1993

AIDS at issue : coping with an epidemic. [videorecording]: [New York, N.Y.] : Public Agenda Foundation, c1989 1 videocassette (22 min.) : sd., col. with b&w ; 1/2 in Unique Identifier : AIDSLINE AV/9300256A; (Producer) This program gives voice to the many moral, legal, ethical and economic concerns that the epidemic raises. It presents a broad range of opinions on such issues as AIDS education in the schools, needle-exchange programs, mandatory testing, the rights of people with AIDS, and condom advertising on televisio
AIDS, babies, and children. [videorecording]: [United States : s.n., 1991] 1 videocassette (12 min.) : sd., col. ; 1/2 in. + 1 guide (UCLA AIDS education for health care providers ; module 10) Unique Identifier : AIDSLINE AV/9300214A; Lewis CE; (Producer) Various scenarios depict the problems associated with children and HIV/AIDS. Foster parents, single mothers, and social workers point out the fears and myths about transmission and discuss the difficulties in providing adequate services to children with AIDS.
Women, HIV, and AIDS : speaking out in the U.K. [videorecording]: New York, N.Y : Filmakers Library, [1991] 1 videocassette (52 min.) : sd., col. with b&w ; 1/2 in Unique Identifier : AIDSLINE AV/9300302A; (Producer) This documentary grapples with the special problems of women in the AIDS epidemic. It will encourage frank and open discussion on a wide range of subjects such as safe sex for both straight and lesbian women, health care for HIV positive women, and advocacy efforts.
It won't happen to me. [videorecording]: [California?] : Kaiser Permanente, c1992 1 videocassette (13 min.) : sd., col. ; 1/2 in Unique Identifier : AIDSLINE AV/9300231A; (Producer) Directed towards teenagers and young adults, this program is an interview with a young mother who is HIV positive. Her preschool daughter is also positive, but her husband, the child s father is not. She tells of the great anguish she feels at being responsible for her daughter s condition because of havin
Nutrition and HIV. [videorecording]: [San Francisco, Calif.?] : North South Films : Clinical Homecare, c1992 1 videocassette (20 min.) : sd., col. ; 1/2 in (Life tapes) Unique Identifier : AIDSLINE AV/9300236A; Waites L; Mello L
AIDS and love : an interview with Dr. Elisabeth Kubler-Ross. [videorecording]: New York, N.Y. : Filmakers Library, [1992] 1 videocassette (39 min.) : sd., col. ; 1/2 in Unique Identifier : AIDSLINE AV/9300255A; (Producer) In this interview from her Virginia farm, Dr. Elizabeth Kubler-Ross, well known for her work with the terminally ill, speaks about the satisfactions of caring for AIDS babies. After her own community prevented her from creating a home for sick mothers and babies on her property, she organized a network of
AIDS prevention for support service employees : video update. [videorecording]: Mt. Kisco, N.Y. : Guidance Associates, 1992 1 videocassette (67 min.) : sd., col. ; 1/2 in. + 1 guide (AIDS, everyday precautions for healthcare workers) Unique Identifier : AIDSLINE AV/9300257A; Alpert LI; Committee
HIV infection : primary care. [videorecording]: [Oakland, Calif.] : Kaiser Foundation Health Plan, c1992 1 videocassette (50 min.) : sd., col. ; 1/2 in (Medicine in the nineties) Unique Identifier : AIDSLINE AV/9300275A; Wolfe E
The:HIV test : who should take it? what does it show?. [videorecording]: [Pleasantville, N.Y.] : Human Relations Media, c1993 1 videocassette (25 min., 30 sec.) : sd., col. ; 1/2 in. + 1 guide Unique Identifier : AIDSLINE AV/9300276A; Cochran P; Rhines K
Teens and AIDS : opportunities for prevention.: Washington, D.C. : Children's Defense Fund, c1988 30 p. : ill (A Publication of the Adolescent Pregnancy Prevention Clearinghouse, ISSN 0899-5591) Unique Identifier : AIDSLINE CAT/9304042; Johnson K
[HIV, narkoman och smittad.]: Stockholm : Utbildningsforlaget Brevskolan, 1990 144 p. : ill (Kunskap mot AIDS) Unique Identifier : AIDSLINE CAT/9302775; Holmberg B
A.I.D.S. : time for reassessment? : aspects of the political economy of the acquired immunodeficiency syndrome (A.I.D.S.).: Perth, W.A. : Curtin University of Technology, School of Economics and Finance, [1990] 27 p (Working paper series, ISSN 1035-901X) Unique Identifier : AIDSLINE CAT/9302629; Craven BM
[AIDS e rene.]: Milano : Wichtig, c1990 98 p Unique Identifier : AIDSLINE CAT/9302655; Sasdelli M
AIDS & intravenous drug use : issues and solutions.: [Melbourne, Vic.] : Health Dept. Victoria, [1990] 26 p. : ill Unique Identifier : AIDSLINE CAT/9303079
The:AIDS disaster : the failure of organizations in New York and the nation.: New Haven : Yale University Press, c1990 xii, 206 p. : ill Unique Identifier : AIDSLINE CAT/9303080; Perrow C; Guillen MF
AIDS : a challenge in education : proceedings of a national conference organized by the Institute of Biology in conjunction with the London University Institute of Education, held in London, 29 November 1989.: London : Institute of Biology ; London ; New York : Royal Society of Medicine Services, 1990 viii, 87 p. : ill Unique Identifier : AIDSLINE CAT/9303082; Morgan DR
HIV/AIDS education : the challenge of reducing high-risk behaviors.: Eugene, Or. : Oregon School Study Council, [1990] iii, 42 p (OSSC bulletin, ISSN 0095-6694 ; v. 34, no. 3 (Nov. 1990)) Unique Identifier : AIDSLINE CAT/9303857; Lumsden LS
[Smitta i varden : psykosociala aspekter pa HIV/aids; handbok for personal som arbetar med HIV-infekterade manniskor som smittats genom blod eller blodprodukter.]: [Stockholm?] : Socialstyrelsen, [1990?] 135 p (SoS-rapport, ISSN 1100-2808 ; (1990:14)) Unique Identifier : AIDSLINE CAT/9304025; Konarski-Svensson JK
[Beschreibung und Tatigkeiten der Einrichtungen im Modellprogramm Drogen und AIDS : Ergebnisse der zweiten Befragung = Description and activities of the outpatient treatment centers in the demonstration project Drugs and AIDS : results of the second survey.]: Munchen : Institut fur Therapieforschung, 1990 xv, 63 p. : ill (IFT-Berichte ; Bd. 54) Unique Identifier : AIDSLINE CAT/9303090; Niemeck U
Management of Kaposi's sarcoma associated with human immunodeficiency virus infection : report.: [Ottawa] : Health and Welfare Canada, c1991 16, 17 p. : ill Unique Identifier : AIDSLINE CAT/9302821; Shepherd FA
The:AIDS epidemic and its demographic consequences : proceedings of the United Nations/World Health Organization Workshop on Modelling the Demographic Impact of the AIDS Epidemic in Pattern II Countries : progress to date and policies for the future, New York, 13-15 December 1989.: the Demographic Impact of the AIDS Epidemic in Pattern II Countries New York : United Nations, Dept. of International Economic and Social Affairs ; Geneva : World Health Organization, Global Programme on AIDS, c1991 ix, 140 p. : ill Unique Identifier : AIDSLINE CAT/9303081
Viral quantitation in HIV infection : proceedings of the International Workshop on Viral Quantitation in HIV Infection, June 13-14, 1991, Paris (France).: Montrouge, France : John Libbey Eurotext, c1991 xvii, 191 p. : ill Unique Identifier : AIDSLINE CAT/9303482; Andrieu J
New York State directory of AIDS/HIV clinical trials.: Washington, DC : American Foundation for AIDS Research, v Unique Identifier : AIDSLINE CAT/9302858
Anti-retroviral treatment : side effect management : report.: [Ottowa, Ont.] : Health and Welfare Canada, [1991] 20, 21 p. : ill Unique Identifier : AIDSLINE CAT/9303696; Rachlis A
AIDS in a caring society : practice and policy.: Stockholm : Nordic School of Public Health, 1991 305 p. : ill (NHV-report, ISSN 0283-1961 ; 1991:6) Unique Identifier : AIDSLINE CAT/9303707; Westphal Victor B
[Drei Gutachten uber rechtliche Fragen im Zusammenhang mit AIDS : Fragen der Partnernotifikation, des Contact Tracing, und der HIV-Tests, aus der Sicht des Verfassungs- und Verwaltungsrechts, des Zivilrechts, und des Strafrechts = Trois expertises sur des questions juridiques en relation avec le SIDA : notification au partenaire, contact tracing, et tests VIH, du point de vue du droit constitutionnel et administratif, du droit civil, et du droit penal.]: Bern : Verlag Stampfli & Cie, 1991 395 p (Abhandlungen zum schweizerischen Recht. Neue Folge ; Heft 529) Unique Identifier : AIDSLINE CAT/9303775; Guillod O
HIV-related issues : background paper.: Washington, D.C. : Congress of the U.S. : Office of Technology Assessment : [Supt. of Docs., U.S. G.P.O., distributor], v. : ill Unique Identifier : AIDSLINE CAT/9303856
Male homosexual behavior and the effects of AIDS education : a study of behavior and safer sex in New Zealand and South Australia.: New York : Praeger, 1991 xvii, 246 p. : ill Unique Identifier : AIDSLINE CAT/9303895; Rosser BR
Meeting the challenge of HIV infection in family foster care.: Washington, DC : Child Welfare League of America, c1991 xii, 83 p Unique Identifier : AIDSLINE CAT/9303916; Ryan CM; Emery LJ
Serving children with HIV infection in child day care : a guide for center-based and family day care providers.: Washington, DC : Child Welfare League of America, c1991 viii, 40 p. : ill Unique Identifier : AIDSLINE CAT/9304014; Pressma D; Emery LJ
AIDS : rights, risk, and reason.: London ; Washington, D.C. : Falmer Press, 1992 vii, 214 p. : ill (Social aspects of AIDS) Unique Identifier : AIDSLINE CAT/9302656; Aggleton P; Davies P; Hart G
AIDS : a communication perspective.: Hillsdale, N.J. : L. Erlbaum Associates, 1992 xiii, 236 p. : ill (Communication) Unique Identifier : AIDSLINE CAT/9302657; Edgar T; Fitzpatrick MA; Freimuth VS
[HIV en AIDS, een strijd om tijd.]: Houten : Bohn Stafleu Van Loghum, 1992 v, 93 p Unique Identifier : AIDSLINE CAT/9302774; Broekhuizen A
Archives of STD/HIV research. Vol. 6, issues 1, 2-: [Kiawah Island, SC : Reproductive Health Center, 1992- v. : ill., ports (M.C. Chang festschrift ; 6, etc.) Unique Identifier : AIDSLINE CAT/9303070
A:word book in oncology and hematology : including terminology of AIDS.: Philadelphia : B.C. Decker, c1992 ix, 280 p Unique Identifier : AIDSLINE CAT/9303668; Sloane SB
AIDS in Africa : its present and future impact.: London : Belhaven Press, 1992 ix, 193 p. : ill Unique Identifier : AIDSLINE CAT/9303708; Barnett T
Report.: Control Programmes Manila, Philippines : Printed and distributed by the Regional Office for the Western Pacific of the World Health Organization, [1992] 28 p. : ill (Report series ; no. RS/91/GE/20(PHL)) Unique Identifier : AIDSLINE CAT/9303998
VIII International Conference on AIDS/III STD World Congress, Amsterdam, the Netherlands 19-24 July 1992.: Netherlands [Amsterdam] : CONGREX Holland B.V., 1992 3 v Unique Identifier : AIDSLINE CAT/9303489
Disulfiram and its metabolite diethyldithiocarbamate : pharmacology and status in the treatment of alcoholism, HIV infections, AIDS and heavy metal toxicity. 1st ed.: London ; New York : Chapman & Hall, 1992 xix, 452 p. : ill Unique Identifier : AIDSLINE CAT/9303772; Gessner PK; Gessner T
New developments in the antimicrobial supportive care of the immunocompromised patient.: PPO Updates; 5(10):1-14 1991. Unique Identifier : AIDSLINE ICDB/93687729; Freifeld A; Pizzo P; Pediatric Branch, NCI, Bethesda, MD; During the last decade, advances in antimicrobial development have offered viable alternatives to traditional therapy to protect the immunocompromised patient (pt) from the early morbidity and mortality that ensues from untreated bacterial infections. Newer antibiotics (3rd-generation cephalosporins, imipenem, aztreon
'Double negative' (CD4-, CD8-) TCR alpha beta+ adult T cell leukemia cells proliferated vigorously in the presence of IL-2 or IL-4.: Int Congr Ser; 956:137-40 1991. Unique Identifier : AIDSLINE ICDB/93688676; Hattori T; Sakai K; Suzushima H; Asou N; Takatsuki K; Matsuzaki Y; Nakauchi H; Natori H; Oizumi K; Second Dept. of Internal Medicine, Kumamoto Univ. Medical Sch.,; Japan; Human T-cell leukemia virus type 1 (HTLV-1) is associated etiologically with adult T-cell leukemia (ATL). A distinctive feature of ATL cells is the universally expressed activated T-cell antigens, such as HLA-DR and CD25, with a phenotype of mature helper T cells (CD3+, CD4+, CD8-). The origins of ATL cells apparently
Immune-deficient mice as models for human hematopoietic disease.: Mol Genet Med; 1:77-115 1991. Unique Identifier : AIDSLINE ICDB/93690248; Dick JE; Dept. of Genetics, Res. Inst., Hosp. for Sick Children, Toronto,; Ontario, Canada; Knowledge of the hematopoietic cell system has been derived primarily from studies of the mouse. In vivo assays for the various cells within the stem cell hierarchy have played an important role in these advances. In contrast, understanding of the biology of the human hematopoietic system has suffered because of the l
Molecular genetics and drug discovery.: Mol Genet Med; 1:133-67 1991. Unique Identifier : AIDSLINE ICDB/93690249; Venuti MC; Dept. of Bioorganic Chemistry, Genentech, Inc., South San; Francisco, CA; As medicinal chemistry has become a more methodical science, the task of discovering new therapeutic agents that work potently, specifically, and without side effects has become increasingly important and difficult. This science, which once relied almost solely on near-blind synthesis and screening for in vivo effects
Inhibition of HTLV-I entry in peripheral blood mononuclear cells by monoclonal antibody 34-23 (Meeting abstract).: FASEB J; 6(4):A1296 1992. Unique Identifier : AIDSLINE ICDB/93687101; Fan N; Poiesz BJ; Gavalchin J; Silverstone A; State Univ. of New York Health Science Center, Syracuse, NY 13210; A monoclonal IgM antibody, MAb 34-23, that identifies a cell surface antigen on cells susceptible to infection by HTLV-I has been produced and its ability to block HTLV-I binding to target cells and inhibit cell-free HTLV-I entry into target cells examined. Preincubation of PHA-activated peripheral blood mononuclear c
Immunological events following chemoimmunotherapy combination of metastatic malignant melanoma (MMM) (Meeting abstract).: FASEB J; 6(4):A1333 1992. Unique Identifier : AIDSLINE ICDB/93687107; Soubrane C; Mouawad R; Ichen M; Suissa J; Borel C; Weil M; Khayat D; Dept. of Medical Oncology, Pitie-Salpetriere Hosp., Paris, France; 16 patients (pts) with MMM were included in this study. They received 100 mg/m2 of cisplatin (CDDP) over 4 hr at days 1 and 28, followed by 18 MIU/m2/day of interleukin-2 (IL2-Eurocetus) in continuous infusion from days 3 to 6, 17 to 21, 31 to 34 and 45 to 49. Alpha interferon (IFN-Roche) 9 MU/day was given sc 3x/wk.
Bestatin, an aminopeptidase inhibitor with a multipharmacologic function (Meeting abstract).: Eighth Mediterranean Congress of Chemotherapy. May 24-9, 1992, Athens, Greece, p. 731, 1992. Unique Identifier : AIDSLINE ICDB/93688839; Mathe G; Chenu E; Bourut C; Orbach-Arbouys S; Institut du Cancer et d'Immunogenetique, Hopital Paul-Brousse,; Villejuif, France; Bestatin, dipeptide N-([2S,3R]-3-amino-2-hydroxy-4-phenylbutanoyl)-L-leucine is a leucine aminopeptidase and B aminopeptidase inhibitor which exerts a direct stimulating effect on lymphocytes (and monocytes) via its fixation on cell surface leucine aminopeptidase, and an indirect one on monocytes (and lymphocytes) via
Gene regulation: biology of antisense RNA and DNA.: Raven Press Ser Mol Cell Biol; 1:1-364 1992. Unique Identifier : AIDSLINE ICDB/93689043; Anonymous; No affiliation given; Current interest in antisense technology started with studies published in 1984, although endogenous antisense mechanisms had been identified and tested almost two decades before. Antisense transgenes in plants, slime mold, and other nonvertebrate systems yielded nearly complete elimination of target gene expression,
Impact of radiotherapy (RT) on oral AIDS-related Kaposi's sarcoma (Meeting abstract).: Ann Oncol; 3(Suppl 5):136 1992. Unique Identifier : AIDSLINE ICDB/93689686; Gramaglia A; Milani F; Villa S; Palazzi M; Giampetruzzi E; Radiotherapy C, Istituto Nazionale Tumori, Milan, Italy; The incidence of epidemic Kaposi s sarcoma (EKS) is increasing (EKS is 15,000x more frequent in AIDS patients [pts] than in the normal population). Oral presentation is about 47% of all cases. Dental pain/loss dysphagia, mucositis, ulceration, and bleeding have a great impact on quality of life of the pt. RT still rep
Human immunodeficiency virus (HIV-1) infection in patients with lymphoid neoplasia (Meeting abstract).: Ann Oncol; 3(Suppl 5):136 1992. Unique Identifier : AIDSLINE ICDB/93689688; Shamebo M; Dept. of Internal Medicine, Faculty of Medicine, Addis Ababa; Univ., Addis Ababa, Ethiopia; Patients (pts; n=103) with lymphoid neoplasia, 77 males and 26 females aged 14-78 yr (mean age 42.6 yr), were seen in the Department of Internal Medicine, Tikur Anbessa Hospital (Black Lion) Teaching Hospital, Addis Ababa, between January 1988 and December 1991. 50 pts (48.5%) were non
The effect of antioxidants on the activation of the transcription activator NF-kappa B by transactivators from hepatitis B virus and HTLV-1 (Meeting abstract).: International Symposium on Cancer, Sapporo Cancer Seminar: Oxyradicals and Anti-oxidative Responses in Cancer. July 14-16, 1992, Sapporo, Japan, p. 43, 1992.. Unique Identifier : AIDSLINE ICDB/93690044; Baeuerle PA; Schreck R; Meyer M; Schluter V; Caselmann W; Hofschneider PH; Gene Center, Ludwig-Maximilians Univ., Munich, Germany; The nuclear factor kappa B (NF-kappa B) is an inducible transcription factor that is activated when cells are exposed to TNF, IL-1, viruses, double-stranded RNA, lipopolysaccharide, UV light and gamma rays. A hallmark of NF-kappa B is that, in nonstimulated cells, it resides in the cytoplasm in complex with the inhibi
Redox regulation of cell activation and transformation by ADF/TRX (human thioredoxin) (Meeting abstract).: International Symposium on Cancer, Sapporo Cancer Seminar: Oxyradicals and Anti-oxidative Responses in Cancer. July 14-16, 1992, Sapporo, Japan, p. 46, 1992.. Unique Identifier : AIDSLINE ICDB/93690047; Taniguchi Y; Kawabe T; Masutani H; Nakamura H; Matsuda M; Okamoto T; Yodoi J; Dept. of Biological Responses, Inst. for Virus Res., Kyoto Univ.,; 53 Shogoin, Kawahara-cho, Sakyo-ku, Kyoto 606, Japan; Human T-lymphotropic virus type 1 (HTLV-1)-transformed T cells overexpress interleukin-2 receptor alpha chain (IL-2R alpha) and adult T-cell leukemia-derived factor (ADF), originally defined as an IL-2R inducer. Subsequent ADF cDNA cloning showed that ADF is a human homolog of thioredoxin (TRX), an endogenous thiol-re
Inhibitory effect of pentosan polysulfate: a potent anti-HIV and antitumor agent on protein serine/threonine and tyrosine kinases (Meeting abstract).: FASEB J; 6(5):A1851 1992. Unique Identifier : AIDSLINE ICDB/93687627; Chiasson JC; Sekaly RP; Chiasson JL; Srivastava AK; Clinical Res. Inst. of Montreal, Montreal, H2W 1R7 Canada; Pentosan polysulfate (PPS), a polyanionic mucopolysaccharide, which has been shown to exert inhibitory effects on human immunodeficiency virus (HIV-I) replication and on tumor growth, inhibited the activities of protein tyrosine kinases (PTK) from lymphocytes (Jurkat cells) and rat lung. In addition, the autophosphory
Therapeutic indications of hemopoietic growth factors in hematologic diseases (Meeting abstract).: Eighth Mediterranean Congress of Chemotherapy. May 24-29, 1992, Athens, Greece, p. 625, 1992.. Unique Identifier : AIDSLINE ICDB/93688738; Kallinikos-Maniatis A; Lab. of Hematology and Transfusion Medicine, Univ. of Patras,; Greece; Hemopoietic growth factors have recently been incorporated in a number of clinical trials both in hematology and in oncology, and results (although preliminary) are certainly promising. Correction of anemia by the administration of rEPO has been achieved in anemia of renal failure and responses have been observed in a
Nitrosourea antitumor agents--correlation between antitumor action and some biochemical properties of newly synthesized derivatives (Meeting abstract).: Eighth Mediterranean Congress of Chemotherapy. May 24-9, 1992, Athens, Greece, p. 742-3, 1992. Unique Identifier : AIDSLINE ICDB/93688851; Illarionova M; Zheleva A; Raikov Z; Todorov D; Dudov; Natl. Oncological Center, Sofia, Bulgaria; The nitrosourea derivatives from several groups (spin-labeled and nonspin-labeled 2-chloroethyl-nitrosourea derivatives of some amino acids as alanine, glycine, methionine, leucine and others) on the rational basis were synthesized. The antitumor activity and some related to that activity, and biochemical properties (
Polychemotherapy AVB schema in Kaposi's sarcoma in HIV-infected patients (Meeting abstract).: Ann Oncol; 3(Suppl 5):136 1992. Unique Identifier : AIDSLINE ICDB/93689687; Munarriz J; Mohedano N; Jimenez U; Donnay O; Lazaro M; Sanz J; Verdejo J; Martinez MC; Castrillo JM; Guardiola L; et al; S. Oncologia Medica-E, Infecciosas, Hosp. de la Princesa, Madrid,; Spain; Chemotherapy was planned on those HIV+ patients (pts) with Kaposi s sarcoma (KS) with unfavorable prognostic factors. In a first group which showed rapid progression with CD4 A and with skin affects, chemotherapy was carried out with vincristine/vinblastine (VBL). In a second group with III/IV stages, CD4 200 and prio
Intermittent use of G-CSF in AIDS-related granulocytopenia (G) (Meeting abstract).: Ann Oncol; 3(Suppl 5):137 1992. Unique Identifier : AIDSLINE ICDB/93689689; Katz A; Levy GC; Albert Einstein Hosp., Sao Paulo, Brazil; AIDS patients (pts) often develop leukopenia and G, either related to the HIV infection itself or associated with the use of myelosuppressive drugs such as AZT or DHPG. This common event further complicates the clinical course of the pts and may requi
High-dose chemotherapy (HDCT) and autologous bone marrow transplantation (ABMT) do not improve the evolution of poor prognosis (PP) germ-cell tumors (GCT) (Meeting abstract).: Ann Oncol; 3(Suppl 5):164 1992. Unique Identifier : AIDSLINE ICDB/93689791; Biron P; Droz JP; Pico JL; Kramar A; Bouzy J; GU group of the French Federation of Cancer Centers; The role of early HDCT + ABMT in the treatment of PP nonseminomatous GCT as defined in our group (Droz, Cancer 62:54, 1988) was studied by a multicentric Phase III trial. Patients (pts) were randomized to receive either arm A: the NCI cisplatin (P), vinblastine (Ve), bleomycin (B), VP16 (V) regimen (PVeBV; Ozols, JCO
Granulocyte-macrophage colony-stimulating factor: unrealized potential.: Blood Cell Growth Factors: Their Present and Future Use in Hematology and Oncology. Murphy MJ Jr, ed. Dayton, OH, AlphaMed Press, p. 3-20, 1991.. Unique Identifier : AIDSLINE ICDB/93689904; Bonnem EM; Schering-Plough International, Kenilworth, NJ; GM-CSF entered the clinic only 4 yr ago, yet it has already demonstrated widespread efficacy and utility in a number of clinical settings. As a single agent, GM-CSF can reverse the neutropenia of myelodysplastic syndrome and aplastic anemia. GM-CSF can also enhance recovery from bone marrow transplantation and thus re
Induction of immune-modulated opportunistic tumours and a new strategy for their treatment.: Int J Immunotherapy; 7(4):189-95 1991. Unique Identifier : AIDSLINE ICDB/93690155; Madarnas P; Dube M; Nigam VN; Dept. of Pathology, Univ. of Sherbrooke, Sherbrooke, Quebec, J1H; 5N4, Canada; Dimethylhydrazine treatment of CD1 mice for more than 30 wk induced colorectal-anal cancer as well as skin and visceral angiosarcomas in high proportions. These mice were tested as models for AIDS-associated Kaposi s sarcoma (KS) with respect to their immune status and for the histological similarity of skin lesions w
[Appendicitis and acquired immunodeficiency syndrome. Apropos of 19 cases]: Chirurgie. 1991;117(7):557-62; discussion 562-3. Unique Identifier : AIDSLINE MED/93114140; Johanet H; Marmuse JP; Benhamou G; Charleux H; Service de Chirurgie generale et digestive, hopital Bichat,; Paris.; Appendectomy is the most current digestive surgical procedure in France . Ascending prevalence of infection by HIV, invites us to report 19 documented cases of appendicular syndroma in a population infected by HIV, within 13 cases who required criteria for AIDS. In 31.5% of cases, o
The donor of blood and its components.: Schweiz Med Wochenschr Suppl. 1991;43:111-4. Unique Identifier : AIDSLINE MED/93117794; Hogman CF; Department of Clinical Immunology and Transfusion Medicine,; University Hospital, Uppsala, Sweden.
Treatment of hemophilia.: Schweiz Med Wochenschr Suppl. 1991;43:82-9. Unique Identifier : AIDSLINE MED/93117807; Meili EO; Gerinnungslabor, Universitatsspital Zurich, Switzerland.
HTLV-I-associated myelopathy (HAM/TSP) with Hashimoto's thyroiditis.: Tokushima J Exp Med. 1991 Dec;38(3-4):99-102. Unique Identifier : AIDSLINE MED/93118037; Kawai H; Kashiwagi S; Inui T; Tamaki Y; Sano Y; Saito S; 1st Department of Internal Medicine, School of Medicine,; University of Tokushima, Japan.; Two cases of HTLV-I-associated myelopathy (HAM/TSP) with Hashimoto s thyroiditis are reported. One patient is a 47-year-old female with goiter and the other a 60-year-old female. Both have slowly progressive spastic paraparesis and have anti-HTLV-I antibodies in their serum and cerebrospinal fluid. Anti-thyroid antibo
Treatment of advanced non-Hodgkin's lymphoma in adults.: Wis Med J. 1991 Dec;90(12):676-8. Unique Identifier : AIDSLINE MED/93118351; Friedenberg WR; Department of Oncology, Marshfield Clinic, WI 54449.; Although dramatic progress has been made in the treatment of advanced non-Hodgkin s lymphoma , a majority of patients eventually die from this disease. Improvements in histopathology, staging techniques, immunophenotyping, and knowledge of prognostic factors have improved our abilit
[Reflections on the epidemiology of HIV infections and AIDS]: Epidemiol Prev. 1991 Sep-Dec;13(48-49):15-28. Unique Identifier : AIDSLINE MED/93137998; Perucci CA; Michelozzi P; Abeni D; Arca M; Sangalli M; Spadea T; Chierchini P; Orchi N; Miceli M; Montiroli PM; et al; Ossevatorio Epidemiologico Regione Lazio.
Isotypic distribution of HIV-1-specific antibodies in individuals from central Africa.: Viral Immunol. 1992 Winter;5(4):243-8. Unique Identifier : AIDSLINE MED/93112216; Kovacsovics-Bankowski M; Carini C; Kashala O; Essex M; Harvard School of Public Health, Department of Cancer Biology,; Boston, Massachusetts.; Individuals infected with human immunodeficiency virus type 1 (HIV-1) develop a humoral immune response to the virus s major structural gene products env, gag, and pol. The distribution of antibodies to env, gag, and pol proteins in Central African populations is of interest as they have a high level of immune system
A method to analyze the interaction between gp120 of human immunodeficiency virus and CD4.: Viral Immunol. 1992 Winter;5(4):305-10. Unique Identifier : AIDSLINE MED/93112223; Lanza P; Washington LC; Zanetti M; Department of Medicine, University of California, San Diego.; The study presents a new in vitro method to investigate the interaction between the glycoprotein (gp)120 of human immunodeficiency virus (HIV) and its receptor, CD4. The method is based on the binding of soluble recombinant CD4 to a human T cell line, 8E5, which constitutively expresses gp120 at its surface as a resul
Passive immunization for the prevention and treatment of HIV infection [editorial]: AIDS. 1992 Nov;6(11):1235-47. Unique Identifier : AIDSLINE MED/93112293; Zolla-Pazner S; Gorny MK
Qualitative and quantitative analysis of human cytotoxic T-lymphocyte responses to HIV-1 proteins.: AIDS. 1992 Nov;6(11):1249-58. Unique Identifier : AIDSLINE MED/93112294; Lamhamedi-Cherradi S; Culmann-Penciolelli B; Guy B; Kieny MP; Dreyfus F; Saimot AG; Sereni D; Sicard D; Levy JP; Gomard E; INSERM U152, ICGM, Hopital Cochin, Paris, France.; OBJECTIVE: To study the degree of immunogenicity of each HIV-1 protein. DESIGN: In most viral systems, antiviral cytotoxic T-lymphocytes (CTL) from a given donor preferentially recognize only one or a small number of viral proteins. METHODS: Anti-HIV CTL were generated by in vitro stimulation of peripheral blood monon
Tumor necrosis factor-alpha in pediatric HIV-1 infection.: AIDS. 1992 Nov;6(11):1265-8. Unique Identifier : AIDSLINE MED/93112296; Ellaurie M; Rubinstein A; Special Immunology Service, Children's National Medical Center,; Washington, District of Columbia.; OBJECTIVE: To evaluate the diagnostic and prognostic value of serum tumor necrosis factor-alpha (TNF-alpha) levels in HIV-1-infected children. DESIGN: Serum levels of TNF-alpha were evaluated in 57 HIV-1-infected symptomatic children aged between 7 months and 8 years. METHODS: TNF-alpha levels were determined by enzym
Serological responses to mycoplasmas in HIV-infected and non-infected individuals.: AIDS. 1992 Nov;6(11):1287-92. Unique Identifier : AIDSLINE MED/93112300; Hakkarainen K; Jansson E; Ranki A; Valle SL; Krohn KJ; Institute of Biomedical Sciences, University of Tampere, Finland.; OBJECTIVE: To assess the frequency of mycoplasma infections in HIV-antibody-positive and -negative individuals by studying the serological responses against mycoplasmas, especially Mycoplasma fermentans and M. pirum. DESIGN: An enzyme-linked immunosorbent assay (ELISA) was used to measure immunoglobulin G (IgG) class
Zidovudine-induced restoration of cell-mediated immunity to mycobacteria in immunodeficient HIV-infected patients.: AIDS. 1992 Nov;6(11):1293-7. Unique Identifier : AIDSLINE MED/93112301; French MA; Mallal SA; Dawkins RL; Department of Clinical Immunology, Royal Perth Hospital, Western; Australia.; OBJECTIVE: To describe a localized form of Mycobacterium avium intracellulare (MAI) infection occurring concurrently with the restoration of cutaneous delayed-type hypersensitivity (DTH) responses to mycobacterial antigens after commencement of zidovudine therapy in immunodeficient HIV-infected patients. PATIENTS: The
Relationship of cerebrospinal fluid immune activation associated factors to HIV encephalitis.: AIDS. 1992 Nov;6(11):1299-307. Unique Identifier : AIDSLINE MED/93112302; Wiley CA; Achim CL; Schrier RD; Heyes MP; McCutchan JA; Grant I; Department of Pathology, University of California San Diego, La; Jolla 92093-0612.; OBJECTIVES AND DESIGN: Because macrophages are the predominant immune cell and the predominant infected cell in the brains of patients with HIV encephalitis, we studied macrophage and immune activation-associated factors in the cerebrospinal fluid (CSF) from 39 autopsied AIDS cases for whom complete neuropathologic ev
Prevalence of measles antibodies in adults with HIV infection: possible risk factors of measles seronegativity.: AIDS. 1992 Nov;6(11):1321-5. Unique Identifier : AIDSLINE MED/93112305; Kemper CA; Zolopa AR; Hamilton JR; Fenstersheib M; Bhatia G; Deresinski SC; Department of Medicine, Stanford University School of Medicine,; California.; OBJECTIVES: To determine the prevalence of measles (rubeola) immunity in a group of HIV-1-infected adults and to examine predictors of measles seronegativity in this population. SETTING: County hospital outpatient clinic and public-health department early HIV intervention clinic. PATIENTS: A total of 262 HIV-infected
Bronchial responsiveness in AIDS patients with Pneumocystis carinii pneumonia.: AIDS. 1992 Nov;6(11):1331-3. Unique Identifier : AIDSLINE MED/93112307; Ong EL; Hanley SP; Mandal BK; Regional Department of Infectious Diseases and Tropical Medicine,; Monsall Hospital, Manchester, England, UK.; OBJECTIVE: To study bronchial responsiveness to inhaled histamine among HIV-infected patients. DESIGN: A prospective study in a regional infectious diseases unit. METHODS: Three groups of patients were studied. Group A consisted of AIDS patients (n = 7) who had had Pneumocystis carinii pneumonia (PCP), group B of AIDS
Prevention of blood-borne HIV transmission using a decentralized approach in Shaba, Zaire.: AIDS. 1992 Nov;6(11):1353-8. Unique Identifier : AIDSLINE MED/93112311; Laleman G; Magazani K; Perriens JH; Badibanga N; Kapila N; Konde M; Selemani U; Piot P; Centre Regional de Lutte Contre le SIDA, Lubumbashi, Zaire.; OBJECTIVE: To prevent blood transfusion-acquired HIV infection with a decentralized approach to HIV screening of blood donors, using an instrument-free rapid test. SETTING: Shaba province, Zaire (496,877 km2). METHODS: The programme consisted of training health-care workers, distr
AIDS education for hospital workers in Manila: effects on knowledge, attitudes, and infection control practices.: AIDS. 1992 Nov;6(11):1359-63. Unique Identifier : AIDSLINE MED/93112312; Santana RT; Monzon OT; Mandel J; Hall TL; Hearst N; Research Institute for Tropical Medicine, Department of Health,; Muntinlupa, Metro Manila, Philippines.; OBJECTIVE: To evaluate an AIDS education intervention for health workers in Metro Manila hospitals. METHODS: A randomized controlled education program consisting of lectures, role-plays, posters and pamphlets was delivered to physicians, nurses, laboratory technologists and orderlies in Manila hospitals. Knowledge, at
HIV-1 infection among non-intravenous drug user female prostitutes in Spain. No evidence of evolution to pattern II.: AIDS. 1992 Nov;6(11):1365-9. Unique Identifier : AIDSLINE MED/93112313; Pineda JA; Aguado I; Rivero A; Vergara A; Hernandez-Quero J; Luque F; Pino R; Abad MA; Santos J; Cruz E; et al; Viral Hepatitis and AIDS Study Group, Virgen del Rocio; University Hospital, Seville, Spain.; OBJECTIVES: To assess the prevalence of HIV-1 infection among non-intravenous drug user (IVDU) female prostitutes in Spain and to determine risk factors for HIV-1 infection in this population. DESIGN: Cross-sectional seroepidemiological study of 519 non-IVDU prostitutes. SETTING: Fo
Estimates of HIV infection among injecting drug users in Glasgow, 1985-1990.: AIDS. 1992 Nov;6(11):1371-5. Unique Identifier : AIDSLINE MED/93112314; Frischer M; Green ST; Goldberg DJ; Haw S; Bloor M; McKeganey N; Covell R; Taylor A; Gruer LD; Kennedy D; et al; Communicable Diseases Scotland Unit, Ruchill Hospital, Glasgow,; UK.; OBJECTIVE: To use research and surveillance studies in Glasgow (Scotland, UK) to estimate the number of current injectors infected with HIV, the total number of injectors infected up to the end of 1990 and the recent incidence of infection. DESIGN: (A) Prevalence of injecting drug use was estimated using log-linear mo
An economic evaluation of home-care assistance for AIDS patients: a pilot study in a town in northern Italy.: AIDS. 1992 Nov;6(11):1377-83. Unique Identifier : AIDSLINE MED/93112315; Tramarin A; Milocchi F; Tolley K; Vaglia A; Marcolini F; Manfrin V; de Lalla F; Infectious Diseases Department, San Bortolo Hospital, Vicenza,; Italy.; OBJECTIVE: To evaluate the costs and cost-effectiveness of home-care assistance (HCA) as an alternative to hospital-based care only for patients with AIDS (PWA). DESIGN: A 6-month prospective study. Use of resources by a control group of PWA receiving ordinary hospital-based care (OC group) was compared with that by a
Completeness of AIDS reporting in Switzerland: a study based on deaths between December 1987 and June 1990.: AIDS. 1992 Nov;6(11):1385-9. Unique Identifier : AIDSLINE MED/93112316; Engel RR; Samuel MC; Rieder HL; Billo N; Somaini B; Department of Biomedical and Environmental Health Sciences,; University of California, Berkeley 94720.; OBJECTIVES: To assess completeness and determinants of reporting to the AIDS registry of the Swiss Federal Office of Public Health. DESIGN AND METHODS: Death certificates indicative of AIDS or HIV for deaths occurring between December 1987 and June 1990 were reviewed and compared with reports to the AIDS registry. RES
Difficulties associated with providing an HIV-free blood supply in tropical Africa [editorial]: AIDS. 1992 Nov;6(11):1395-7. Unique Identifier : AIDSLINE MED/93112318; Ryder RW
Pyomyositis and cryptococcal sepsis in an HIV-infected patient with severe granulocyte defect [letter]: AIDS. 1992 Nov;6(11):1399-400. Unique Identifier : AIDSLINE MED/93112319; Zimmerli W; Borer H; Ruttiman S
Salmonella typhimurium lung abscesses in an HIV-infected patient: successful treatment with oral ciprofloxacin [letter]: AIDS. 1992 Nov;6(11):1400-1. Unique Identifier : AIDSLINE MED/93112320; Albrecht H; Stellbrink HJ; Fenske S; Steiner P; Greten H
In vitro reduction of HIV infectivity by dimethylsulphoxide [letter]: AIDS. 1992 Nov;6(11):1402-3. Unique Identifier : AIDSLINE MED/93112321; Aranda-Anzaldo A; Ablashi DV; Viza D
Helicobacter pylori infection in an HIV-positive patient [letter]: AIDS. 1992 Nov;6(11):1404-5. Unique Identifier : AIDSLINE MED/93112323; Harris M; Szabo J
On 'the natural history of HIV and AIDS in women' [letter]: AIDS. 1992 Nov;6(11):1406-8. Unique Identifier : AIDSLINE MED/93112325; Kelley KF; Vermund SH
Changes in public knowledge and awareness of AIDS in Zambia [letter]: AIDS. 1992 Nov;6(11):1408-9. Unique Identifier : AIDSLINE MED/93112326; Trykker H; Kalumba K; Hamming A; Eberhard M
Residual risk for post-transfusional HIV-2 infection in France [letter]: AIDS. 1992 Nov;6(11):1410. Unique Identifier : AIDSLINE MED/93112327; Boeri N; Belec L; Gilquin J; Chevalier X
PCR-based quantitation of low levels of HIV-1 DNA by using an external standard.: Genet Anal Tech Appl. 1992 Aug;9(4):113-6. Unique Identifier : AIDSLINE MED/93112450; Arnold BL; Itakura K; Rossi JJ; Department of Molecular Genetics, City of Hope, Duarte, CA 91010.; Beginning with 10(3)-10(5) molecules of a purified HIV-1 target sequence as a starting template, we have examined the effects of starting template concentration and cycle number on the amplification efficiency of the polymerase chain reaction. An external standard DNA sequence has been designed that when added to a DN
Drug abuse and HIV infection: general practice treatment and research agendas [editorial]: Br J Gen Pract. 1992 Nov;42(364):451-2. Unique Identifier : AIDSLINE MED/93112457; Robertson JR
AIDS and Austrian physicians.: AIDS Educ Prev. 1992 Winter;4(4):279-94. Unique Identifier : AIDSLINE MED/93112497; Fazekas C; Diamond M; Mose JR; Neubauer AC; Hygiene Institut, Karl-Franzens-University Graz, Austria.; Physicians have key roles both in treating disease and educating their patients about health and disease-related issues. To assess which factors correlate with Austrian physician s willingness to treat and educate patients about HIV-related risk behaviors and deal with AIDS issues, we conducted a survey of general pra
Effect of Magic Johnson's HIV status on HIV-related attitudes and behaviors of an STD clinic population.: AIDS Educ Prev. 1992 Winter;4(4):295-307. Unique Identifier : AIDSLINE MED/93112498; Langer LM; Zimmerman RS; Hendershot EF; Singh M; University of Miami, Florida.; This paper reports data on the effects that Earvin Magic Johnson s announced HIV infection had on the clients of an Philadelphia sexually-transmitted-disease (STD) clinic. Interviews conducted after Johnson s announcement (N = 148) included questions about whether respondents had heard his announcement and how this ne
The stigmatization of AIDS in infants and children in the United States.: AIDS Educ Prev. 1992 Winter;4(4):308-18. Unique Identifier : AIDSLINE MED/93112499; Clemo L; Department of Political Science, State University of New York,; Oswego 13216.; Many studies examining AIDS issues have detailed the policy implications of negative attitudes toward homosexuals, intravenous (IV) drug users, and the inner-city poor; however, none have specifically examined whether existing biases and prejudicial fears expressed toward HIV-infected adults also affect political resp
Child care providers and AIDS: a study of knowledge versus acceptance.: AIDS Educ Prev. 1992 Winter;4(4):319-27. Unique Identifier : AIDSLINE MED/93112500; Coleman M; Dept. of Child and Family Development, University of Georgia,; Athens 30602.; A survey of child care providers knowledge of human immunodeficiency virus (HIV) transmission and attitudes toward recommended child care policies regarding AIDS was conducted in a Southeastern state. Significant knowledge differences regarding HIV transmission were found between certain comparison groups, although a
AIDS outreach workers: an exploratory study of job satisfactions/dissatisfactions.: AIDS Educ Prev. 1992 Winter;4(4):328-37. Unique Identifier : AIDSLINE MED/93112501; Deren S; Davis WR; Tortu S; Friedman S; Tross S; Sufian M; Pascal J; Stull C; Narcotic and Drug Research, Inc., New York, NY.; AIDS outreach workers operate at the frontlines of the AIDS epidemic to provide information and education to high-risk individuals. Recent reports indicate that these workers have been effective in helping to reduce high-risk behaviors. However, a review of retention data for 62 outreach workers employed from 1986 to
Reliability of AIDS knowledge scales: conceptual issues.: AIDS Educ Prev. 1992 Winter;4(4):338-44. Unique Identifier : AIDSLINE MED/93112502; Zimet GD; Department of Pediatrics, Case Western Reserve University School; of Medicine, Cleveland, OH.; A common approach to evaluating the reliability of AIDS knowledge scales has relied on the demonstration of internal consistency through the use of Kuder-Richardson formula 20 (KR-20) or coefficient alpha. In this study, the argument was made that, in a knowledge-based scale with diverse content (exemplified by AIDS k
The Ohio AIDS Prevention Survey: a study of psychometric properties.: AIDS Educ Prev. 1992 Winter;4(4):345-9. Unique Identifier : AIDSLINE MED/93112503; Leslie M; St. Pierre RW; Schuster PA; Department of Health Education, Pennsylvania State University,; Monroeville 15146.; The reliability of a measuring instrument is a major criterion for assessing its quality and adequacy. This article describes reliability pilot testing done with the Ohio AIDS Prevention Survey (Fellner & Thomas, 1989-90) in a sample of sexually active women of childbearing age. Previous alpha reliabilities of the
AIDS in sub-Saharan Africa: implications for health education.: AIDS Educ Prev. 1992 Winter;4(4):350-61. Unique Identifier : AIDSLINE MED/93112504; Gwede C; McDermott RJ; University of South Florida College of Public Health, Department; of Community and Family Health, Tampa 33612-3805.; This paper reviews the current epidemiologic status of AIDS in sub-Saharan Africa, focusing on what is currently understood about the distinctive features of heterosexual transmission in young men, women, and children. Epidemiologic data show that AIDS is transmitted primarily through heterosexual vaginal intercourse.
Neither the LCK nor the FYN kinases are obligatory for IL-2-mediated signal transduction in HTLV-I-infected human T cells.: Int Immunol. 1992 Nov;4(11):1233-43. Unique Identifier : AIDSLINE MED/93112573; Mills GB; Arima N; May C; Hill M; Schmandt R; Li J; Miyamoto NG; Greene WC; Toronto General Hospital, Ontario, Canada.; IL-2 is one of the principal growth factors regulating the proliferation of T lymphocytes. Although two independent IL-2-binding molecules have been molecularly cloned and shown to participate in the formation of a high affinity receptor complex, their primary structur
[A new method of global search for functional DNA segments using a fractal representation of nucleotide texts]: Biofizika. 1992 Sep-Oct;37(5):837-47. Unique Identifier : AIDSLINE MED/93112785; Korolev SE; Solov'ev VV; Tumanian VG; New global method for computer prediction of functional sites in nucleotide sequences, based on the fractal representation, is presented. Fractal representation of set of sequences (FRS) provides simple way for generating recognitions matrix of functionally similar sequences and simple estimations of its efficiency fo
[Management of the asymptomatic HIV-positive patient (letter)]: Aten Primaria. 1992 Oct 1;10(5):803-4. Unique Identifier : AIDSLINE MED/93112844; Nabal Vicuna M; Pablo Cerezuela F; Aguirre Errasti JM; Ramos Paesa C
[Influence of the HIV (+) cases on the epidemiology of infantile tuberculosis in Barcelona]: Aten Primaria. 1992 Nov 1;10(7):865-7. Unique Identifier : AIDSLINE MED/93112848; Garcia Orus C; Canovas Verge D; Cordon Gurpegui F; Cayla Buqueras JA; Escuela Universitaria de Enfermeria, Cruz Roja, Barcelona.; OBJECTIVE. To understand better the characteristics of tuberculosis (TBC) in children and to identify sources of infection. DESIGN. Crossover study. SITE. At the community level in the city of Barcelona. PATIENTS. Children under 15 with tuberculosis, who were diagnosed between Oct 1, 1989 and Sept 30, 1990 and were re
Autoantibodies to c-myc protein: elevated levels in patients with African Burkitt's lymphoma and normal Ghanians.: Autoimmunity. 1992;13(3):215-24. Unique Identifier : AIDSLINE MED/93112867; LaFond RE; Eaton RB; Watt RA; Villee CA; Actor JK; Schur PH; Laboratory of Human Reproduction and Reproductive Biology,; Harvard Medical School, Boston, MA 02115.; Sera from U.S. patients with SLE, RA, and various malignancies, clinically normal individuals with sero-activity to HIV, AIDS, and from pregnant women were tested for the presence of anti-c-myc antibodies. In an ELISA using recombinant human c-myc protein as the antigen, no difference in mean antibody titer was genera
Reversal of the abnormal development of T cell subpopulations in the thymus of autoimmune MRL-lpr/lpr mice by a polyamine biosynthesis inhibitor.: Autoimmunity. 1992;13(4):275-83. Unique Identifier : AIDSLINE MED/93112875; Thomas TJ; Gunnia UB; Thomas T; Program in Clinical Pharmacology, University of Medicine and; Dentistry of New Jersey-Robert Wood Johnson Medical School, New; Brunswick 08903.; Polyamines--putrescine, spermidine, and spermine--are a group of positively charged organic molecules that are present in all living cells. They are important regulators of cell growth and differentiation, but the precise mechanism of their action is not known. Ornithine decarboxylase (ODC) is a key enzyme in the bios
[The pathogenic concepts in the acquired immunodeficiency syndrome]: Bacteriol Virusol Parazitol Epidemiol. 1992 Jan-Jun;37(1-2):39-52. Unique Identifier : AIDSLINE MED/93113122; Negut EA; Mazilu E; Institutul Cantacuzino.
[The condom--a prophylactic agent. The limits of its protection]: Bacteriol Virusol Parazitol Epidemiol. 1992 Jan-Jun;37(1-2):91-4. Unique Identifier : AIDSLINE MED/93113130; Ciufecu C; Institutul Cantacuzino, R.A.
Intestinal Enterocytozoon bieneusi microsporidiosis in an HIV-infected patient: diagnosis by ileo-colonoscopic biopsies and long-term follow up.: Clin Investig. 1992 Nov;70(11):1019-23. Unique Identifier : AIDSLINE MED/93113182; Weber R; Muller A; Spycher MA; Opravil M; Ammann R; Briner J; Departement Innere Medizin, Universitatsspital, Zurich.; A 39-year-old patient with acquired immunodeficiency syndrome was diagnosed as having intestinal Enterocytozoon bieneusi microsporidiosis after persistent watery diarrhea for 30 months and a 16-kg weight loss. Microsporidian parasites were found by light and electron m
The risk of transfusion-associated AIDS: offering patients an active role in their care.: Am J Med Qual. 1992 Winter;7(4):111-5. Unique Identifier : AIDSLINE MED/93113229; Shepherd LL; Robinson, Bradshaw & Hinson, Charlotte, NC 28246.; This article explores the duty of health care providers to inform patients of the risk of contracting AIDS through blood transfusions that may be necessitated by surgery or other forms of medical treatment. Although the quantitative risk of receiving HIV-contaminated blood in a transfusion is small, the qualitative ri
Cassia alata and the preclinical search for therapeutic agents for the treatment of opportunistic infections in AIDS patients.: Cell Mol Biol (Noisy-le-grand). 1992 Nov;38(7):799-802. Unique Identifier : AIDSLINE MED/93113268; Crockett CO; Guede-Guina F; Pugh D; Vangah-Manda M; Robinson TJ; Olubadewo JO; Ochillo RF; Laboratory of Pharmacology, Xavier University of Louisiana, New; Orleans 70125.; In our search for therapeutic agents from natural sources with potential for the treatment of opportunistic infections in patients afflicted with acquired immunodeficiency syndrome (AIDS), we investigated antibacterial and antifungal activities of water extracts of Cassia alata (C. alata). The extracts are traditional
HTLV-I induced extranodal lymphomas.: Leuk Lymphoma. 1992 May;7(1-2):37-45. Unique Identifier : AIDSLINE MED/93113298; Shimamoto Y; Yamaguchi M; Department of Internal Medicine, Saga Medical School, Japan.; HTLV-I induced not only nodal but also primary extranodal lymphomas. In this report we describe 12 patients with HTLV-I induced extranodal T-cell lymphoma collected from the literature and our institute experience. There were 5 males and 7 female patients of middle age positive for HTLV-I antibody. The sites of primar
Clinical and virological aspects of HIV2 infection in rhesus monkeys.: Cancer Detect Prev. 1992;16(5-6):341-5. Unique Identifier : AIDSLINE MED/93113651; Livartowski J; Dormont D; Boussin F; Chamaret S; Guetard D; Vazeux R; Lebon P; Metivier H; Montagnier L; CRSSA, DPS/SPE, Commissariat a l'Energie Atomique,; Fontenay-Aux-Roses, France.; To establish an animal model of AIDS, two different wild or adapted HIV2 Rod and Eho strains were cultivated on monkey cells from different species (baboons, cynomolgus, Rhesus monkeys). Five different available strains were then injected both by intravenous (i.v.) and intracerebral (i.c.) route into ten Rhesus monkey
Chronic fatigue syndrome: studies on skeletal muscle.: Clin Neuropathol. 1992 Nov-Dec;11(6):329-32. Unique Identifier : AIDSLINE MED/93113914; Grau JM; Casademont J; Pedrol E; Fernandez-Sola J; Cardellach F; Barros N; Urbano-Marquez A; Department of Internal Medicine, Hospital Clinic i Provincial,; Barcelona, Spain.; Chronic fatigue syndrome represents a poorly defined disease with protean clinical manifestations, the majority of them expressed as a muscle fatigue or as inability to maintain the expected muscle strength. In the present work we studied muscle function and muscle histopathology in 20 patients fulfilling the proposed
Diagnostic challenges: lymphotropic sero-questionables.: East Afr Med J. 1992 Oct;69(10):563-5. Unique Identifier : AIDSLINE MED/93114295; Fox E; Constantine NT; Rodier G; Abbatte EA; U.S. Naval Medical Research Unit No. 3, Cairo, Egypt.; During a sero-survey for lymphotropic retroviruses, seven screening tests were performed for the three lymphotropic retroviruses of relevance in Djibouti , East Africa (HIV-1, HIV-2 and HTLV-1). Of the 82 subjects whose sera reacted in at least one retroviral screening assay, abou
Phenotype of lymphocyte in ovarian tumor peritoneal fluid. A preliminary study.: Eur J Gynaecol Oncol. 1992;13(6):475-9. Unique Identifier : AIDSLINE MED/93114317; Lacki J; Markowska J; Wiktorowicz K; Cell. Immunol. Lab., University School of Medicine, Poznan.; Phenotype of lymphocytes was estimated in 16 peritoneal fluids obtained from 9 ovarian cancer patients. Peritoneal fluids contained predominantly T cells (more than 80%) while B cell content was relatively low. Approximately 50% lymphocytes carried T-helper cell marker (CD4). Percentage of T-cytotoxic/suppressor cells
The effects of HIV on hematopoiesis [letter]: Eur J Haematol. 1992 Nov;49(5):277-8. Unique Identifier : AIDSLINE MED/93114439; Odeh M
Immune signalling at the maternal-fetal interface and trophoblast differentiation.: Dev Comp Immunol. 1992 Nov-Dec;16(6):425-30. Unique Identifier : AIDSLINE MED/93114463; Wegmann TG; Guilbert LJ; Department of Immunology, University of Alberta, Edmonton,; Canada.; In this review the afferent and efferent signals involved in immune signalling at the maternal-fetal interface are highlighted in the light of recent information. MHC antigen expression is reviewed. Immunizing mothers against class I and II MHC antigens can prevent spontaneous fetal resorption in mice. In addition, th
Psychosocial issues in hemophilia before and after the HIV crisis: a review of current research.: Gen Hosp Psychiatry. 1992 Nov;14(6):387-403. Unique Identifier : AIDSLINE MED/93114609; Bussing R; Johnson SB; University of Florida, Department of Psychiatry, Gainesville.; The human immunodeficiency virus (HIV) has had a fundamental impact on quality of life, delivery of care, and directions of research efforts for the hemophilia community. Studies of psychosocial issues in hemophilia before and after the HIV crisis are reviewed. Before this crisis, research addressed personality factor
[HIV infection in pregnancy]: Harefuah. 1992 Nov 1;123(9):315-9, 372. Unique Identifier : AIDSLINE MED/93114671; Mankuta D; Holcberg G; Glezerman M; Dept. of Obstetrics and Gynecology, Soroka Medical Center, Beer; Sheba.; The epidemic of human immunodeficiency virus (HIV) is now affecting populations that were less susceptible in the early 1980s. It is estimated that 8% of patients with AIDS in the US are women in the reproductive age, and 1% are children. In Israel up to 1992, 134 women and 14 chil
Resurgence of tuberculosis.: Iowa Med. 1992 Oct;82(10):411-4. Unique Identifier : AIDSLINE MED/93114994; Hornick D; Schlesinger L; Wenzel R; University of Iowa College of Medicine.; Since 1985 there has been an 18% increase in the number of cases of tuberculosis nationally. Even more alarming is the increasing incidence of multidrug-resistant tuberculosis which presents a serious public health problem, particularly for HIV-infected patients.
A tetrazolium-based colorimetric assay for quantification of HIV-1-induced cytopathogenicity in monocyte-macrophages exposed to macrophage-colony-stimulating factor.: J Virol Methods. 1992 Dec 1;40(3):275-86. Unique Identifier : AIDSLINE MED/93115239; Bergamini A; Perno CF; Capozzi M; Mannella E; Salanitro A; Calio R; Rocchi G; Department of Public Health, University of Rome, Tor Vergata,; Italy.; A sensitive assay was developed for in vitro evaluation of anti-HIV agents in monocyte-macrophage cells (M/M) (a crucial target of HIV in the body). Monocyte-macrophage cells are usually poorly sensitive to the cytopathic effect induced by HIV. However, when fresh adherent monocyte-macrophage cells are cultured at rel
Performance of patients with early HIV-1 infection on the Stroop Task.: J Clin Exp Neuropsychol. 1992 Sep;14(5):857-68. Unique Identifier : AIDSLINE MED/93115260; Martin EM; Robertson LC; Edelstein HE; Jagust WJ; Sorensen DJ; San Giovanni D; Chirurgi VA; Department of Neurology, University of California-Davis.; HIV-seropositive and seronegative control subjects performed a standard paper-and-pencil version and an experimental reaction time version of the Stroop Color-Word Naming Task. Results indicated that both symptomatic and asymptomatic HIV-positive subjects showed an exaggerated Stroop effect compared to controls, but t
A simplified method for determination of peptide-protein molar ratios using amino acid analysis.: J Immunol Methods. 1992 Dec 8;156(2):137-49. Unique Identifier : AIDSLINE MED/93115458; Shuler KR; Dunham RG; Kanda P; Department of Virology and Immunology, Southwest Foundation for; Biomedical Research, San Antonio, TX 78228.; In this report, we have described methods to improve the efficiency of coupling synthetic peptides to keyhole limpet hemocyanin (KLH) and for the analysis of the composition of the resulting peptide-protein conjugates. KLH was first dissolved in buffers containing 3 M guanidine hydrochloride to maintain solubility and
A simultaneous three-color T cell subsets analysis with single laser flow cytometers using T cell gating protocol. Comparison with conventional two-color immunophenotyping method.: J Immunol Methods. 1992 Dec 8;156(2):151-62. Unique Identifier : AIDSLINE MED/93115459; Mandy FF; Bergeron M; Recktenwald D; Izaguirre CA; Division of Infectious Immunology, Bureau of Laboratories and; Research Services, Health and Welfare Canada, Ottawa, Ontario.; We describe a method for simultaneous analysis of CD3, CD4, and CD8 positive cells from whole blood utilizing single laser flow cytometers. All three T cell values are attained from a single test tube. CD4 and CD8 positive cells are identified only if they are CD3 positive. Thus the values obtained by this method for
New and uncommon vaccines.: J Infect. 1992 Nov;25(3):337-42. Unique Identifier : AIDSLINE MED/93115492; Jones GA; Regional Infectious Disease Unit, City Hospital, Edinburgh, U.K.
Serological response to purified mycobacterial phosphatidylinositol mannoside in healthy controls and in patients with tuberculosis and leprosy.: Int J Lepr Other Mycobact Dis. 1992 Sep;60(3):353-67. Unique Identifier : AIDSLINE MED/93115542; Mullins RJ; Fournie JJ; Moloney B; Baumgart K; Jones P; Brown P; Basten A; Centenary Institute of Cancer Medicine and Cell Biology,; University of Sydney, New South Wales, Australia.; The serological response to a monoclonal antibody-defined phosphatidylinositol mannoside (L4-PIM) present in all mycobacteria was examined in patients with various mycobacterial diseases and healthy subjects from different populations. IgG but not IgM antibodies were detected in most patients with untreated lepromatou
Managing some of the common opportunistic infections in advanced HIV infection.: J La State Med Soc. 1992 Oct;144(10):443-4. Unique Identifier : AIDSLINE MED/93115564; Brandon WR
Survival of persons with AIDS in Kentucky.: J Ky Med Assoc. 1992 Nov;90(11):548-54. Unique Identifier : AIDSLINE MED/93115571; Stapleton M; Adams K; Finger R; Of all reported Kentucky adult/adolescent cases of AIDS (124) with diagnosis dates from July 1, 1990, through June 30, 1991, 33% died within three months of diagnosis. To discern possible reasons for these very short survival times, information was analyzed from the CDC AIDS Confidential Case Report of the 124 patient
American medicine and the uphill struggle.: J Okla State Med Assoc. 1992 Jun;85(6):276. Unique Identifier : AIDSLINE MED/93115834; Funnell JD
Fungal infections in AIDS patients.: J Med Vet Mycol. 1992;30 Suppl 1:19-28. Unique Identifier : AIDSLINE MED/93115864; Dupont B; Graybill JR; Armstrong D; Laroche R; Touze JE; Wheat LJ; Pasteur Institute Hospital, Paris, France.
[Primary brain lymphoma in AIDS. 17 cases studied by MRI before stereotaxic biopsies]: J Radiol. 1992 Jun-Jul;73(6-7):367-76. Unique Identifier : AIDSLINE MED/93115964; Cordoliani YS; Derosier C; Pharaboz C; Jeanbourquin D; Schill H; Cosnard G; Service d'imagerie medicale, Hopital d'instruction des Armees; du Val-de-Grace, Paris.; AIM: Determining which semiological criteria might help to suggest lymphoma when an intracerebral mass in observed in a patient with AIDS. The use of these criteria might shorten the duration of the anti-toxoplasmic test treatment and to perform puncture earlier. The fast growth of the lymphomas may account for the ra
New approaches to the management of rheumatoid arthritis.: J Rheumatol. 1992 Nov;19 Suppl 36:2-8. Unique Identifier : AIDSLINE MED/93115985; Jaffe IA; Department of Medicine, Columbia University College of Physicians; and Surgeons, New York, NY.; The approach to the treatment of rheumatoid arthritis is currently undergoing fundamental change. The demonstration of erosions by magnetic resonance imaging early in the disease, when conventional radiographs only show soft tissue swelling, demands rapid intervention with more effective drugs. The increasing use of m
HIV infection in a patient with Meyer-Rokitansky-Kuster-Hauser syndrome.: J R Soc Med. 1992 Nov;85(11):706-7. Unique Identifier : AIDSLINE MED/93116018; Kell PD; Barton SE; Edmonds DK; Boag FC; John Hunter Clinic, St Stephen's Clinic, London.
HIV and the elderly [letter]: J R Soc Med. 1992 Nov;85(11):712. Unique Identifier : AIDSLINE MED/93116021; O'Neill D
[Urinary disturbance due to HTLV-1 associated myelopathy]: Nippon Hinyokika Gakkai Zasshi. 1992 Dec;83(12):2058-61. Unique Identifier : AIDSLINE MED/93116281; Sakiyama H; Nishi K; Kikukawa H; Ueda S; Department of Urology, Kumamoto University Medical School.; Patients with human T-cell lymphotropic virus type 1 associated myelopathy (HAM) have complaints of urinary disturbance frequently. Symptoms and urodynamic examinations were evaluated in untreated twenty-one patients with HAM. Although two cases (11%) had no urinary symptom, nineteen cases (89%) suffered from dysuria,
[Human immunodeficiency virus and acquired immunodeficiency syndrome: a new problem in transplantation]: Khirurgiia (Mosk). 1992 Sep-Oct;(9-10):87-90. Unique Identifier : AIDSLINE MED/93116372; Troshin AZ; Prianikov AE; Bronskaia LK
A simple method for overproduction and purification of p24 Gag protein of human immunodeficiency virus type 1.: Microbiol Immunol. 1992;36(8):823-31. Unique Identifier : AIDSLINE MED/93116635; Tanaka N; Saitoh A; Nakata A; Shinagawa H; Department of Experimental Chemotherapy, Osaka University, Japan.; A simple method for the overproduction in Escherichia coli and purification of major core protein p24 of human immunodeficiency virus type 1 (HIV-1) was described. The gag-pol region encoding p24, p15, and protease was fused to 3 end of lacZ gene on plasmid. A LacZ-Gag fusion protein, the major primary product, is de
A prospective study on correlation between the decrease in anti-P17 antibody level and progression to AIDS in asymptomatic carriers of HIV.: Microbiol Immunol. 1992;36(8):833-40. Unique Identifier : AIDSLINE MED/93116636; Choudhury AM; Yamada O; Wakamiya N; Kurimura T; Department of Pathology, Research Institute for Microbial; Diseases, Osaka, Japan.; As the majority of human immunodeficiency virus (HIV) carriers are in asymptomatic stage for a long period of time, it is important to investigate the factors or surrogate markers for conversion from asymptomatic to symptomatic stage. Our study is designed to evaluate the relationship among virus isolation rate, anti-
Spontaneous proliferation of HTLV-II-infected peripheral blood lymphocytes: HLA-DR-driven, IL-2-dependent response.: Microbiol Immunol. 1992;36(8):865-72. Unique Identifier : AIDSLINE MED/93116639; Lal RB; Hjelle B; Rudolph DL; Retrovirus Diseases Branch, Centers for Disease Control, Atlanta,; GA 30333.; Peripheral blood lymphocytes obtained from HTLV-II-infected persons (n = 13) and cultured in the absence of exogenous stimulator demonstrated augmented spontaneous proliferation (17,672 +/- 5,498 cpm) when compared with cells from healthy donors (1,921 +/- 1,306 cpm). Removal of non-T population did not abrogate the p
Pre-existing chronic infraepithelial Trichomonas invasion with consecutive immunodepression enables progression of human immunodeficiency virus: a new concept of acquired immunodeficiency syndrome pathogenesis.: Med Hypotheses. 1992 Nov;39(3):225-8. Unique Identifier : AIDSLINE MED/93116656; Krvavac S; Public Health Center Stari Grad, Sarajevo, Bosnia.; All three existing species of human trichomonads cause similar immune and histopathological host responses. The elicited crossimmunity causes interspecific competition of trichomonal infections in their typical localizations, which results in very rare simultaneous colonization of the same host by different species. T
An alternative to DNA extraction for the diagnosis of Pneumocystis carinii pneumonia by polymerase chain reaction using a new oligonucleotide probe.: Mol Cell Probes. 1992 Oct;6(5):361-5. Unique Identifier : AIDSLINE MED/93116703; Borensztein L; Hatin I; Simonpoli AM; Ugarte E; Girard PM; Jaureguiberry G; INSERM U.13, Hopital Claude Bernard, Paris, France.; We have used new specific primers and probe in a polymerase chain reaction (PCR) followed by Southern blot assays to detect Pneumocystis carinii in human bronchoalveolar lavage samples obtained from HIV-infected patients with pulmonary symptoms. To facilitate the procedure we developed a filtration technique without D
Detection of Mycobacterium leprae and the potential for monitoring antileprosy drug therapy directly from skin biopsies by PCR.: Mol Cell Probes. 1992 Oct;6(5):401-10. Unique Identifier : AIDSLINE MED/93116709; Williams DL; Gillis TP; Fiallo P; Job CK; Gelber RH; Hill C; Izumi S; G. W. Long Hansen's Disease Center, LSU SVM, Baton Rouge 70894.; An improved protocol for PCR analysis of Mycobacterium leprae-infected tissues, based on enzymatic lysis, has been developed and used to demonstrate the feasibility of using PCR for detecting M. leprae in routine skin biopsies taken from leprosy patients throughout the clinical spectrum. Of 92 multibacillary patients
HIV-1 promotor insertion revealed by selective detection of chimeric provirus-host gene transcripts.: Nucleic Acids Res. 1992 Dec 11;20(23):6261-6. Unique Identifier : AIDSLINE GENBANK/X68242; Raineri I; Senn HP; Institute for Medical Microbiology, University of Basel,; Switzerland.; To study host gene activation by retroviral promotor insertion, a polymerase chain reaction (PCR) assay was developed. This method allows a sensitive and selective detection of chimeric provirus-host gene transcripts, hallmarks of insertional activation events, which does not rely on an induction of tumor cell growth.
Transferable deaths during 1990 for residents of Camberwell Health Authority.: Public Health. 1992 Nov;106(6):449-56. Unique Identifier : AIDSLINE MED/93117320; Doyle YG; Conway M; Camberwell Health Authority/South East London Commissioning; Agency, London.; Almost one quarter of all deaths among residents of Camberwell District Health Authority during 1990 occurred without the district ( transferable deaths ). These deaths differed from total deaths in that the main cause of study deaths was cancer, and many of these cases died in a hospice with which the district has no
[AIDS and HIV infection--1990]: Przegl Epidemiol. 1992;46(1-2):137-45. Unique Identifier : AIDSLINE MED/93117390; Szata W
[Diagnostic value of antibodies against HIV-1 proteins in seropositive drug addicts tested by the western blotting method]: Przegl Epidemiol. 1992;46(1-2):19-25. Unique Identifier : AIDSLINE MED/93117392; Swiderska H; Kalinowska B; Zaklad Immunopatologii Panstwowego Zakladu Higieny, Warszawie.; The incidence of various patterns of antibodies against HIV 1 proteins was tested by Western blot in EIA--positive serum samples from intravenous drug abusers. The presence of anti-p24, anti-gp160 and anti-gp120 antibodies was the most typical pattern suggestive for early humoral response. In most instances of indeter
New tests produced by Organon Teknika for the diagnosis of antibodies to HIV-1 and HIV-2.: Przegl Epidemiol. 1992;46(1-2):3-10. Unique Identifier : AIDSLINE MED/93117394; Chantrain C; Organon Teknika International Turnhout, Belgique.
[Candida laryngitis and HIV infection: description of 4 cases]: Rev Clin Esp. 1992 Oct;191(5):261-3. Unique Identifier : AIDSLINE MED/93117454; Roig P; Carrasco R; Salavert M; Navarro V; Guix J; Nieto A; Bernacer B; Seccion de enfermedades infecciosas, Hospital General; Universitario de Valencia Hospital Clinico Universitario de; Valencia.; Candidiasic laryngitis is a very rare Candida spp infection of mucosa, appearing typically in immunosuppressed patients, mainly in patients with neoplasia, and, recently, in patients with Human Immunodeficiency Virus (VIH) infection. We present four cases of candidiasic laryngitis and HIV infection, as well as the cli
[Psoriasis and progressive multifocal leukoencephalopathy in AIDS (letter++)]: Rev Clin Esp. 1992 Oct;191(5):285-6. Unique Identifier : AIDSLINE MED/93117465; Cotone C; Lucentini M; Garcia G; Anibal Molina H
[Burkitt's lymphoma and acquired immunodeficiency syndrome. Presentation as obstructive renal insufficiency (letter)]: Rev Clin Esp. 1992 Nov;191(7):393. Unique Identifier : AIDSLINE MED/93117481; Niso Hernandez JJ; Perez Ortola R; Cia Ruiz J; Merino Angulo A
[Gerstmann's syndrome and progressive multifocal leukoencephalopathy in a patient with AIDS (letter)]: Rev Clin Esp. 1992 Nov;191(7):396-7. Unique Identifier : AIDSLINE MED/93117486; Iranzo D; Romeu J; Castellote E; Coll J
[Occurrence of pneumothorax and pneumomediastinum in a patient with AIDS and pulmonary infection caused by Pneumocystis carinii and Cryptococcus neoformans (letter; comment)]: Rev Clin Esp. 1992 Nov;191(7):397-8. Unique Identifier : AIDSLINE MED/93117487; Alonso-Villaverde C; Hernandez-Flix S; Tomas R; Masana L
[Doppler echocardiography assessment of cardiac abnormalities in parenteral drug addicts]: Rev Esp Cardiol. 1992 Nov;45(9):554-9. Unique Identifier : AIDSLINE MED/93117506; Almenar L; Sotillo J; Osa A; Fenollosa B; Perello A; Moreno MT; Salvador A; Lopez-Aldeguer J; Algarra F; Servicio de Cardiologia, Hospital La Fe, Valencia.; We studied by Echocardiographic-Doppler 114 consecutive intravenous drugs addicts (IVDA); 91 were positive human immunodeficiency virus (HIV+) and 23 negatives. We classified them in five groups; beginning the negative HIV as group 0, and groups I to IV stratified according the Central Disease Control (CDC) classifica
[The difficult diagnosis of tuberculosis]: Schweiz Rundsch Med Prax. 1992 Dec 22;81(52):1561-4. Unique Identifier : AIDSLINE MED/93117629; Brandli O; Zurcher Hohenklinik, Faltigberg-Wald.; In spite of alarming reports from third world and industrialized countries, no increase in the incidence of tuberculosis has been seen in Switzerland . This is mainly attributable to the consistently performed initial treatment with a multiple-drug combination and the good comp
Aspects of comfort and safety of condom. A study of two thousand intercourses among volunteer couples.: Scand J Soc Med. 1992 Dec;20(4):247-52. Unique Identifier : AIDSLINE MED/93117777; Boldsen JL; Jeune B; Madsen PC; Institute of Community Health, University of Odense, Denmark.; In nearly 2,000 intercourses 14 different types of condoms were tested by 80 heterosexual and seven homosexual volunteer couples. The test couples were generally quite experienced in the use of condoms. It appears that the condoms rarely (1.3%) ruptured or slipped off during the actual intercourse. This means that emp
Ocular syphilis.: Surv Ophthalmol. 1992 Nov-Dec;37(3):203-20. Unique Identifier : AIDSLINE MED/93117978; Margo CE; Hamed LM; Department of Ophthalmology, University of Florida College of; Medicine, Gainesville.; There has been a steady increase in the number of cases of syphilis in the United States since the middle 1980s, with a dramatic rise in incidence among heterosexual men and women and of congenital syphilis. There also have been changes in geographic distribution of cases and an associ
Aspects of tuberculosis in Africa. 1. Tuberculosis in Africa in the AIDS era--the role of chemoprophylaxis [see comments]: Trans R Soc Trop Med Hyg. 1992 Sep-Oct;86(5):467-9. Unique Identifier : AIDSLINE MED/93118113; Porter JD; McAdam KP; Department of Clinical Sciences, London School of Hygiene and; Tropical Medicine, UK.; An estimated 2.8 million people in Africa have dual infections with tuberculosis and human immunodeficiency virus (HIV). Because of the increasing numbers of cases of tuberculosis as a consequence of the HIV epidemic, chemoprophylaxis may become a cost effective tuberculosis control measure in high prevalence countrie
Aspects of tuberculosis in Africa. 2. The value of microbiology in the management of tuberculosis in Nairobi, Kenya.: Trans R Soc Trop Med Hyg. 1992 Sep-Oct;86(5):470-1. Unique Identifier : AIDSLINE MED/93118114; Brindle R; Wellcome Trust Research Laboratories, Nairobi, Kenya.; A group of African patients with tuberculosis were followed over the first month of treatment to assess the bactericidal response to 2 treatment regimens (streptomycin/thiacetazone/isoniazid and streptomycin/rifampicin/isoniazid/pyrazinamide). Patients also infected with human immunodeficiency virus (HIV) had lower pr
Cellular and humoral immune responses of a patient with American cutaneous leishmaniasis and AIDS.: Trans R Soc Trop Med Hyg. 1992 Sep-Oct;86(5):511-2. Unique Identifier : AIDSLINE MED/93118127; Da-Cruz AM; Machado ES; Menezes JA; Rutowitsch MS; Coutinho SG; Instituto Oswaldo Cruz, Rio de Janeiro, Brazil.; The lymphocyte responsiveness to leishmanial antigens and its influence on the course of cutaneous leishmaniasis was studied in a patient with AIDS-associated American cutaneous leishmaniasis caused by Leishmania braziliensis. The patient had cutaneous disseminated erythematous papules or nodules and mucosal lesions a
Isolation of Leishmania infantum from the blood of a patient with AIDS using sandflies.: Trans R Soc Trop Med Hyg. 1992 Sep-Oct;86(5):516. Unique Identifier : AIDSLINE MED/93118130; Molina R; Lopez-Velez R; Gutierrez-Solar B; Jimenez I; Alvar J; Servicio de Parasitologia, Centro Nacional de Microbiologia,; Instituto de Salud Carlos III, Majadahonda, Madrid, Spain.
Intestinal parasites in Zambian patients with AIDS.: Trans R Soc Trop Med Hyg. 1992 Sep-Oct;86(5):543-5. Unique Identifier : AIDSLINE MED/93118140; Hunter G; Bagshawe AF; Baboo KS; Luke R; Prociv P; Department of Parasitology, University of Queensland, Australia.; Previous studies have found a high prevalence of Isospora belli and Cryptosporidium parvum infections in African acquired immune deficiency syndrome (AIDS) patients with chronic diarrhoea. We aimed to determine the prevalence of gastrointestinal parasite in AIDS patients in hospital, not only those with diarrhoea, and
The presence of antibodies to purified p24gag protein of HTLV-I in sera of patients with systemic lupus erythematosus (SLE).: Virus Genes. 1992 Nov;6(4):357-64. Unique Identifier : AIDSLINE MED/93118244; Higashi J; Kumagai S; Hatanaka M; Imura H; Department of Second Internal Medicine, Faculty of Medicine,; Kyoto University, Japan.; Sera of patients with systemic lupus erythematosus (SLE) were tested for their reactivity to HTLV-I by western blotting (WB). Seven (18%) of 40 SLE serum samples reacted to the p24gag protein of HTLV-I by WB using purified gag antigens. The specificity of anti-p24gag antibodies in the SLE sera was confirmed by competi
The effect of human immunodeficiency virus infection on the distribution and outcome of pneumonia in intensive care units.: West J Med. 1992 Dec;157(6):637-40. Unique Identifier : AIDSLINE MED/93118291; Tucker KJ; Anton B; Tucker HJ; Intensive Care Unit, California Pacific Medical Center, San; Francisco.; To determine the frequency and distribution of pneumonia in an intensive care unit (ICU), we retrospectively examined the records of 1,854 consecutive ICU admissions between January 1987 and April 1990. A total of 266 patients met criteria for pneumonia (unilateral or bilateral infiltrate by chest roentgenogram, plus
Pseudothrombocytopenia in a child with the acquired immunodeficiency syndrome.: West J Med. 1992 Dec;157(6):668-70. Unique Identifier : AIDSLINE MED/93118304; Wong VK; Robertson R; Nagaoka G; Ong E; Petz L; Stiehm ER; Department of Pediatrics, Southern California Permanente Medical; Group, Bellflower.
Thin-walled lung cavities and cysts due to AIDS-related pulmonary infection.: West J Med. 1992 Dec;157(6):675-6. Unique Identifier : AIDSLINE MED/93118307; Padmanabhan K; Vora S; Pulmonary Disease Department, Coney Island Hospital, Brooklyn,; New York 11235.
State AIDS drug program expansion [letter]: West J Med. 1992 Dec;157(6):683. Unique Identifier : AIDSLINE MED/93118314; Sauseda WE
Failure of therapy for tuberculosis in human immunodeficiency virus infection.: Am J Med Sci. 1992 Sep;304(3):168-73. Unique Identifier : AIDSLINE MED/93118676; Nolan CM; Seattle-King County Department of Public Health, University of; Washington, Seattle 98104.; Optimum treatment of tuberculosis in persons with human immunodeficiency virus (HIV) infection is still being defined. Tuberculosis treatment failure in an HIV-infected patient is described and 10 similar cases from the medical literature are reviewed to search for common patterns associated with an adverse outcome of
HIV and skin disease: the molecular biology of the human immunodeficiency virus.: Am J Med Sci. 1992 Sep;304(3):180-7. Unique Identifier : AIDSLINE MED/93118678; Duvic M; University of Texas Medical School, M. D. Anderson Cancer Center,; Houston 77030.; The human immunodeficiency virus (HIV) is a member of a family of retroviruses that cause chronic persistent infections in animals and in humans. The structure of this virus resembles that of other retroviruses but also contains important and complex regulatory elements. The expression of HIV can be influenced by the
AIDS in Romania.: Am J Med Sci. 1992 Sep;304(3):188-91. Unique Identifier : AIDSLINE MED/93118679; Nedelcu I; Department of Dermatology, Central Military Hospital, Bucharest,; Romania.; Of the 1446 AIDS cases reported in Romania , 79% were in the pediatric age group. Of these children, 28% lived with their families, 30% were orphans, and 42% were abandoned. Among the AIDS-affected children, 32% were less than 1 year old and 67% were 1-4 years old. The natural hist
[Systemic candidiasis]: Ann Fr Anesth Reanim. 1992;11(5):558-75. Unique Identifier : AIDSLINE MED/93118969; Lelarge P; Mariot J; Departement d'Urgence et de Reanimation, Hopital Central,; Nancy.; Candida proliferate within the body of patients with deficient cellular immunity either by the haematogenous route or by adjacency. This condition is often found in hospital patients. It explains the increasing incidence of disseminated candidiasis. They are preferentially found in patients who have had complicated su
Presence of human immunodeficiency virus nucleic acids in wastewater and their detection by polymerase chain reaction.: Appl Environ Microbiol. 1992 Dec;58(12):3984-90. Unique Identifier : AIDSLINE MED/93119153; Ansari SA; Farrah SR; Chaudhry GR; Department of Biological Sciences, Oakland University, Rochester,; Michigan 48309.; The human immunodeficiency virus type 1 (HIV-1) released by infected individuals or present in human and hospital wastes can potentially cause contamination problems. The presence of HIV-1 was investigated in 16 environmental samples, including raw wastewater, sludge, final effluent, soil, and pond water, collected fr
Collaboration as a strategy for acquired immunodeficiency syndrome prevention.: Arch Psychiatr Nurs. 1992 Dec;6(6):331-9. Unique Identifier : AIDSLINE MED/93119178; Kavanagh KH; Harris RM; Hetherington SE; Scott DE; School of Nursing, University of Maryland, Baltimore.; An eight-session training model used a social interactive framework to combine theoretical and methodological aspects of peer counseling, cross-cultural communication, and transcultural nursing, with a conviction that the participants (volunteers from an ongoing, urban methadone maintenance program) had significant st
[What is the mode of transmission for HTLV-I infection in Central Africa?]: Ann Soc Belg Med Trop. 1992 Sep;72(3):229-32. Unique Identifier : AIDSLINE MED/93119191; Louis JP; Gardon J; Migliani R; Louis FJ; Trebucq A; Rey JL; Secretariat Generale de l'OCEAC, Yaounde, Cameroun.
[HIV infection in Libreville, Gabon. Developments from 1986 to 1991]: Ann Soc Belg Med Trop. 1992 Sep;72(3):233-5. Unique Identifier : AIDSLINE MED/93119192; Louis JP; Trebucq A; Hamono B; Atende C; Hengy C; Martin-Prevel Y; Louis FJ; Delaporte E; Secretariat General de l'OCEAC, Yaounde, Cameroun.
Anxiety, depression and HIV related symptomatology across the spectrum of HIV disease.: Aust N Z J Psychiatry. 1992 Dec;26(4):560-6. Unique Identifier : AIDSLINE MED/93119343; Perdices M; Dunbar N; Grunseit A; Hall W; Cooper DA; National Centre in HIV Epidemiology and Clinical Research,; University of New South Wales, Sydney.; Levels of anxiety and depression were assessed for 207 HIV seropositive homosexual/bisexual men (AIDS = 34, ARC = 72, asymptomatic HIV infection = 101), and 36 seronegative controls. Lymphocyte subset enumeration, history of opportunistic infections, and occurrence of HIV-related symptoms were recorded at the time of
Double-stranded DNA sequencing by linear amplification with Taq DNA polymerase.: Biotechniques. 1992 Oct;13(4):527-30. Unique Identifier : AIDSLINE MED/93119611; Wang B; Fang Q; Williams WV; Weiner DB; Wistar Institute of Anatomy and Biology, Philadelphia, PA 19104.
HIV/AIDS: Caught in the Act.: Nurs Stand. 1992 Nov 25-Dec 1;7(10):18-9. Unique Identifier : AIDSLINE MED/93119836; Alderman C
Erythema dyschromicum perstans in an HIV antibody-positive man [letter]: Br J Dermatol. 1992 Dec;127(6):658-9. Unique Identifier : AIDSLINE MED/93119895; Nelson MR; Lawrence AG; Staughton RC; Gazzard BG
Disseminated cutaneous sporotrichosis associated with anergic immuno-suppression due to miliary tuberculosis.: West Afr J Med. 1992 Jul-Sep;11(3):216-20. Unique Identifier : AIDSLINE MED/93119933; Addy JH; University of Ghana Medical School Accra.; A 52-years-old policeman suffering from tuberculous meningitis, developed pseudo-umbilicated nodular skin lesions which increased rapidly in size during the course of his illness. Histology revealed cutaneous sporotrichosis. Human immuno-deficiency virus infection was excluded by absence of history of exposure and rep
Strategies to contain the spread of AIDS: A review.: West Afr J Med. 1992 Jul-Sep;11(3):226-33. Unique Identifier : AIDSLINE MED/93119936; Okpara RA; Department of Medicine, Central Hospital Owerri Imo State,; Nigeria.; An attempt has been made to review the available strategies to contain the spread of the Acquired Immunodeficiency Syndrome (AIDS). Also options for clinical management of AIDS patients are summarized. Development and production of a suitable vaccine is the ultimate goal in the attempts to stop the spread of AIDS. Th
Primary uveal B immunoblastic lymphoma in a patient with AIDS.: Br J Ophthalmol. 1992 Nov;76(11):700-2. Unique Identifier : AIDSLINE MED/93120027; Hofman P; Le Tourneau A; Negre F; Michiels JF; Diebold J; Department of Pathology, Hopital Pasteur, Nice, France.; A case of primary intraocular malignant lymphoma without cerebral involvement is reported in a 30-year-old man with acquired immunodeficiency syndrome. The study of the enucleation specimen showed a B immunoblastic lymphoma with a CD30 positive anaplastic large cell component. There was no involvement of the adnexal s
HTLV-I associated gastric lymphoma.: Zentralbl Pathol. 1992 Nov;138(5):351-4. Unique Identifier : AIDSLINE MED/93120067; Kojima H; Ikeda H; Kubo T; Higuchi A; Fujimoto N; Nishibe M; Nagashima K; Department of Pathology, Kushiro Rohsai Hospital, Japan.; A large gastric lymphoma was detected in a 42-year-old woman who was seropositive for HTLV-I. The tumor was histologically shown to be of diffuse large cell type, and phenotypic analysis revealed high expression of CD3 and CD4, indicative of a helper/inducer type of T-cell lymphoma. In Southern blot analyses, the tumo
Evaluation of new anti-infective drugs for the treatment of chancroid. Infectious Diseases Society of America and the Food and Drug Administration.: Clin Infect Dis. 1992 Nov;15 Suppl 1:S108-14. Unique Identifier : AIDSLINE MED/93120383; Ronald AR; Corey L; McCutchan JA; Handsfield HH; Department of Internal Medicine, University of Manitoba,; Winnipeg, Canada.; Chancroid is a mucocutaneous infection caused by Haemophilus ducreyi that produces ulcerative lesions and enhances the efficiency of transmission of human immunodeficiency virus (HIV). Confirmation of infection by culture of H. ducreyi is essential in therapeutic trials. Minimal inhibitory concentrations of antibiotic
Evaluation of new anti-infective drugs for the treatment of syphilis. Infectious Diseases Society of America and the Food and Drug Administration.: Clin Infect Dis. 1992 Nov;15 Suppl 1:S140-7. Unique Identifier : AIDSLINE MED/93120387; Ronald AR; Silverman M; McCutchan JA; Corey L; Handsfield HH; Department of Internal Medicine, University of Manitoba,; Winnipeg, Canada.; Syphilis is caused by Treponema pallidum, a spirochetal bacterium pathogenic only for humans. The clinical course of disease is divided into three stages interspersed by periods of latency. Penicillin remains the treatment of choice for all stages of infection; tetracycline or erythromycin may be used as therapeutic a
Evaluation of new anti-infective drugs for the treatment of toxoplasma encephalitis. Infectious Diseases Society of America and the Food and Drug Administration.: Clin Infect Dis. 1992 Nov;15 Suppl 1:S200-5. Unique Identifier : AIDSLINE MED/93120397; Sande MA; Whitley RJ; McCracken GH; Lentnek A; Scheld WM; Department of Medicine, San Francisco General Hospital,; California.; Toxoplasma gondii is a protozoan that exists in three forms, all of which are potentially infectious for humans. After acute infection, cysts persist in the central nervous system and extraneural tissue. Human hosts with compromised immunity, particularly those with the acquired immunodeficiency syndrome, are vulnerab
Evaluation of new antifungal drugs for the treatment of systemic fungal infections. Infectious Diseases Society of America and the Food and Drug Administration.: Clin Infect Dis. 1992 Nov;15 Suppl 1:S274-81. Unique Identifier : AIDSLINE MED/93120409; Medoff G; Dismukes WE; Pappagianis D; Diamond R; Gallis HA; Drutz D; Infectious Diseases Division, Washington University School of; Medicine, St. Louis, Missouri 63110.; These guidelines are applicable to all fungal pathogens that produce systemic infections in humans. Specific examples are provided whenever they might clarify special issues. Systemic fungal infections usually are divided into two broad categories: endemic systemic fungal diseases, which occur classically in healthy h
Evaluation of new anti-infective drugs for the treatment and prevention of infections caused by the Mycobacterium avium complex. Infectious Diseases Society of America and the Food and Drug Administration.: Clin Infect Dis. 1992 Nov;15 Suppl 1:S296-306. Unique Identifier : AIDSLINE MED/93120411; Hopewell P; Cynamon M; Starke J; Iseman M; O'Brien R; Chest Service, San Francisco General Hospital, California 94110.; The bacteria of the Mycobacterium avium complex are ubiquitous; thus it is often difficult to distinguish environmental contamination from colonization or infection. Patients with either pulmonary or disseminated infection may be enrolled in clinical trials. Disseminated disease occurs mostly in patients infected with
Evaluation of new anti-infective drugs for the treatment of genital infections due to herpes simplex virus. Infectious Diseases Society of America and the Food and Drug Administration.: Clin Infect Dis. 1992 Nov;15 Suppl 1:S99-107. Unique Identifier : AIDSLINE MED/93120422; Corey L; McCutchan JA; Ronald AR; Handsfield HH; Department of Medicine, University of Washington School of; Medicine, Seattle.; This guideline addresses clinical trials of new therapies for genital infections due to herpes simplex virus (HSV). Of the two types of virus, HSV-2 is the more common pathogen. Both HSV-1 and HSV-2 become latent in sacral nerve root ganglia and intermittently reactivate. Patients who have frequent recurrences (more t
Immunization of SCID-Hu mice and generation of anti-hepatitis B surface antigen-specific hybridomas by electrofusion.: Hum Antibodies Hybridomas. 1992 Oct;3(4):201-5. Unique Identifier : AIDSLINE MED/93120481; Neil GA; Sammons DW; Department of Internal Medicine, University of Iowa, Iowa City; 52242.; Human hybridomas with specificity for recombinant hepatitis B surface antigen (HBSAg) were produced by adoptive transfer of human peripheral blood mononuclear cells prepared from HBSAg-immune donors to CB.17 mice bearing the severe combined immunodeficiency (SCID) phenotype. A total of ten SCID-Hu mice were immunized
Chronic lactic acidosis in a patient with acquired immunodeficiency syndrome and mitochondrial myopathy: biochemical studies.: J Am Soc Nephrol. 1992 Dec;3(6):1212-9. Unique Identifier : AIDSLINE MED/93120497; Gopinath R; Hutcheon M; Cheema-Dhadli S; Halperin M; Department of Medicine, University of Toronto, Ontario, Canada.; A 30-yr-old man with acquired immunodeficiency syndrome treated with zidovudine developed biopsy-proven mitochondrial myopathy. Chronic lactic acidosis (lactate, 10 +/- 1 mmol/L) persisted for more than 5 wk. Liver function tests were normal, but the concentration of lactose rose to 16.1 mmol/L when 500 mmol of ethano
Flow cytometric evaluation of cytotoxic peripheral blood lymphocytes in acute renal graft rejection.: J Am Soc Nephrol. 1992 Dec;3(6):1220-6. Unique Identifier : AIDSLINE MED/93120498; Sridhar NR; Blanton M; Whitacre L; Balakrishnan K; First MR; Division of Nephrology and Hypertension, University of Cincinnati; Medical Center, OH 45267-0585.; The presence of the S6F1+ epitope on the surface of CD8+ lymphocytes is believed to be uniquely representative of cytotoxic subpopulations. A preliminary study was conducted to evaluate the CD8+ S6F1+ peripheral lymphocytes by flow cytometry in patients undergoing renal allograft biopsy for allograft dysfunction. Lymp
Cavitating Pneumocystis pneumonia in an autopsied case of adult T-cell leukemia [published erratum appears in Int J Hematol 1993 Apr;57(2):189]: Int J Hematol. 1992 Dec;56(3):233-7. Unique Identifier : AIDSLINE MED/93120526; Marutsuka K; Suzumiya J; Sumiyoshi A; First Department of Pathology, Miyazaki Medical College, Japan.; Cavitating necrosis is rare in Pneumocystis carinii pneumonia. In this report, we describe an autopsy patient with adult T-cell leukemia associated with cavitating Pneumocystis carinii pneumonia. The patient, a 61-year-old woman, died of an acute crisis of adult T-cell leukemia associated with diffuse pulmonary infect
Misbehaviour of a dying epidemic: a call for less speculation and better surveillance [editorial]: Tuber Lung Dis. 1992 Aug;73(4):181-3. Unique Identifier : AIDSLINE MED/93120595; Rieder HL
Humoral response to Mycobacterium tuberculosis in patients with human immunodeficiency virus infection.: Tuber Lung Dis. 1992 Aug;73(4):187-91. Unique Identifier : AIDSLINE MED/93120597; Barrera L; de Kantor I; Ritacco V; Reniero A; Lopez B; Benetucci J; Beltran M; Libonatti O; Padula E; Castagnino J; et al; National Institute of Microbiology, Buenos Aires, Argentina.; The effect of the human immunodeficiency virus (HIV) on mycobacterial antibody production was investigated. Using an enzyme-linked immunosorbent assay (ELISA) for detecting IgG against Mycobacterium tuberculosis PPD, it was observed that individuals at risk of HIV infection show a pattern of humoral response to the tu
HIV-related tuberculosis in England and Wales.: Tuber Lung Dis. 1992 Aug;73(4):200-2. Unique Identifier : AIDSLINE MED/93120599; Nisar M; Narula M; Beeching N; Davies PD; Tuberculosis Research Unit, Sefton General Hospital, Liverpool,; UK.; Numbers of tuberculosis notifications in England and Wales increased by 8% from 1987 to 1989. An analysis of notifications by age and sex has been undertaken to determine whether this increase has been due to an increase in young male adults, as has occurred in the USA, implying that HIV is largely responsible for the
Cohort study of HIV-positive and HIV-negative tuberculosis, Nairobi, Kenya: comparison of bacteriological results.: Tuber Lung Dis. 1992 Aug;73(4):203-9. Unique Identifier : AIDSLINE MED/93120600; Githui W; Nunn P; Juma E; Karimi F; Brindle R; Kamunyi R; Gathua S; Gicheha C; Morris J; Omwega M; Kenya Medical Research Institute, Nairobi.; We have set up a cohort of human immunodeficiency virus (HIV) positive and negative patients with tuberculosis in order to address the problems associated with HIV-related tuberculosis. We present here the results of sputum smear microscopy, culture, mycobacterial identification tests and drug susceptibility assays fr
Use of resterilizable plastic syringes for HIV prevention in tuberculin testing. Experience in Nepal [letter]: Tuber Lung Dis. 1992 Aug;73(4):244. Unique Identifier : AIDSLINE MED/93120609; Smith I
AIDS patients [letter]: R I Med. 1992 Oct;75(10):475. Unique Identifier : AIDSLINE MED/93120649; Schechter S
Prolonged recurrence of pentamidine-induced torsades de pointes.: Ann Pharmacother. 1992 Nov;26(11):1365-9. Unique Identifier : AIDSLINE MED/93120682; Cortese LM; Gasser RA Jr; Bjornson DC; Dacey MJ; Oster CN; Henry M. Jackson Foundation, Walter Reed Army Medical Center,; Washington, DC 20307.; OBJECTIVE: To report a case of recurrent pentamidine-induced torsades de pointes (TdP) and to review previously reported cases in the literature. DATA SOURCES: Medical records of the subject patient, case reports, and relevant studies identified by MEDLINE. DATA EXTRACTION: Data were abstracted from pertinent publishe
Changes in pentamidine monitoring following educational interventions [letter]: Ann Pharmacother. 1992 Nov;26(11):1458-9. Unique Identifier : AIDSLINE MED/93120704; Martins AM; Brown GR
Clinical application of the polymerase chain reaction for a rapid diagnosis of Mycobacterium tuberculosis infection.: Intern Med. 1992 Aug;31(8):1016-22. Unique Identifier : AIDSLINE MED/93120710; Kikuchi Y; Oka S; Kimura S; Mitamura K; Shimada K; Department of Infectious Diseases, University of Tokyo, Japan.; A gene amplification method of Mycobacterium tuberculosis DNA by the polymerase chain reaction (PCR) has been devised. A primer pair used in this study is 5 GTTGCCGTGGCGG TATCGG3 and 5 GCGACATTACGGGGCAGGTGG3 , which brackets a 152-base region encoding the 65KD antigen, and a specific probe is 5 TTTGGGGTCATCTTTGGAGCG3
Lymphocyte subsets in muscle biopsies of human T-lymphotropic virus type I carriers with polymyositis.: Intern Med. 1992 Aug;31(8):973-7. Unique Identifier : AIDSLINE MED/93120724; Ijichi T; Higuchi I; Fukunaga H; Izumo S; Osame M; Third Department of Internal Medicine, Faculty of Medicine,; Kagoshima University, Japan.; Recent epidemiologic studies have shown that human T-lymphotropic virus type I (HTLV-I) is associated with polymyositis. To clarify the histological features of HTLV-I positive polymyositis, we studied muscle tissue from two groups of patients with polymyositis, those seropositive for HTLV-I (5 patients) and those ser
[Abnormality of T lymphocyte subsets in aged persons with kidney deficiency syndrome and its influence on immunologic regulation]: Chung Kuo Chung Hsi I Chieh Ho Tsa Chih. 1992 Aug;12(8):478-9, 453-4. Unique Identifier : AIDSLINE MED/93120817; Fan GR; Affiliated Subei People's Hospital of Yang Zhou Medical College,; Jiangsu.; T lymphocyte subsets were investigated in 57 aged persons with Kidney Deficiency Syndrome as well as in 30 normal controls with application of the monoclonal antibody (OKT3, OKT4, OKT8). The results showed that the percentage of OKT3, OKT4 in the aged persons was significantly lower than that of control (P
About turn in US on interferon alfa [news]: BMJ. 1992 Nov 21;305(6864):1243-4. Unique Identifier : AIDSLINE MED/93120933; Roberts J
Multiple-stimulus presentation and voice control in automated perimetry.: Ger J Ophthalmol. 1992;1(2):91-5. Unique Identifier : AIDSLINE MED/93121022; Mueller AJ; Lachenmayr BJ; Eckstein A; Holzl M; Universitats-Augenklinik, Munchen, Federal Republic of Germany.; In all, 55 eyes of 55 patients were examined prospectively in random order with the Humphrey field analyzer [central field 76 points, full threshold strategy, single-stimulus presentation, response-button control (HFA 1); central field 76 points, defect-depth strategy, response-button control (HFA 2)] and the Dicon TK
Quantitative RNA and DNA gene amplification can rapidly monitor HIV infection and antiviral activity in cell cultures.: PCR Methods Appl. 1992 May;1(4):257-62. Unique Identifier : AIDSLINE MED/93121055; Winters MA; Holodniy M; Katzenstein DA; Merigan TC; Center for AIDS Research, Stanford University Medical Center,; California 94305-5107.; We have developed a quantitative gene amplification procedure to assess the replication of human immunodeficiency virus (HIV) in cell cultures and evaluate the effect of drugs on viral replication. Increases in HIV gag RNA and DNA in phytohemagglutinin-stimulated normal peri-pheral blood mononuclear cells (PBMC) infec
Improved blood sample processing for PCR.: PCR Methods Appl. 1992 Nov;2(2):149-53. Unique Identifier : AIDSLINE MED/93121074; Casareale D; Pottathil R; Diaco R; Roche Molecular Systems, Branchburg, New Jersey 08876-1760.; To simplify our procedure for blood sample processing for PCR, we introduced a simpler, shorter, and more cost-effective method for the separation of peripheral blood lymphocytes (PBL) and DNA extraction for amplification with Taq polymerase. By this method, blood samples are processed in two simple 15-min steps: (1)
Home study C.E.: tuberculosis--Part I (continuing education credit).: Calif Nurse. 1992 Nov-Dec;88(10):10-1. Unique Identifier : AIDSLINE MED/93121223; Hughes AM; Gillen M
Age dependency of features in HIV infected children [letter; comment]: Cent Afr J Med. 1992 Jul;38(7):314. Unique Identifier : AIDSLINE MED/93121362; Dahlin K
HIV and breast-feeding [news]: Cent Afr J Med. 1992 Jul;38(7):314-5. Unique Identifier : AIDSLINE MED/93121363
Pneumonia complicating pregnancy.: Clin Chest Med. 1992 Dec;13(4):679-91. Unique Identifier : AIDSLINE MED/93121712; Rodrigues J; Niederman MS; State University of New York, Stony Brook.; Although pregnancy is infrequently complicated by pneumonia, lung infection by bacteria, viruses, and fungi can pose serious maternal and fetal hazards. Pneumonia may lead to preterm labor and certain infecting agents, most notably the HIV virus, can cross the placenta and lead to neonatal infection. There is some evi
Implementing HIV protection regulations is nursing's next challenge.: Crit Care Nurse. 1992 Oct;12(7):104-5. Unique Identifier : AIDSLINE MED/93121791; Kalowes P
It's time to face the enemy--together.: Crit Care Nurse. 1992 Oct;12(7):112. Unique Identifier : AIDSLINE MED/93121792; Fassbinder B
AIDS: what are critical care nurses' concerns? [see comments]: Crit Care Nurse. 1992 Oct;12(7):23-9. Unique Identifier : AIDSLINE MED/93121794; Scherer YK; Haughey BP; Wu YW; Kuhn MM
If you tested HIV-positive, would you inform your colleagues of your status?: Crit Care Nurse. 1992 Oct;12(7):82, 84. Unique Identifier : AIDSLINE MED/93121800
Amsterdam AIDS conference reveals slow progress [news]: Crit Care Nurse. 1992 Oct;12(7):98-9. Unique Identifier : AIDSLINE MED/93121802; Burke DS
1992 annual meeting scientific program summary.: Del Med J. 1992 Dec;64(12):751-4. Unique Identifier : AIDSLINE MED/93122326; Martz EW
Validation of removal of human retroviruses.: Dev Biol Stand. 1992;76:215-23. Unique Identifier : AIDSLINE MED/93122344; Marcus-Sekura CJ; Center for Biologics Evaluation and Research, Food and Drug; Administration, Bethesda, MD.
Peculiar properties of mycoplasmas: the smallest self-replicating prokaryotes.: FEMS Microbiol Lett. 1992 Dec 15;79(1-3):423-31. Unique Identifier : AIDSLINE MED/93122558; Razin S; Department of Membrane and Ultrastructure Research, Hebrew; University-Hadassah Medical School, Jerusalem, Israel.; Mycoplasmas are the smallest and simplest prokaryotes capable of self-replication, with information provided by a genome which may be as small as 600 kb, estimated to carry less than 500 genes. Keeping the number of structural elements, metabolic pathways and components of the protein synthesizing machinery to an esse
Long-term therapy and on-demand treatment of children and adolescents with severe haemophilia A: 12 years of experience.: Haemostasis. 1992;22(5):251-8. Unique Identifier : AIDSLINE MED/93122636; Brackmann HH; Eickhoff HJ; Oldenburg J; Hammerstein U; Institute for Experimental Haematology and Blood Transfusion,; Bonn, FRG.; Between 1978 and 1989, a controlled study was performed on children and adolescents suffering from severe haemophilia A. Special attention was given to long-term therapy adjusted to the patients requirements. The clinical and the X-ray scores of the Orthopaedic Advisory Committee of the World Haemophilia Society were
Update of 156 episodes of central nervous system bleeding in hemophiliacs.: Haemostasis. 1992;22(5):259-67. Unique Identifier : AIDSLINE MED/93122637; de Tezanos Pinto M; Fernandez J; Perez Bianco PR; Fundacion de la Hemofilia, Instituto de Investigaciones; Hematologicas. Buenos Aires, Argentina.; Between 1960 and 1991, 156 episodes of central nervous system (CNS) bleeding were documented in 106 patients from a total population of 1,410 hemophiliacs (7.5%). Ninety-one hemophilia A patients presented 131 bleeding episodes; 15 hemophilia B patients had 25 episodes. 32% of these episodes took place in patients les
Financial assistance for HIV-infected persons with haemophilia worldwide.: Haemostasis. 1992;22(5):293-8. Unique Identifier : AIDSLINE MED/93122641; Schimpf K; Stiftung Rehabilitation, Heidelberg, FRG.; In many countries we could note the dramatic developments in regard to financial assistance of HIV-infected haemophiliacs and their families since we distributed the first overview on this to all World Federation of Hemophilia member countries. As a result of the untiring efforts of the National Haemophilia Societies,
La Paz Hemophilia Center, 1967-1992: people, events, and memories.: Haemostasis. 1992;22(5):299-304. Unique Identifier : AIDSLINE MED/93122642; Martin-Villar J; Hematology Service, La Paz Hospital, Madrid, Spain.; In 1967, once urgent blood requirements had been resolved in La Paz Hospital, Madrid, Spain , and adequate supplies of plasma for cryoprecipitation, therefore, being available, a Hemophilia Unit (later Hemophilia Center) was set up to attend to the comprehensive care of hemophilia pa
Negative and positive developments during the last 25 years.: Haemostasis. 1992;22(5):305-8. Unique Identifier : AIDSLINE MED/93122643; Alonso Gomez J; World Federation of Hemophila, Madrid, Spain.
AZT: hope for many, help for few.: Health Soc Work. 1992 Nov;17(4):253-60. Unique Identifier : AIDSLINE MED/93122656; Wright EJ; Bodnar J; University of Medicine and Dentistry of New Jersey, University; Hospital, Department of Social Work Services, Newark 07103.
An experiential program to reduce AIDS risk among female sex partners of injection-drug users.: Health Soc Work. 1992 Nov;17(4):261-72. Unique Identifier : AIDSLINE MED/93122657; Rhodes F; Wolitski RJ; Thornton-Johnson S; Psychology Department, California State University, Long Beach; 90840.; This article describes the development and implementation of an acquired immune deficiency syndrome (AIDS) intervention program for female sex partners of male injection-drug users. Four psychoeducational workshops were designed to motivate personal risk reduction, provide participants with necessary cognitive and beh
Connecting the disconnected: adult day care for people with AIDS in New York City.: Health Soc Work. 1992 Nov;17(4):273-81. Unique Identifier : AIDSLINE MED/93122658; Smith MY; Knickman JR; Oppenheimer LM; Health Research Program, Robert F. Wagner School of Public; Service, New York University, NY 10003.; Despite pressing need, the development of a continuum of long-term-care services for people with acquired immune deficiency syndrome (AIDS) has been hampered by the dearth of information on the characteristics and service needs of patients eligible for such care. This article presents findings from a process evaluatio
AIDS: social work and mandatory screening.: Health Soc Work. 1992 Nov;17(4):308-12. Unique Identifier : AIDSLINE MED/93122662; Goldberg JE; LCSW, BDC, Bethesda, MD 20817.
[AIDS encephalopathy--helped by azidothymidine? Primary and secondary cerebral manifestations (news)]: Fortschr Med. 1992 Nov 30;110(33):70-1. Unique Identifier : AIDSLINE MED/93122713; Hartung HD
Mycoplasma fermentans (incognitus strain) induces TNF alpha and IL-1 production by human monocytes and murine macrophages.: Immunol Lett. 1992 Sep;34(1):27-30. Unique Identifier : AIDSLINE MED/93122849; Gallily R; Salman M; Tarshis M; Rottem S; Lautenberg Center for General and Tumor Immunology, Hebrew; University-Hadassah Medical School, Jerusalem, Israel.; We have demonstrated that Mycoplasma fermentans (incognitus strain), as well as M. fermentans KL4, PG 18 and IM 1 strains have the ability to activate human peripheral blood monocytes and murine macrophages of two inbred strains to secrete a high level of tumor necrosis factor alpha (TNF alpha) in a dose-dependent man
HIV-2 antibodies in serum samples from Maharashtra state.: Indian J Med Res. 1992 Sep;95:213-5. Unique Identifier : AIDSLINE MED/93122872; Kulkarni S; Thakar M; Rodrigues J; Banerjee K; National Institute of Virology, Pune.; Two hundred serum samples were tested to detect the presence of HIV-2 infection in Maharashtra state. The serum samples were derived from various groups including those with high risk behaviour for HIV infection. All samples were tested by three combined HIV-1 and HIV-2 ELISA kits. The reactivity was confirmed by LiaT
Resource allocation in relation to health problems.: Inforum. 1992;13:13-4. Unique Identifier : AIDSLINE MED/93122905; Powell K
In situ neutralization in Boc-chemistry solid phase peptide synthesis. Rapid, high yield assembly of difficult sequences.: Int J Pept Protein Res. 1992 Sep-Oct;40(3-4):180-93. Unique Identifier : AIDSLINE MED/93122966; Schnolzer M; Alewood P; Jones A; Alewood D; Kent SB; Scripps Research Institute, La Jolla, CA.; Simple, effective protocols have been developed for manual and machine-assisted Boc-chemistry solid phase peptide synthesis on polystyrene resins. These use in situ neutralization [i.e. neutralization simultaneous with coupling], high concentrations (> 0.2 M) of Boc-amino acid-OBt esters plus base for rapid coupling,
A rational design of synthetic peptide vaccine with a built-in adjuvant. A modular approach for unambiguity.: Int J Pept Protein Res. 1992 Sep-Oct;40(3-4):214-21. Unique Identifier : AIDSLINE MED/93122969; Defoort JP; Nardelli B; Huang W; Tam JP; Rockefeller University, New York, NY.; We describe a peptide vaccine model containing a built-in adjuvant. This model used a multiple antigen peptide system (MAPS) to amplify peptide antigens and a lipoamino acid, tripalmitoyl glyceryl cysteine (P3C), as a built-in adjuvant. An 18-residue peptide antigen (B2) derived from the third variable domain (amino a
HIV protease (HIV PR) inhibitor structure-activity-selectivity, and active site molecular modeling of high affinity Leu [CH(OH)CH2]Val modified viral and nonviral substrate analogs.: Int J Pept Protein Res. 1992 Sep-Oct;40(3-4):274-81. Unique Identifier : AIDSLINE MED/93122977; Sawyer TK; Staples DJ; Liu L; Tomasselli AG; Hui JO; O'Connell K; Schostarez H; Hester JB; Moon J; Howe WJ; et al; Upjohn Laboratories, Upjohn Company, Kalamazoo, MI.; This report details the structure-activity relationships of the HIV gag substrate analog Val-Ser-Gln-Asn-Leu psi[CH(OH)CH2]Val-Ile-Val (U-85548E), an inhibitor exhibiting subnanomolar affinity towards HIV type-1 aspartic proteinase (HIV-1 PR). Our data show that the P1-P2 tripeptidyl sequence provides the minimal che
[Classification of findings and staging in infectiology including AIDS]: Internist (Berl). 1992 Nov;33(11):746-53. Unique Identifier : AIDSLINE MED/93123033; Loscher T; von Sonnenburg F; Abteilung fur Infektions- und Tropenmedizin,; Ludwig-Maximilians-Universitat Munchen.
Cerebrospinal fluid (CSF) analyses in HIV-1 primary neurological disease.: Ital J Neurol Sci. 1992 Nov;13(8):667-83. Unique Identifier : AIDSLINE MED/93123056; Nogales-Gaete J; Syndulko K; Tourtellotte WW; Depto de Medicina, Facultad Medicina, Universidad de Chile,; Santiago.; This paper will focus on CSF findings in HIV-1 Neurological Disease (ND). Why use CSF as exploration window of the HIV-CNS involvement? Traditionally, CSF analysis has been an effective diagnostic method as well as a means of monitoring treatment in several infectious and immune pathologies of the CNS. Consequently th
Caring for the professional caregiver: the application of Caplan's model of consultation in the era of HIV.: Issues Ment Health Nurs. 1992 Oct-Dec;13(4):357-67. Unique Identifier : AIDSLINE MED/93123073; Carnes BA; Nurses as well as other health-care professionals have been impacted by the current human immunodeficiency virus (HIV) epidemic. Issues related to virus transmission, voluntary testing, and professional requirements to provide care for those infected can trigger emotional as well as cognitive responses for all involve
Accident prevention: the health visitor's role.: Health Visit. 1992 Oct;65(10):340-1. Unique Identifier : AIDSLINE MED/93123082; Levene S; The health of the nation white paper sets targets in five key areas for reductions in both mortality and morbidity: coronary heart disease and stroke, cancers, mental illness, HIV/Aids and sexual health and accidents. In a series of articles in Health visitor, experts will be considering the opportunities the white pa
Beyond simple pooling for HIV screening.: J Immunoassay. 1992;13(4):545-57. Unique Identifier : AIDSLINE MED/93123473; Gwa LH; Hsieh CC; Ko YC; Lan SJ; Department of Epidemiology, Harvard School of Public Health,; Boston.; We discuss some theoretical features underlying the successful uses of pooling in testing HIV seroprevalence. In particular it is shown that there is a scaling relation for the distribution of positive sera among the pools. A multi-stage pooling method consisting of repeatedly halving the positive pools is proposed. C
Search for retrovirus in the chronic fatigue syndrome.: J Clin Pathol. 1992 Dec;45(12):1058-61. Unique Identifier : AIDSLINE MED/93123477; Gow JW; Simpson K; Schliephake A; Behan WM; Morrison LJ; Cavanagh H; Rethwilm A; Behan PO; Department of Neurology, University of Glasgow, UK.; AIM: To examine peripheral blood and skeletal muscle from patients with chronic fatigue syndrome for exogenous retrovirus. METHODS: Blood samples from 30 patients and muscle biopsy specimens of 15 patients were examined for retroviral sequences by DNA extraction, polymerase chain reaction (PCR), and Southern blotting