-med
Nucl Med Commun. 1993 Jan;14(1):8-11. Unique Identifier : AIDSLINE MED/93141153
O'Doherty MJ; Thomas SH; Page CJ; Blower PJ; Bateman NT; Nunan TO; Department of Nuclear Medicine, St. Thomas' Hospital, London, UK.
The pulmonary deposition of nebulized pentamidine (300 mg, Respirgard II nebulizer) was measured in seven human immunodeficiency virus (HIV)-positive men using a new radiopharmaceutical, 123I-iodopentamidine. Mean total pulmonary deposition was 15.3 mg or 5.1% of the initial nebulizer dose. Further studies in two of t
Crowe AJ; Hayman MJ; Department of Microbiology, State University of New York, Stony; Brook 11794.
The transforming gene product of the S13 avian erythroblastosis virus, env-sea, is a member of the growth factor receptor class of tyrosine kinases. The env-sea precursor protein gp155env-sea is proteolytically processed into the mature cleavage products gp85env-sea and gp70env-sea which are subsequently terminally gl
S Afr Med J. 1993 Jan;83(1):36-9. Unique Identifier : AIDSLINE MED/93142133
Tshibangu NN; Epidemiology Unit, Department of Health and Social Services,; Mmabatho, Bophuthatswana.
To assess the degree of HIV endemicity and the extent of its penetration into the general population in Bophuthatswana, a sentinel network of all the 11 hospitals and 3 prisons in the country was established in 1987. In addition, a population seroprevalence study was conducted in 1989. Between 5 January 1987 and 31 De
Tidsskr Nor Laegeforen. 1993 Jan 10;113(1):18-22. Unique Identifier : AIDSLINE MED/93142210
Heier HE; Blodbank og immunologisk avdeling, Ulleval sykehus, Oslo.
In Norway self-sufficiency has been achieved with regard to all major blood products, despite a relatively low number of blood donations. There is good balance in the consumption of the various products. The total consumption of erythrocytes has gone down only slightly since pre-HI
Tidsskr Nor Laegeforen. 1993 Jan 10;113(1):24-6. Unique Identifier : AIDSLINE MED/93142212
Aarseth S; Vatn S; Aarseth HP; Bedriftshelsetjenesten, Sentralsykehuset, Akershus, Nordbyhagen.
We used a questionnaire to study the working situation of physicians in two large Norwegian hospitals. During the last six months 40% of the doctors reported one or more episodes of exposure to blood when transfer of infectious agents such as hepatitis B-virus or HIV would have been possible. The fact that so many doc
Kleinman S; Swanson P; Allain JP; Lee H; American Red Cross Blood Services, Los Angeles-Orange Counties; Region, California.
To determine the transmissibility of human T-lymphotropic virus types I and II (HTLV-I and HTLV-II) via transfusion, persons who, from 1983 to 1989, received blood components donated by persons who subsequently tested anti-HTLV-I-positive were evaluated. It was found that 16 (30%) of 54 evaluable recipients of transfu
Ragazzoni A; Grippo A; Ghidini P; Schiavone V; Lolli F; Mazzotta F; Mecocci L; Pinto F; Department of Neurological and Psychiatric Science, University of; Florence, Italy.
EEGs, brainstem auditory evoked potentials (BAEPs) and auditory event-related potentials (ERPs) were recorded from 33 individuals infected with the human immunodeficiency virus, type 1 (HIV1+ patients: 13 CDC Class II or III; 20 Class IV). All were neurologically asymptomatic, non-demented, and had a past history of i
Oechsner M; Moller AA; Zaudig M; Max Planck Institute for Psychiatry, Psychiatric Clinic, Munich,; Germany.
Progressive cognitive impairment in human immunodeficiency virus (HIV) infection, called acquired immunodeficiency syndrome (AIDS) dementia complex (ADC), significantly influences the social prognosis of afflicted patients. The frequency and character in different stages of the inf
Am J Gastroenterol. 1993 Feb;88(2):303-6. Unique Identifier : AIDSLINE MED/93142760
Meyerson S; Desai TK; Polidori G; Raval MF; Ehrinpreis MN; Department of Medicine, Wayne State University, Harper Hospital,; Detroit, Michigan.
Idiopathic intussusception in adults is rare. In tropical climates, enteric infection is causally implicated. Three cases of intussusception in AIDS patients have been reported, two of which were associated with enteric infection. We report the fourth case of ileocolonic intussusception in an AIDS patient in whom lymp
Am J Pathol. 1993 Jan;142(1):221-30. Unique Identifier : AIDSLINE MED/93142847
Shoeman RL; Sachse C; Honer B; Mothes E; Kaufmann M; Traub P; Max-Planck-Institut fur Zellbiologie, Ladenburg, Federal; Republic of Germany.
HeLa cell actin was cleaved by human immunodeficiency virus type 1 protease when in its soluble, globular form (G-actin). No cleavage of the polymerized, filamentous form of actin (F-actin) was observed when examined by denaturing gel electrophoresis; however, electron microscopy revealed a low level of cleavage of F-
Am J Pathol. 1993 Jan;142(1):25-31. Unique Identifier : AIDSLINE MED/93142851
Wu TC; Kanayama MD; Hruban RH; Whitehead W; Raj NB; Department of Pathology, Johns Hopkins Medical Institution,; Baltimore, Maryland.
The pathogenesis of the neurologic abnormalities associated with the acquired immune deficiency syndrome (AIDS) is poorly understood. Although human immunodeficiency virus type 1 (HIV-1) transcripts have been detected in endothelial cells and macrophages of the central nervous system in patients with AIDS, infection o
The incidence of the autoimmunodeficiency syndrome (AIDS) is rising at an alarming rate. Usually, the first clue to human immunodeficiency virus (HIV) disease is an infection of the skin. The author describes a number of fungal, viral, and bacterial infections seen in HIV-infected patients and names the most effective
Blood. 1993 Jan 1;81(1):166-76. Unique Identifier : AIDSLINE MED/93112950
Ballerini P; Gaidano G; Gong JZ; Tassi V; Saglio G; Knowles DM; Dalla-Favera R; Department of Pathology, College of Physicians & Surgeons,; Columbia University, New York, NY 10032.
Non-Hodgkin s lymphoma (NHL) develops in about 5% to 10% of acquired immunodeficiency syndrome (AIDS) patients. The vast majority of AIDS-NHL are clinically aggressive B-cell NHL that are histologically classified as small noncleaved cell lymphoma (SNCCL), large cell immunoblastic plasmacytoid lymphoma (LC-IBPL), and
Cancer Res. 1993 Jan 15;53(2):429-37. Unique Identifier : AIDSLINE MED/93113609
Aida Y; Okada K; Amanuma H; Laboratory of Gene Technology and Safety, Tsukuba Life Science; Center, Institute of Physical and Chemical Research (RIKEN),; Ibaraki, Japan.
The phenotype and ontogeny of cells carrying the tumor-associated antigen (TAA), identified in tumors of cattle with enzootic bovine leukosis (EBL) by use of the monoclonal antibody (MAb) c143, were analyzed by flow cytometry and immunohistochemistry. The TAA recognized by the c143 MAb (c143 TAA) was mainly expressed
Markowitz RB; Thompson HC; Mueller JF; Cohen JA; Dynan WS; Department of Chemistry and Biochemistry, University of Colorado,; Boulder 80309-0215.
BK virus (BKV) and JC virus (JCV) are present within the renal system of most adults. Reactivation may be linked to immunodeficiency, since many of the extant virus strains have been isolated from urine or kidney tissue of patients who were receiving immunosuppressive therapy or who had disorders of the immune system.
Carr A; Swanson C; Penny R; Cooper DA; Centre for Immunology, St. Vincent's Hospital, Sydney, Australia.
A group of clinical, immunologic, and virologic variables was examined to determine if any predicted the development of hypersensitivity to trimethoprim-sulfamethoxazole (TMP-SMZ) during treatment of Pneumocystis carinii pneumonia in patients with human immunodeficiency virus (HIV) infection. Hypersensitivity occurred
Sa'Adu A; Thomson BJ; Bountiff L; Webster AD; Immune Deficiency Research Group, Clinical Research Centre,; Harrow, Middlesex, UK.
DNA of circulating lymphocytes obtained from 17 patients with common variable immunodeficiency (CVID) was tested for the presence of HIV-1 sequences, using a variety of primers complementary to conserved regions of HIV-1 genomes. None of the patients was positive. The DNA from 12 CVID patients was tested for the pre
Ikeda K; Okazaki R; Inoue D; Ogata E; Matsumoto T; Fourth Department of Internal Medicine, University of Tokyo; School of Medicine, Japan.
Human T-cell leukemia virus type I (HTLV-I) is the etiologic agent of adult T-cell leukemia (ATL), and hypercalcemia frequently associated with ATL is mediated by parathyroid hormone-related peptide (PTHRP). The present study was undertaken to clarify the role of cAMP second messenger system in the regulation of human
Cello JP; University of California, San Francisco.
A 31-year-old man was hospitalized for evaluation of chronic diarrhea accompanied by profound dehydration, abdominal pain, nausea, vomiting, and low-grade fever. He had been identified as hepatitis B surface antigen-positive in 1983 and HIV antibody-positive two years later. In 1987, after a diagnosis of Pneumocystis
J Immunol. 1993 Jan 15;150(2):625-34. Unique Identifier : AIDSLINE MED/93123765
Butera ST; Roberts BD; Folks TM; Retrovirus Diseases Branch, Centers for Disease Control, Atlanta,; GA 30333.
Using the CD4+ model of chronic HIV-1 infection, OM-10.1, we investigated the influence of TNF-alpha regulatory networks on induced viral expression. Previously, OM-10.1 cultures were characterized to respond to exogenous TNF-alpha, as nearly 100% of the cells were activated to express HIV-1 within 24 h. In this study
Talarico CL; Phelps WC; Biron KK; Division of Virology, Wellcome Research Laboratories, Research; Triangle Park, North Carolina 27709.
Patients with AIDS often experience recurrent infections with varicella-zoster virus (VZV) requiring repeated or prolonged treatment with acyclovir (ACV), which may lead to the development of ACV resistance. The ACV resistance of isolates recovered from such patients is associat
Willems L; Thienpont E; Kerkhofs P; Burny A; Mammerickx M; Kettmann R; Faculte des Sciences Agronomiques, Gembloux, Belgium.
Intradermal injection of a cloned bovine leukemia virus (BLV) provirus (pV344) into sheep allowed direct evaluation of intrastrain variability. A sheep was injected with pV344 DNA mixed with DEAE-dextran and became persistently infected with BLV strain 344. After 18 months, DNA was extracted from peripheral blood leuk
Bowles NE; Damay P; Spahr PF; Department of Molecular Biology, University of Geneva,; Switzerland.
It has been widely documented that the nucleocapsid protein p12 (NC) of Rous sarcoma virus (RSV) has a role in the encapsidation and maturation of the virus genomic RNA during particle formation, and particularly important appear to be the Cys-His motifs of this protein. Since some retroviruses only have one such moti
Lang SM; Weeger M; Stahl-Hennig C; Coulibaly C; Hunsmann G; Muller J; Muller-Hermelink H; Fuchs D; Wachter H; Daniel MM; et al; Institut fur Klinische und Molekulare Virologie der Universitat; Erlangen-Nurnberg, Erlangen, Germany.
The importance of the vpr gene for simian immunodeficiency virus (SIV) replication, persistence, and disease progression was examined by using the infectious pathogenic molecular clone called SIVmac239. The ATG start codon of the vpr gene was converted to TTG by site-specific mutagenesis. The constructed Vpr- mutant v
Murine AIDS (MAIDS) is induced by a replication-defective virus (BM5d). In susceptible mice (C57BL/6J), inoculation with LP-BM5 murine leukemia virus, which consists of the BM5d virus and replication-competent B-tropic ecotropic (BM5e) and milk cell focus-inducing (BM5-MCF) helper viruses results in the polyclonal pro
Owens RA; Weitzman MD; Kyostio SR; Carter BJ; Laboratory of Molecular and Cellular Biology, National Institute; of Diabetes and Digestive and Kidney Diseases, Bethesda, Maryland; 20892.
The Rep78 and Rep68 proteins of adeno-associated virus (AAV) bind to the AAV terminal repeat hairpin DNA and are required for viral replication. We have expressed a series of mutant rep genes from the human immunodeficiency virus type 1 long terminal repeat promoter in human 293 cells and in an in vitro transcription-
Med Clin North Am. 1993 Jan;77(1):1-23. Unique Identifier : AIDSLINE MED/93124980
Berger JR; Levy RM; Department of Neurology, University of Miami School of Medicine,; Florida.
The physician caring for HIV-1-infected patients must have a good working knowledge of the broad spectrum of neurologic diseases that occur in association with this infection. As with any other neurologic disorder, the site of the neuraxis that is affected must be properly identified. In HIV-1-infected persons, more t
Med J Aust. 1993 Jan 18;158(2):104-8. Unique Identifier : AIDSLINE MED/93125279
Brew BJ; Currie JN; National Centre in HIV Epidemiology and Clinical Research, St; Vincent's Hospital, Darlinghurst, NSW.
Early neurological complications present an opportunity to make an early diagnosis of HIV infection. Patients may present with subtle symptoms and signs of neurological disease, but many HIV-related complications are readily treated if they are correctly diagnosed. As there are also neurological side effects of anti-H
Med J Aust. 1993 Jan 18;158(2):111-3. Unique Identifier : AIDSLINE MED/93125281
McCluskey PJ; Laboratory of Ocular Immunology, School of Pathology, University; of New South Wales, Kensington.
As in other organ systems, there are ocular disorders largely unique to HIV such as Kaposi s sarcoma and cytomegalovirus retinitis. Other syndromes, such as acute retinal necrosis, although not unique to HIV infection, are well recognised in this group of patients and are sufficien
Jones AC; Freedman PD; Phelan JA; Baughman RA; Kerpel SM; Department of Oral Diagnostic Sciences, University of Florida; College of Dentistry, Gainesville.
Cytomegalovirus is responsible for a significant percentage of asymptomatic viral infections worldwide. Although virtually any cell or organ may be infected, involvement of the oral cavity is uncommon. Only nine well-documented examples of intraoral cytomegalovirus infections were
Proc Natl Acad Sci U S A. 1993 Jan 1;90(1):352-6. Unique Identifier : AIDSLINE MED/93126375
Rochford R; Hobbs MV; Garnier JL; Cooper NR; Cannon MJ; Department of Immunology, Scripps Research Institute, La Jolla,; CA 92037.
The Epstein-Barr virus (EBV)-associated B-cell lymphoproliferative disorders that arise in immunosuppressed individuals are considered to resemble EBV-transformed in vitro lymphoblastoid cell lines (LCLs) with a mature activated B-cell phenotype. In this study of human lymphoproliferative disorders in the severe combi
Rouleau M; Senik A; Leroy E; Vernant JP; Laboratoire d'Immunologie Cellulaire et de Transplantation,; I.R.S.C., Villejuif, France.
T cells play an important role in protective immunity against tuberculosis. As patients are not reimmunized with BCG after BMT, the question arises as to whether PPD-specific memory T cells are transferred from the marrow donor to the recipient and persist in the long-term. We studied long-term survivors of non-T cell
Am J Med. 1993 Jan;94(1):93-9. Unique Identifier : AIDSLINE MED/93128284
Shuster E; Veterans Affairs Medical Center, Philadelphia, PA.
A year ago, the New Jersey case of William H. Behringer, the surgeon with acquired immunodeficiency syndrome (AIDS), caused health experts to focus on health care workers infected with human immunodeficiency virus (HIV) and to call for new policies and guidelines to protect patients against infection. After a year of
Grefte A; van der Giessen M; van Son W; The TH; Department of Clinical Immunology, University of Groningen,; Netherlands.
In 10 of 14 patients with an active cytomegalovirus ( CMV ) infection, distinctive large cells (35-45 microns in diameter) were present in the peripheral blood. Morphologically these cells closely resembled the classic cytomega
Dieterich DT; Kotler DP; Busch DF; Crumpacker C; Du Mond C; Dearmand B; Buhles W; New York University Medical Center, New York.
The efficacy and safety of ganciclovir therapy for cytomegalovirus ( CMV ) colitis in patients with AIDS was examined in a double-blind, placebo-controlled study. Sixty-two patients at four university medical centers were enrol
Proc Natl Acad Sci U S A. 1993 Jan 15;90(2):562-6. Unique Identifier : AIDSLINE MED/93133828
Shirasaka T; Yarchoan R; O'Brien MC; Husson RN; Anderson BD; Kojima E; Shimada T; Broder S; Mitsuya H; Experimental Retrovirology Section, National Heart, Lung and; Blood Institute, National Cancer Institute, Bethesda, MD 20892.
Human immunodeficiency virus type 1 (HIV-1) strains were isolated from nine patients before and after prolonged therapy with either an alternating regimen of 3 -azido-3 -deoxythymidine ( AZT ) and 2 ,3 -dideoxycytidine (
Vet Clin North Am Small Anim Pract. 1993 Jan;23(1):173-91. Unique Identifier : AIDSLINE MED/93134749
Sparger EE; Department of Medicine, University of California, School of; Veterinary Medicine, Davis.
The feline immunodeficiency virus (FIV) is a novel feline retrovirus of the lentivirus subfamily that is known to induce immunodeficiency disorders in experimentally and naturally infected cats. Recent studies have characterized the stages of infection and specific immune deficits associated with FIV infection. Host c
Feng CP; Kulka M; Aurelian L; Department of Pharmacology and Experimental Therapeutics,; University of Maryland, School of Medicine, Baltimore 21201.
Molecular interactions between the herpes simplex virus type 1 (HSV-1) and human immunodeficiency virus (HIV) were investigated in U937 cells. Nonpermissive HSV-1 infection of U937 cells activated HIV as determined in transient expression assays with hybrid constructions containing the HIV-LTR-directed chloramphenicol
We report the characterization of the env gene of a feline immunodeficiency virus isolate from France (FIV Wo). FIV Wo gag and env genes were cloned directly from cat peripheral blood mononuclear cells, using polymerase chain reaction. The env molecular clone was shown to be functi
Biochemistry. 1993 Jan 26;32(3):739-44. Unique Identifier : AIDSLINE MED/93136172
Salazar M; Champoux JJ; Reid BR; Department of Chemistry, University of Washington, Seattle 98195.
We have carried out a solution study of the local conformation in a hybrid-chimeric duplex of the [sequence: see text] type (where r and D represent RNA and DNA). The object of this study was to investigate the sugar conformations at the internal junction in the hybrid-DNA octamer duplex (gccaCTGC). (GCAGTGGC)--where
Blood. 1993 Jan 15;81(2):468-74. Unique Identifier : AIDSLINE MED/93136436
Boyle MJ; Vasak E; Tschuchnigg M; Turner JJ; Sculley T; Penny R; Cooper DA; Tindall B; Sewell WA; Centre for Immunology, St Vincent's Hospital, Sydney, NSW,; Australia.
Epstein-Barr virus (EBV) has been associated with Hodgkin s disease (HD) in up to 50% of cases, but the subtype of EBV involved has only recently been studied. In this report, biopsy samples from 30 patients with HD were assessed for EBV sequences using both the polymerase chain reaction (PCR) and in situ hybridizatio
J Immunol. 1993 Feb 1;150(3):1019-28. Unique Identifier : AIDSLINE MED/93139491
Buhl R; Jaffe HA; Holroyd KJ; Borok Z; Roum JH; Mastrangeli A; Wells FB; Kirby M; Saltini C; Crystal RG; Pulmonary Branch, National Heart, Lung, and Blood Institute,; National Institutes of Health, Bethesda, MD 20892.
After the initial infection with HIV, there is evidence of immune dysfunction despite an apparent normal clinical state. In the context that the lung is a major site affected by opportunistic infection during the progression of this immune dysfunction, and that some components of the immune system are activated during
Bhigjee AI; Bill PL; Wiley CA; Windsor IM; Matthias DA; Amenomori T; Wachsman W; Moorhouse D; Neurology Unit, University of Natal Medical School, Durban, South; Africa.
Peripheral nerve dysfunction (PND) was found in as many as 43% of our patients with human T-cell lymphotropic virus type I (HTLV-I)-associated myelopathy (HAM/TSP). To evaluate the PND further we biopsied the sural nerve in 6 patients. The histological features were varying degrees of demyelination, remyelination, axo
Clifford DB; Buller RS; Mohammed S; Robison L; Storch GA; Department of Neurology, Washington University School of; Medicine, St. Louis, MO 63110.
We used the polymerase chain reaction (PCR) to demonstrate cytomegalovirus ( CMV ) DNA in the CSF of a patient with the CMV radiculomyelopathy syndrome. To investigate the significance of this finding, we also performed PCR for
Am J Gastroenterol. 1993 Feb;88(2):277-8. Unique Identifier : AIDSLINE MED/93142753
Scully LJ; Ryan AE; Department of Medicine, Ottawa Civic Hospital, Ontario, Canada.
Urticaria has been described only rarely in patients with hepatitis A virus infection, although its association with acute hepatitis B virus infection is well recognized. A young male homosexual presented with hepatitis and urticaria, which proved to be an acute hepatitis A virus infection. In one study of a foodborne
Am J Pathol. 1993 Jan;142(1):139-47. Unique Identifier : AIDSLINE MED/93142839
Nakamine H; Masih AS; Okano M; Taguchi Y; Pirruccello SJ; Davis JR; Mahloch ML; Beisel KW; Kleveland K; Sanger WG; et al; Department of Pathology and Microbiology, University of Nebraska; Medical Center, Omaha 68198-3135.
To improve the diagnostic accuracy and understanding of the pathogenesis of lymphoproliferative diseases (LPDs) occurring in immunosuppressed transplant recipients (post-transplantation LPD), clonality of Epstein-Barr virus-induced human LPDs in mice with severe combined immunodeficiency was examined by analyzing: 1)
Am J Pathol. 1993 Jan;142(1):33-8. Unique Identifier : AIDSLINE MED/93142860
Boiocchi M; Dolcetti R; De Re V; Gloghini A; Carbone A; Division of Experimental Oncology, Centro di Riferimento; Oncologico, Aviano (PN), Italy.
The recent detection of clonal episomes of Epstein-Barr virus (EBV) in a significant proportion of Hodgkin s disease (HD) cases has suggested a re-evaluation of the possible pathogenetic role of EBV in the development of the disease. Here we report that in two EBV-positive HD, arisen in human immunodeficiency virus-1-
Blood. 1993 Jan 1;81(1):15-9. Unique Identifier : AIDSLINE MED/93112947
Soubrane C; Tourani JM; Andrieu JM; Visonneau S; Beldjord K; Israel-Biet D; Mouawad R; Bussel J; Weil M; Khayat D; Medical Oncology Laboratory, Salpetriere Hospital, Paris,; France.
A patient with refractory human immunodeficiency virus (HIV)-related immune thrombocytopenic purpura (ITP) was treated with 3G8 (anti-CD16) monoclonal antibody on days 1, 3, and 8 (25, 25, and 50 mg were administered intravenously, respectively). Side effects were those expected after the administration of a xenogenic
Browne MJ; Mayer KH; Chafee SB; Dudley MN; Posner MR; Steinberg SM; Graham KK; Geletko SM; Zinner SH; Denman SL; et al; Brown University AIDS Program, Providence, RI.
2 ,3 -didehydro-3 -deoxythymidine ( d4T ) is a pyrimidine analogue and inhibitor of reverse transcriptase with potent in vitro activity against human immunodeficiency virus (HIV). A phase I trial of d4T was conducted in 41 HIV-infected patients, 12 with
Janoff EN; O'Brien J; Thompson P; Ehret J; Meiklejohn G; Duvall G; Douglas JM Jr; Department of Medicine, VA Medical Center, Minneapolis, MN 55417.
Although invasive pneumococcal infections are common among men infected with human immunodeficiency virus (HIV), the prevalence of pharyngeal colonization with Streptococcus pneumoniae was not significantly different among HIV-infected patients (8 [14%] of 56) and HIV-seronegative men (9 [9%] of 99) attending a sexual
van der Horst FA; van der Marel A; den Ottolander GJ; Kluin-Nelemans HC; Department of Hematology, University Hospital Leiden, The; Netherlands.
Patients with hairy cell leukemia (HCL) are prone to opportunistic infections, which suggests an impaired T-cell functioning. To investigate a possible mechanism of such an impairment, we determined the numbers of naive and memory T cells by measuring the expression of CD45R0 on CD4+ and CD8+ T cells in 23 HCL patient
Lancet. 1993 Jan 9;341(8837):65-71. Unique Identifier : AIDSLINE MED/93116511
Starzl TE; Fung J; Tzakis A; Todo S; Demetris AJ; Marino IR; Doyle H; Zeevi A; Warty V; Michaels M; et al; Pittsburgh Transplant Institute, Pennsylvania.
Our ability to control both the cellular and humoral components of xenograft rejection in laboratory experiments, together with an organ shortage that has placed limits on clinical transplantation services, prompted us to undertake a liver transplantation from a baboon to a 35-year-old man with B virus-associated chro
Sleasman JW; Hemenway C; Klein AS; Barrett DJ; Department of Pediatrics, University of Florida College of; Medicine, Gainesville.
OBJECTIVE--To determine if corticosteroids administered in addition to antimicrobials improve survival in children with acquired immunodeficiency syndrome and severe Pneumocystis carinii pneumonia (PCP). DESIGN--Before-after, nonrandomized, case-comparison study. SETTING--Pediatric intensive care unit of a tertiary ca
Chopra RK; Raj NB; Scally JP; Donnenberg AD; Adler WH; Saah AJ; Margolick JB; Department of Environmental Health Sciences, School of Hygiene; and Public Health, Johns Hopkins University, Baltimore, MD 21205.
Previous studies have shown that exogenous IL-2 does not correct the reduction in phytohaemagglutinin (PHA)-induced proliferation of lymphocytes from HIV-1 infected (HIV+) individuals. We investigated the mechanism of this reduction to determine if reduced expression o
J Immunol. 1993 Jan 15;150(2):331-41. Unique Identifier : AIDSLINE MED/93123732
Boehncke WH; Takeshita T; Pendleton CD; Houghten RA; Sadegh-Nasseri S; Racioppi L; Berzofsky JA; Germain RN; Lymphocyte Biology Section, National Institute of Allergy and; Infectious Diseases, NIH, Bethesda, MD 20892.
Previous studies on the role of specific residues of the peptide or MHC molecule in Ag presentation have revealed the sensitivity of this complex system to even small changes in structure. In our study, we have analyzed the effect of amino acid substitution in a major CD4+ T cell determinant (T1) of HIV-1 gp160 on bin
Rabeneck L; Crane MM; Risser JM; Lacke CE; Wray NP; Department of Medicine, Baylor College of Medicine, Houston,; Texas.
OBJECTIVE: To develop a simple clinical staging system based on CD4 count and clinical variables that predicts progression to AIDS in HIV-infected non-AIDS patients. DESIGN: Retrospective cohort study. SETTING: A primary care outpatient clinic for HIV-infected patients at a VA Medical Center. PATIENTS: One hundred sev
Whitt JK; Hooper SR; Tennison MB; Robertson WT; Gold SH; Burchinal M; Wells R; McMillan C; Whaley RA; Combest J; et al; Department of Psychiatry, University of North Carolina School of; Medicine, Chapel Hill 27599.
Efforts to detect subtle but objective neuropsychologic deficits could clarify the early involvement of the central nervous system and the progression of human immunodeficiency virus (HIV) infection in older children and young adolescents. Baseline examinations of 63 children and adolescents with hemophilia were condu
Bastian I; Gardner J; Webb D; Gardner I; Menzies School of Health Research, Casuarina, Darwin, Northern; Territory, Australia.
A human T-lymphotropic virus type I (HTLV-I) strain was isolated in a CD4+ T-lymphocyte culture established from a healthy seropositive Australian Aboriginal. This isolate, identified as HTLV-IMSHR-1, was detected by immunofluorescence with monoclonal antibodies, by the presence of gag-encoded protein p24 in the cultu
N Engl J Med. 1993 Feb 4;328(5):327-35. Unique Identifier : AIDSLINE MED/93125629
Pantaleo G; Graziosi C; Fauci AS; Laboratory of Immunoregulation, National Institute of Allergy and; Infectious Diseases, National Institutes of Health, Bethesda, MD; 20892.
Am J Med. 1993 Jan;94(1):41-8. Unique Identifier : AIDSLINE MED/93128275
Gascon P; Sathe SS; Rameshwar P; Division of Hematology, University of Medicine and Dentistry of; New Jersey-New Jersey Medical School, Newark 07103.
PURPOSE: Anemia is an important negative predictor for survival with disseminated Mycobacterium avium complex (MAC) infection in the acquired immunodeficiency syndrome (AIDS). We analyzed the differences in AIDS patients with and without MAC infection with regard to anemia, severity of human immunodeficiency virus (HI
JAMA. 1993 Feb 3;269(5):622-6. Unique Identifier : AIDSLINE MED/93132878
Blatt SP; Lucey CR; Butzin CA; Hendrix CW; Lucey DR; Department of Medicine, Wilford Hall Medical Center, Lackland; AFB, TX 78236-5300.
OBJECTIVE--To determine whether the total lymphocyte count (TLC) accurately predicts a low absolute CD4+ T-cell count and CD4+ percentage in persons infected with human immunodeficiency virus (HIV). DESIGN--Retrospective analysis of data collected in the US Air Force HIV Natural History Study. SETTING--Military medica
N Engl J Med. 1993 Feb 11;328(6):373-9. Unique Identifier : AIDSLINE MED/93133228
Smith DK; Neal JJ; Holmberg SD; Division of HIV/AIDS, Centers for Disease Control and Prevention,; Atlanta, GA 30333.
BACKGROUND. The clinical and public health importance of recent reports of patients with CD4+ T-lymphocytopenia without human immunodeficiency virus (HIV) infection is unclear. We conducted investigations to determine the demographic, clinical, and immunologic features of patients with idiopathic CD4+ T-lymphocytopeni
N Engl J Med. 1993 Feb 11;328(6):380-5. Unique Identifier : AIDSLINE MED/93133229
Ho DD; Cao Y; Zhu T; Farthing C; Wang N; Gu G; Schooley RT; Daar ES; Aaron Diamond AIDS Research Center, New York.
BACKGROUND. The human immunodeficiency virus (HIV), the etiologic agent of the acquired immunodeficiency syndrome (AIDS), infects and depletes CD4+ T lymphocytes. Recently, patients have been described with profound CD4+ T-lymphocytopenia but without evident HIV infection, a condition now termed idiopathic CD4+ T-lymp
N Engl J Med. 1993 Feb 11;328(6):386-92. Unique Identifier : AIDSLINE MED/93133230
Spira TJ; Jones BM; Nicholson JK; Lal RB; Rowe T; Mawle AC; Lauter CB; Shulman JA; Monson RA; Immunology Branch, Centers for Disease Control and Prevention,; Atlanta, GA 30333.
BACKGROUND. Although patients with idiopathic CD4+ T-lymphocytopenia and serious opportunistic infections have been described previously, the clinical and immunologic features of this condition have not been well defined. METHODS. We studied in detail five patients with idiopathic CD4+ T-lymphocytopenia. The studies i
N Engl J Med. 1993 Feb 11;328(6):393-8. Unique Identifier : AIDSLINE MED/93133231
Duncan RA; von Reyn CF; Alliegro GM; Toossi Z; Sugar AM; Levitz SM; Evans Memorial Department of Clinical Research, Boston City; Hospital, MA 02118.
BACKGROUND AND METHODS. We describe four patients without major risk factors for human immunodeficiency virus (HIV) infection, each of whom presented with severe opportunistic infections and was found to have idiopathic CD4+ T-lymphocytopenia. We performed assays to detect the presence of retroviruses and undertook im
Genetic engineering technology is a rapidly developing field that has almost unlimited potential for the production of safer and more effective vaccines, therapeutic proteins, and more specific and sensitive diagnostic reagents. Although applications in veterinary medicine of genetically engineered products are presen
Cancer. 1993 Jan 15;71(2):402-6. Unique Identifier : AIDSLINE MED/93137187
Maiman M; Fruchter RG; Guy L; Cuthill S; Levine P; Serur E; Department of Obstetrics and Gynecology, SUNY-Health Science; Center, Brooklyn 11203.
BACKGROUND AND METHODS. To determine the relationship between cervical cancer and human immunodeficiency virus (HIV) infection, 84 women of known HIV status with invasive cervical carcinoma were assessed. Sixteen of 84 patients (19%) were HIV seropositive. The disease characteristics, recurrence rates, survival rates,
Hausner MA; Giorgi JV; Plaeger-Marshall S; Department of Medicine, University of California, School of; Medicine, Los Angeles.
CD8 T lymphocytes are an important component of the host immune response to human immunodeficiency virus (HIV). To characterize CD8 cell function, we have studied the in vitro phenomenon of CD8 cell-mediated inhibition of HIV replication from autologous, naturally infected CD4 cells. We describe here a reproducible as
Meerloo T; Sheikh MA; Bloem AC; de Ronde A; Schutten M; van Els CA; Roholl PJ; Joling P; Goudsmit J; Schuurman HJ; Department of Pathology, University Hospital, Utrecht, The; Netherlands.
Human immunodeficiency virus type 1 (HIV-1)-infected H9 and blood mononuclear cells (MNCs) were studied by immunogold electron microscopy for the presence of HIV-1 gag p24 protein, env gp41 and gp120 proteins, and host cell molecules CD4, CD11a, CD25, CD54, CD63, HLA class I and HLA-DR. Uninfected H9 cells and MNC mem
J Med Virol. 1993 Jan;39(1):28-32. Unique Identifier : AIDSLINE MED/93139794
Goubau P; Desmyter J; Swanson P; Reynders M; Shih J; Surmont I; Kazadi K; Lee H; Department of Microbiology, Rega Institute, Leuven, Belgium.
Antibodies to HTLV were determined in 4,630 black African individuals from Zaire , Ghana and South Africa ; 185 (4%) were confirmed as seropositive. Seroprevalance was 0.2% in a group of South African women, 0
JAMA. 1993 Feb 10;269(6):729-30. Unique Identifier : AIDSLINE MED/93140212
The Centers for Disease Control and Prevention (CDC) has revised the classification system for HIV infection to emphasize the clinical importance of the CD4+ T-lymphocyte count in the categorization of HIV-related clinical conditions. This classification system replaces the system published by CDC in 1986 and is prima
Mayeux R; Stern Y; Tang MX; Todak G; Marder K; Sano M; Richards M; Stein Z; Ehrhardt AA; Gorman JM; HIV Center for Clinical and Behavioral Studies, New York State; Psychiatric Institute, New York.
We obtained data from 111 gay men who entered a longitudinal study of the natural history of human immunodeficiency virus (HIV) without clinical evidence of acquired immunodeficiency syndrome (AIDS), and examined them regularly over a 36-month period. Using a Cox proportional-hazard regression model to compare cumulat
Siakkou H; Jahn S; Kienzle N; Ulrich R; Grotzinger C; Schneider T; Kohleisen B; Pauli G; Spohn R; Jung G; et al; Institute fur Virologie, Medizinischen Fakultat (Charite) der; Humboldt-Universitat, Berlin, Federal Republic of Germany.
A panel of newly isolated murine monoclonal antibodies is described which are specific for the Nef protein of the human immunodeficiency virus type 1 (HIV-1). Epitope mapping using recombinant Nef-related proteins, synthetic peptides and lipopeptides showed 3 independent antigenic determinants located within the regio
Manca F; Habeshaw JA; Dalgleish AG; Fenoglio D; Li Pira G; Sercarz EE; Department of Immunology, University of Genoa, San Martino; Hospital, Italy.
Human T helper cells can discriminate among strain variants of HIV gp120 because of T cell clones recognizing non-conserved regions, as demonstrated with T cells from HIV-infected individuals and vaccinated volunteers and with primary T cell lines and clones obtained by in vitro immunization. To obtain a better defini
Hart TK; Klinkner AM; Ventre J; Bugelski PJ; Department of Toxicology, SmithKline Beecham Pharmaceuticals,; King of Prussia, Pennsylvania 19406.
The surface of HIV-1, like that of other retroviruses, is studied with virally encoded glycoproteins which appear ultrastructurally as electron-dense spikes or knobs. The glycoprotein that forms the spike structure, gp120, is non-covalently bound to the transmembrane glycoprotein gp41. Mature HIV-1 virions do not have
J Immunol. 1993 Jan 15;150(2):635-43. Unique Identifier : AIDSLINE MED/93123766
Gorny MK; Xu JY; Karwowska S; Buchbinder A; Zolla-Pazner S; Department of Pathology, NYU Medical School, NY 10016.
HIV infection induces antibodies that mediate neutralization of cell-free virus and may protect against viral infection. Neutralizing human mAb that bind to the third hypervariable domain (V3) of gp120 have been generated from PBL of HIV-seropositive subjects. Twelve such mAb recognize 9 different epitopes spanning an
Gillespie GM; Marino R; Oral Health Program, Pan American Health Organization, World; Health Organization, Washington, DC.
This paper presents a preliminary approach to the study of the oral manifestations of HIV infections in the region of the Americans. A general description of the lesions encountered is provided together with a review of the prevalence of the different manifestations in some countries of the Americas. Oral candidiasis
Pancino G; Chappey C; Saurin W; Sonigo P; Genetique des virus (ICGM-CNRS UPR415), Institut Cochin de; Genetique Moleculaire, Paris, France.
In order to map linear B epitopes in feline immunodeficiency virus (FIV) envelope glycoproteins (Env), a random library of FIV Env polypeptides fused to beta-galactosidase and expressed in Escherichia coli was screened by using sera from experimentally FIV-infected cats. We mapped five antibody-binding domains in the
Buseyne F; McChesney M; Porrot F; Kovarik S; Guy B; Riviere Y; Unite de Virologie et Immunologie Cellulaire, URA CNRS 1157,; Institut Pasteur, Paris, France.
Virus-specific cytotoxic T lymphocytes (CTL) may be an important host defense mechanism in the control of virus replication in persons infected with human immunodeficiency virus type 1 (HIV-1). Cytotoxic T-cell lines generated by nonspecific stimulation with anti-CD3 monoclonal antibodies and interleukin 2 were used t
Moore JP; Ho DD; Aaron Diamond AIDS Research Center, New York University School of; Medicine, New York, New York 10016.
We have used an indirect-capture enzyme-linked immunosorbent assay to quantitate the reactivity of sera from human immunodeficiency virus type 1 (HIV-1)-infected humans with native recombinant gp120 (HIV-1 IIIB or SF-2) or with the gp120 molecule (IIIB or SF-2) denatured by being boiled in the presence of dithiothreit
Hariharan K; Nara PL; Caralli VM; Norton FL; Haigwood N; Kang CY; IDEC Pharmaceuticals Corporation, La Jolla, California 92037.
This study was undertaken to analyze the specificity and neutralizing properties of cross-reactive anti-gp120 antibodies (Abs) in the sera of two human immunodeficiency virus (HIV)-infected asymptomatic individuals. Two panels of murine monoclonal anti-idiotype Abs (anti-id MAbs) were established against cross-reactiv
Durham TM; Hodges ED; Swindels S; Green JG; University of Nebraska Medical Center College of Dentistry,; Omaha.
Neurologic manifestations of human immunodeficiency virus disease have been well documented and include peripheral neuropathy of the facial nerve. HIV-related peripheral facial nerve paralysis may be of predictive value in endemic populations, and it may be associated
Proc Natl Acad Sci U S A. 1993 Jan 1;90(1):158-62. Unique Identifier : AIDSLINE MED/93126333
Lenard J; Rabson A; Vanderoef R; Department of Physiology and Biophysics, Robert Wood Johnson; Medical School, University of Medicine and Dentistry of New; Jersey, Piscataway 08854-5635.
The mechanism of the antiviral activity of hypericin was characterized and compared with that of rose bengal. Both compounds inactivate enveloped (but not unenveloped) viruses upon illumination by visible light. Human immunodeficiency and vesicular stomatitis viruses were photodynamically inactivated by both dyes at n
Proc Natl Acad Sci U S A. 1993 Jan 1;90(1):25-9. Unique Identifier : AIDSLINE MED/93126353
Mohri H; Singh MK; Ching WT; Ho DD; Aaron Diamond AIDS Research Center, Department of Medicine and; Microbiology, New York University School of Medicine, NY 10016.
A nonselective ex vivo assay was used to directly detect and quantify zidovudine ( AZT )-resistant human immunodeficiency virus type 1 (HIV-1) in the blood of treated and untreated patients. In contrast to previous reports, drug-resistant virus was dete
Smith MS; Koerber KL; Pagano JS; Lineberger Comprehensive Cancer Center, School of Medicine,; University of North Carolina, Chapel Hill.
The emergence of zidovudine (3 -azido-2 ,3 -deoxythymidine)-resistant strains of human immunodeficiency virus type 1 (HIV-1) from AIDS patients treated with zidovudine has been linked to six amino acid substitutions localized within the viral polymerase gene. Here, in 2 patients, three resistance mutations were detect
Nature. 1993 Jan 14;361(6408):186-7. Unique Identifier : AIDSLINE MED/93133326
Malmqvist M; Pharmacia Biosensor AB, Uppsala, Sweden.
Fundamental information that enhances our understanding of biospecific interactions can be obtained using a new analytical system based on biosensor technology. The functional characteristics of biospecific interaction, such as kinetics, affinity and binding position, are examined by label-free analysis of proteins in
Tumas KM; Poszgay JM; Avidan N; Ksiazek SJ; Overmoyer B; Blank KJ; Prystowsky MB; Department of Pathology, University of Pennsylvania, Philadelphia; 19104-6142.
The murine leukemia virus, E-55+ virus, induces a thymic lymphoma/leukemia in 100% of BALB.K mice infected as adults after a latent period of 4 months or more (Pozsgay et al., Virology 173, 330-334, 1989). Two molecular clones of virus designated E-55+ and E-55- based on their ability to encode the E-55 epitope detect
Sedlacek J; Fabry M; Coward JE; Horejsi M; Strop P; Luftig RB; Department of Gene Manipulation, Czechoslovak Academy of; Sciences, Prague.
We have characterized the structure and infectivity of an avian retrovirus, myeloblastosis associated virus (MAV), containing a genetically altered proteinase (PR). A site-directed mutant of MAV-PR that shows an increased proteolytic activity in vitro (about 20 times higher kcat/Km) as a consequence of substituting fi
Blood. 1993 Jan 15;81(2):412-8. Unique Identifier : AIDSLINE MED/93136428
Troisi CL; Hollinger FB; Hoots WK; Contant C; Gill J; Ragni M; Parmley R; Sexauer C; Gomperts E; Buchanan G; et al; Baylor College of Medicine, Houston, TX 77030.
Hemophilia A and B patients seen at nine US regional treatment centers were tested for serologic markers of hepatitis B virus (HBV), hepatitis C virus (HCV), and hepatitis delta virus (HDV) during 1987 and 1988. Because human immunodeficiency virus (HIV) infection, a potentially confounding variable, was present in 53
Crit Care Clin. 1993 Jan;9(1):153-76. Unique Identifier : AIDSLINE MED/93137121
Torres RA; Franke-Ruta G; Barr MR; AIDS Center, St. Vincent's Hospital and Medical Center, New York,; New York.
The advent of antiviral therapy for HIV infection and anti-infective agents for the treatment and prophylaxis of Pneumocystis carinii pneumonia has had a significant impact on the survival and quality of life of persons with AIDS and associated conditions. This article discusses zidovudine and other antiviral therapie
Lassmann H; Schmied M; Vass K; Hickey WF; Research Unit for Experimental Neuropathology, Austrian Academy; of Sciences, Vienna.
Infection of the central nervous (CNS) system by the human immunodeficiency virus (HIV) depends on the migration of infected hematogenous cells into the brain. We thus used quantitative light and electron microscopic immunocytochemistry to study the homing and turnover of bone marrow derived cells in the CNS in radiat
Rao SP; Ogata K; Catanzaro A; Department of Medicine, University of California, San Diego; 92103-8374.
Mycobacterium avium-M. intracellulare is an intracellular pathogen responsible for the highest incidence of disseminated bacterial infection in patients with AIDS. Treatment of the infection is difficult and has been of limited efficacy. Attachment of the organism to macrophages is a critical early step in the establi
Kotani M; Yamamura Y; Tamatani T; Kitamura F; Miyasaka M; Department of Immunology, Tokyo Metropolitan Institute of Medical; Science, Japan.
We describe in this report the production and characterization of monoclonal antibodies (mAb) to the rabbit homologues of CD4, CD5 and CD11a antigens, and their use for phenotypic analysis of rabbit lymphoid cell lines. All the mAbs were produced by immunizing mice with rabbit thymocytes. mAb KEN-4 apparently identifi
J Med Virol. 1993 Jan;39(1):67-74. Unique Identifier : AIDSLINE MED/93139801
Mancini M; Hadchouel M; Tiollais P; Pourcel C; Michel ML; Unite de Recombinaison et Expression Genetique, INSERM U.163,; Institut Pasteur, Paris, France.
As a model for studying possible mechanisms of nonresponse toward hepatitis B surface antigen (HBsAg) in hepatitis B virus (HBV) carriers, we used transgenic (Tg) mice which constitutively express this antigen in the liver from before birth. The mice secrete large amounts of HBsAg particles into the sera without produ
J Med Chem. 1993 Jan 22;36(2):249-55. Unique Identifier : AIDSLINE MED/93140128
Wai JS; Williams TM; Bamberger DL; Fisher TE; Hoffman JM; Hudcosky RJ; MacTough SC; Rooney CS; Saari WS; Thomas CM; et al; Merck Research Laboratories, West Point, Pennsylvania 19486.
In an ongoing effort to develop novel nonnucleoside, specific human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) inhibitors, a series of 3-[(pyridylmethyl)amino]- and 3-[(phenylmethyl)amino]-2-pyridinone derivatives was synthesized and tested for HIV-1 RT inhibitory activity. The more potent compou
Life Sci. 1993;52(3):243-9. Unique Identifier : AIDSLINE MED/93140499
O'Brien JA; Ostovic D; Schorn TW; Smith SJ; Ruffing TL; Siegl PK; Goldman ME; Department of New Lead Pharmacology, Merck Research Laboratories,; West Point, PA 19486.
A rapid method for measuring pyridinone HIV-1 reverse transcriptase inhibitor plasma levels was necessary for identifying potential clinical candidates and for choosing a clinical formulation. Due to its sensitivity to the pyridinones, ability to tolerate extraneous material, and its capability for rapid, high through
Balzarini J; Velazquez S; San-Felix A; Karlsson A; Perez-Perez MJ; Camarasa MJ; De Clercq E; Rega Institute for Medical Research, Katholieke Universiteit; Leuven, Belgium.
The [2 ,5 -bis-O-(tert-butyldimethylsilyl)-beta-D-ribofuranosyl]-3 - spiro-5-(4-amino-1,2-oxathiole-2,2-dioxide) (TSAO) derivatives of N1-methylhypoxanthine with linkage to the TSAO moiety through the N9 or N7 atom of the hypoxanthine ring (designated TSAO-m1Hx and 7-TSAO-m1Hx, respectively) are potent and selective i
Mellors JW; Im GJ; Tramontano E; Winkler SR; Medina DJ; Dutschman GE; Bazmi HZ; Piras G; Gonzalez CJ; Cheng YC; Department of Internal Medicine, University of Pittsburgh Medical; Center, Pennsylvania.
Tetrahydroimidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one and thione (TIBO) derivatives (e.g., R82150) are potent, human immunodeficiency virus-1 (HIV-1)-specific, inhibitors of reverse transcriptase (RT) that are undergoing initial evaluation in clinical trials. Because HIV-1 has become resistant to other RT inhibitors
Biochem Pharmacol. 1993 Jan 7;45(1):223-30. Unique Identifier : AIDSLINE MED/93143757
August EM; Qian HY; Birks EM; Thombre UA; Lin TS; Prusoff WH; Department of Pharmacology, Yale University School of Medicine,; New Haven, CT 06510.
3 -Azido-2 ,3 -dideoxy-5-iodouridine (AzIdUrd) and 3 -azido-2 ,3 -dideoxy-5-bromouridine (AzBdUrd), previously shown to be potent and selective inhibitors of human immunodeficiency virus replication in vitro were minimally toxic to the uninfected human lymphoid cell line H9 (IC50 = 197 and 590 microM, respectively). B
This information is designed to support, not replace, the relationship that exists between you and your doctor.